Sorex_araneus Locus UBE4A
snOPY snoRNA Orthological Gene Database
Sorex_araneus UBE4A
Sorex_araneus
UBE4A
GeneScaffold_6907
SNORA11
26081..26204
38477
CCAGAAACTGCAGAGGGGCCATTGCAATAGGACAGCAGGTAGGGTGCCTGCCTTGCTCA
CAGCCGACTCGGGTTCAATTCCCGAAAATTCTATATGGTCCATTGTGCCCACTGTATAGA
GCCAGTAGAAGCTCTTGAGCATTGCCAGGTAGTTATTACCCCCTCACTATCCCTCTCCCC
CCAGAAAATGAAGAAGGAAAACTGCTACAGAGGATGATGAAGCCATAGGTGGAGATAGCG
CAGAATGGTCGAGAAGGGCCAAGAGATATAGCACAGCCCTTGCTTTGCACATGGCTGACC
AGGGATCAATTCCCAGCATCCCATTTGGTCCCCTAAGCCCAACCAGGAGTGATTCCTGAG
TGCAGGAGTCCAGGAGTAACTCGAGTATCCCCAATTGTGGCAAAAAAAAAAAATTGTAAA
GAAATATTATAGGCCTTTCTGGAGCTGGAACAATAATAGTCCAGCTGGTGAGCGCTTGCC
TTGCTTGCAACCGACCCGAGTTTGATCCCTGGCATCCTATTTGGTCCCCCAAGCACTGCC
TGGAGTAATTCAGAGTGTAGAGCCAGGAGTAGCCCCTGAGCATCATGGGCATGGCCCAAA
AACAAACCAAAAAAAGAATGAATAAAATGTAATGTCTCCAGCCACCAGCCACTGCACCTG
CCCCTTCTCCGTTGGCTGGTGCGGCCCAGTGAAGTGGTGAGGCTTAACCCCAGCTCAGGA
TGCAGGGCTGTTCTTCACGGGGCTGGCTGTGCCAGGAGCATGGGAACAGCCTGAGTGGAC
GAGGGGTTTGGCCTCAGATCCACTATGGTTGGGTGGTGGGGCAAACTTGTCAGTTTATCT
TTCCCACAGGAAACAAGTAAATCCAGTTTAAGAATAAAATGTGTTTGAGAAACGGGGAAG
AACAAGTTCTCAGATCTGTTGCCTGTTCCCAGCCGCATCTAACCCCTGCCCTTTCTCTAG
CCCCTCCCTCTAGGTCTGGATGGAGGATACGTTACAGTGAAATGACAGACCAGGAGAATA
ACAACAACATCTCAAGTAACCCCTTTGCTGCTCTCTTTGGCTCTCTGGCCGATGCCAAGC
AGTTTGCAGCAATCCAGAAAGAGCAGCTGAAGCATCAGTCCGGTAAGCGGAGCAGCCTGC
ACAGGGGCCCAGCTGCCCGACCCATCTCCCCACCTCCCCCATGGCTGCTACTGGGGGGGC
CTTGGCTGAGGGTGGGGGTTAAAGTTGGGGCACATGCTGTTTTTTTGTGTTCATTGAGAG
CAGAGTGACTTTTTGTTTGTCATGGGGTTCTCTCCTTTCCTTCTACCCACTGTGTGAAGA
GACCAGGTGTTTCTGTAGTAACAGGAGCCAGTACAATCAACCCCCCCCCACACACACACA
CACACACACACTGCTTCATTAGGTAAAGTGTCCAGTATTGAAATGCTATTTAGAAGTTGT
ATAACTAGGGCATCCTATATGGTCCCCAAAGAATGCCTTGCAAACAGCCAACCCAGGTTT
GATCCCCAGCATCCCATATGGTCCCCTGAGCCTCCCAGGAGTGATCCCTGAGCACAGAAC
TAGGAGTAAGGCCCTAAAGCCAAAGAAAAATTAAAATATGCAATGGTTGAGGGCCAGAGA
GATTGTACAGTGTGTAGGGCGTTTGCCTTGCATGCAGCCAACCCAGATTCGATCCCCAGC
ATTCCATATGGTCCCTCAAGCCCCACCAGGAGTAATTCCTGAGTATAGAGCCACATATGA
CCCAAAAGGACAAAATAAGGTAAAATATACAATGGTTGTTTTTTATTTTTTTCCTTTTTG
GGTCATACCCGGGCGATGCTCAGGGGTTACTCCCGGCTCTGCACTCAGGAATCACTCCTG
GTGGTGCTCAGGGGACCATATGGGATGCCGGGGATCGAACCCAAGTCGGCCACGTGCAAG
GCAAATGCCCTACCTGCTGTGCTATCACTCGGGCCCTACATGGGTATTTTTTTTTAAAAC
TATTTAATAACCTTTTGAAATAGGAAGTATAAAAAGCATGTTGCGTGCAGCCTCAGGAAA
CAGACTGGAAAGGGAGAAATGTAGAAGCATGTGGCCTGAAGACCCATAACTGAGACCAGT
TCCTGAGCCCTGTGCTCGAGAGCGTCAGGCAGAAGGCCGCCTCCATCCCACACCGTGGGC
CTGGGGTAGCTTCCTGCTTGCAGAGGGGCAGACTAGAAGACTGACCCTGGGCCTTTGGAA
GAGTGAGTGATGTCTCCCTGGTGAGGTTAGCGTCTTGCCAGGGACCCCGCCAAAGGGGTC
AGGTGAAACCTTCTGCTGCAGGGGCACAGCTGGACCAGAGTTGGGGGTACTTCGTCTTCT
GAGGGTGTTCACATTTATTTCAAGCTGAAATTGCCCCCCCCCTTCCACCCTCCACCCTCC
CTCAAATAGTGGGTTGGGTTTAGTTTTTAGGAAAAAAGAAATGTTTCCATTTTCCCTCTG
TTTTTTTTTTTTTTCCAATTACATCCAGATGAACCCCAGACCTAAATAAGTAAACTTTAA
AAGGTGCCTGTCGGGGCTGGAGTGATAGCATAGCGGGTAGGGCGTTTGCCTTGCACGCGG
CCAACCCGGGTTCAAATCCCAGCATCCCATATGGTCCCCTGAGCACTGCCAGGAGTAATT
CCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCCAGGTGTGACCCAAAAACCAAAA
AATAAATAAATAAATAAAAATAAAATAAAAGGTGCCTGTCGAGATGGCAGGCTGGCGGGG
CGGGGCGTGTAGGAGGGGGATCCTGAGAACACAGGTGGGGGGAAGAGGAAGCTGGTGGCG
GGATCGGCGATGGAACATTGTCTAAAACCCAACTACAAATAAATCCCGATGCTCTCATAA
AATAGAAAGTGGGGGGACATCATGTTCAGATGAAGGGCTGAGTTGGTAGCGTTACTCTCT
GGGAGGAAGGGTATGGCAGGTCAGTAGCAGCCTGGGTGATCGGTGAAGCACAGGCAAGAT
CAAACCATACTCTCTTATTTCCTCTCATGCCGGGATCAATTCTGGGGCCTCCCATGTGTC
CCAGCCAGTGGGGGCCACACCCAGCAGTGCTTGGGGTCAACCACATGTGAGACCGGAGCT
TCCTGTCACAACTTGTTAGTGATTTCTTATTCAAGGTCCTAATGGCTCCAAGGTGACACA
CAACAATCGTTACACACTTTCCTCAAAGGAAACGTTTTTGGATCATTTTTAGCGAATTAT
TCATAACAAGCTATGCAAAATAAATTATGTAGGTCCTGCTTTGGGAGCAGGCTTTGGGGA
TGATGGGAATATTCGAAATAATGGTGGTAGGAAGGTATAATGATGGTGGGATTGGTGTTG
GAATATTGAATGTAATAAATTATTATGAACAGCTTTTTAAAAATTTTTTAAATAAATTTA
AAAAAAAAACAGAACTTCAGCCCCTGTACCATCTCTCTGGCCCCATTGTTGAATTTTTAA
CATGGTCCCAAAGGGCAGCTCTGGATGTCAGTGTCTGACATCTCTCCCAGAGGTCACCAG
GCTCCCAGTGGGAGATAACAACTTAGGGGATGTTCGTAGGACAGGACGGAGAGCGTTTGG
GAGATCATTTATGAGTATGGGGTCAAGGGAAGTGTCACCAGATAGGTTCCCAACACCTGT
CACCATTGGAATTCAGAGGATAAGTTGGCAGGGTAAGAGCGGAGAGGCAGAAGGCTTGTC
TGGGAGGCTGGCTTGAGCCAGGAGCAGCGCAGGCACCCAGCAGCTGGGGCCCAGTGTGCT
GCGTGCCTCTGTGACAGCTTTGGCTACTTCGCACCCAACAGGCCCTTTGTTTTGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCCGGCAATTTCTCACCCACTGTTCC
TACTACTGAGTACGCTAAAAAATCCAAAAGAACTCTCCCGCTACTGGCGACACACCAGAC
AGACAGATGGGGAGGAGCCCCTCTGACAAATCACAGCCGGGGCCACATCTGCCTCCCCAC
CTCTGATTGACAGGGGCCGTATCAAACAGTCATGCCCACCCATATATGTCTTCGTTTTGG
CTTGATTTCCTGCGGGGGTGCTAAGAGTCAAGTAGTTGTTATAGAGACCAGATGGCACAT
CAAGCTGAGACATTTATCATCTGGTCTTTCATAGGAAAAAGTTTATGGACCCCTACTCTT
GAGCTCTGTAATGCTTTCAGCAGCTTGGCAGCTTCCCAAGAAATGGCTCCTAAGTGCCCA
GAATTTTTTATTTTATTAGCACTGGGGTGCTGAGTCAAAAAAGAGTGAGGGAAAGAGGTT
TGAATGTGTATATTTCTAGAAATTACCAGGTGCTAAGGTTTGGGGGGTAGTGCAGGTATC
AGGGGTTGTGCAACTAGAATGTTCTGTGGTTCTGTTTCCTGGCTACACAGTTCATGGCTC
AGTTCCATGAAAAGATCTACCAGATGCTGAAGAACCTGCTGCAGCTCTCTCCCGAGACCA
AGCACTGCATCTTGTCCTGGCTGGGAAACTGTCTGCATGCAAACGCAGGCCGCACCAAGA
TCTGGGCCAACCAGATGCCAGAAATCTTCTTCCAAATGTACGCCTCGGATGCCTTCTTCC
TGAACCTGGGTGCTGCCCTCCTGAAGCTCTGCCAGCCATTCTGCAAACCCAAATCCTCTC
GGCTGCTCACCTTTAACCCCACTTACTGTGCCCTGAAGGAGTTGAACGACGAAGAACGGA
AAATTAAGAACGTCCACATGCGAGGTAGGGGAGGGGTGGGCTTCTCACAAACTGAACGTC
AGTTCATGTTGTATGTGTTTGTCTATGCAAGAGAGGCGGGGGGGAAGGGAGGGAGAAATC
TAAGGCCTTCACTTGCTTAGCCTTTTTCACGAAATTCCCCCTTTTTTACTGAAACAAGAT
GAGGCAGAAAGAATAGTGATTTAATTTTAAAGACCCAAACAACAAAAGCACCGATTGCTG
TCCAAGTGCTGTGCGTTAGTGAGACATCTCTGAAGTTGGCAGCCTTGGGTAGTTCTTTGT
TCATTTTTCTTTTTGGTTTCTGAGCCACAGCCAGCAGTGCTCAGGGTTCCTTGTGGCGCT
CTCTTTCAAATTATCGAGCTTTCTTCCTGGCCCCTTTATTTATTTTTTTTGACAGTGCTC
AGGGACATGTGGGATGTTGGGGATCAAACCCAGATCAGTCATGTGCAAGGCAGGTACTCT
GCCCACTGTAGTATTTCTCCAGCTCCCCTTTATTACTTAAAAATATATATATATATATTC
TTTGTTCTTTCTTTTTTTTTCTTTAACTCAAGAGACTCCAGAAGAAGACAGGTAGTTTTA
CAGAAAACGGTAATATGGTTTAGTATTAAGCCAGGCGAGCACAGAAAAAGTAGCAAATAA
TAAATTCTGCAGATGTTAAAATAAATAAATTCTGCAGATGTTGAGATCTTTATAGCTTAG
TCCTGCGAGGTGAGTGTGGGTTTTCAGGCACAGAGGGAAGAGCCAGTGTGATGGTCCAAA
GCTGTGGAAAGATTTGACAAAAGCAGCATGAACAAATTGGTGTGGCTCAAGAAAGATTTG
GGGAAGGACAGGAAATATGACAGGGAAGTAAAGAAGATCAGAACTGGGTAAGAGGAAACT
TGGACAATACAGAAAAGTGAAAAGAAGAAAGTCAGGCACTCCTGATTCTATCTTCAACCT
TTTTTTTGGTTCTTGGCCACACCTAGCAGTGCTCAGGTCTTCCTCCGAGCTTTGCACTCA
GGAATCACTCCTAGAAGCCAGGGATCAAATCCAGGCCAGCCACATGCAAGGCAGGTACCT
TATCCACTGTATTTTAACTCTGGCCACCTTTGTAATGTAACTTCAGCGTATAAAAAAGAA
TCTTACATATTTAAAAGCAAATAAACTGGGGCTGAAGAGATAGTAGTCAGTAAGGCACTT
GCCTCGGATGTATCTGACCCAGGTTCTATCCCTGGCACCACATGTGGACCCTCTTGGACC
CTCCCGGAGTGATCCCTGAGTTCAGAGCCAGCAATAAGCCCCAACACACACACACACACA
AAGAAATACATAAAAGCATGGACTAGATCACAAATGATCCGCTGTCATGTCACTTGGAAA
AATCGACGGTGTTAATCTTTCCTCTTAAGTTTTAGTGACTTACGGTCAAATTCAAGAGGC
TTAAATGCACCTATGTAGACAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTAGCCACCGCACTCCTG
CTGGCTGGTGGCAGCATGTCGAGGAGGAGCAGGGACTCCAGTCTGGGGCCATCTCCAGAC
CTAACCTACAGTTTTAATTGCTGGGGTCAGAGAGGCAGTACAGCCATCAAGGCACTCCTG
AGTGCCTCCCCACACCACCGAAGAAAAAACTTAGAAAAAAGTTCAAGCTTTTTCTAAGAA
CAGTAGGGATTTCCATTGTCAAAATGGACACCTGGTTGCAAATTGTGGATTTCTAAGACA
CCCCTGACCTTTGTCCTTGGCGGGTGGTGGCAAGGAGGGCTGGGGATGGGGATCAATGGA
CAGAACTCGGGACAGAGATGACATACCCAGCTGTGCTCAGGGTTTACTCCTGGCTCTGCA
CTTTGATTTACCAGTCCTGACACGGTTCAGGGGGCTCTAAGGGGTGCTTGGGATGGAACC
TGTGTTGGCTGTGTACGTGGCAAGTTTCCTGTCCTCTGTACCATCACTCTGGCCCATGTC
CATCATTGGCATTTTAAGTAGGAGTGTGGATTTCAAACGTGCACAGCCTCTTCAGCCAAT
CAGCTTCAGACTGCTTTCTTGGTTTCCCACTATCACTTAGCTAACCCTATGGCTTATCGG
ACTCCGCCAAAGGACTGAACACATCAGAGGGTGTTATCCGAAGCACTGAACTGTGGGTCT
TCCTTTCACTGGGGAACATTTGCGTCATGCATCGGGAACTATCATTGAAGGTTGTACTGG
ACCACAGAAGACAGGAAGCTGCTCTTCTATTGCACCTCCAGGAGCGTCTAGCTGAGATCG
GTCCTTACTCCTTGAGCCCCTTCCAGTGGCTTCCATTCTGTTCTTTGGAGAGTGGCTGTC
CAGCTAACCCCAGCGTATTACCTTCATGGCCAGGGATGGGCTCAGTGGCCAGAGCCTAGT
CTAAGGCTCTCCACAGTACAATCATTGCACCTGTGTGGTCTCAAACTATCCCACTGCACT
TCCTGTGCTTGACCTGATACTTTACATAATAACGGCCCCCTTTGCACCTGCTCAGCCCCT
GGGCACTGGTCTTTGGTTGGTGCAGAAACCAGCTCACTTTCTGGAGGTTCCATTATTTTG
AATGTTTGATAGCGTTTCCCAGTGCTGGGAGTGGGGGCCAATGTTCTGTCAGGAACTTGT
GTGTGCCTTTCTCTCATCCGCTGCACCTCGCAGCATCCCAAATGAGAATCTTGAAATAAA
AGAGTTTTTCCTTGTTCCTGTGCCCAGCTGTTCCTCCAAGCCTGCCTGACCCAGTTCTCC
TTTCTTGGAGGCAGGTTGCATGATCAGATGGTAAAAATCAACCAGAATCTGCACCGGCTG
CAGGTTGCCTGGCGGGACGCTCAGCAGAGTTCCAGCCCCGCTGCCGACAACCTCCGAGAG
CAGTTCGAGCGACTGATGACCATCTACCTTTCCACCAAGACCGCCATGACTGAGCCACAG
ATGCTGCGGAACTGCCTGAACTTGCAGGTGTCCATGGCGGTTCTCCTGACACAGCTGGCC
ATCGGCAACGAGAGCTCACAGCCAAAGGAGCTGACCTTCCCGCTGCCGGACAGCTACAGC
TCCCTGGCCTACGTGCCAGGTAAGCAGGCACTTCCTCTTCGTACCATCTCGGTTCCCCTA
GTTCACTCTGGAAGTTGGACTTCAGAAGGCCCTTCTGTAGTCATCACTCATTGGTTTTTG
GAGAAACAAGTCCAAGTTTTAGATCCTGTCCACGGGTCAGCATACAGAGGAATCCACTGC
CTATTCCTGAGCCCCTGGGAACCCATGATCACAGGCACTGTAGCAGTGTCGTCCCGTTGT
TCATCGATTTACTCGAGCATGCACCAGTAACATCTCCATCGGGAGATTTGTTACTGTTTT
TGGCATATTGAATACGCCACAGGTAGCTTTCCAGGCTCTTCCGTGTGGGCAAGATATTCT
CGGTAGCTTGCCAGGCTTTCTGAGAGGGACGGAGGAATAGAACCCGAGTCGGCCATGTGA
TCACAGGCATCAAATGTTTTTTTTTATTATTATTATTAAAAATTAGTGAATTGTGAGGTA
CAGTTATAGACTCAAAACTTTTTAGTGGTGGAGAATGGGCACTGGTGGAGGGATGGGTAC
TTGAGAATTGTATGACTGAAACACAAGCATCGAATGTTTTTAATCTTGATTTCAAATTCT
TCCTACAGCTAGAGGGTGATTTAAACCAGTTAAGCTTGAATGAAAGTGGGGAGAAATGTA
AAAAAGCATACTTTCTTGAACTGCACTTTTGTATATACACCATATTTCATATAATGACAA
TCCCAACAATTATATTGGTTGGGGAAGAGTTATAATTAAACTTACATTCAAAGGAGATTG
TTATAGGGGCCTGAGATAATACCACAGGTAGAGCATTCGCCTTGCATGCAGCCAAGGTTG
ATTCCATCCCCAGCACCCCATATGGTCCCCCAAGCACCACCAGGAGTGACCCCTGACTGA
GTACAGAGCCAGGAGTAAGCCCTGAGCACAGGATGTGGCCAAAAGCCAAAAATAAACAAA
GGAGATTGTTACGGCTAGAGAGGTAATAGAACTAGGGTTAAGGCACTTTTCACGCAGCCA
ACCCAGGTTCCCTCCCCAACACTGATATGGTCCCCTGAGCCTCACCTGGAGGAGACTTGC
ACACCGCTGGGTGTGGCCAAGCAAAAAAAAAACAACAAACAAGGGTTTGTTCAGAGCAGA
GTGCCTGAAGAAATGGCACCTCTGTTTACACCATACCCAACAGAAATCTGGGCTCATTGA
TGAGGGGCACAAAATTTGCCACCTTCCAGTGACTACCCTACATTTGTCTAAAAATAAAAT
ATTTTTTTAAAAAAGGAGATTCTGTACTTAATAATTTAGAGCAATTCTGGGTACCCATAA
AGACATTTTGGTGTTTGGTTTTTTTTTCTTTTAACCTTTGAACAAGTTGGATGAAAGGGA
GGAATTTCCCCGTAGTTTAGTACAAATGTTTTGCTCATTCTGGTGACCGTTTTCTTCTTC
CAGAATTCTTTGCAGATAACCTGGGGGATTTCCTCATTTTCCTCCGCCGCTTTGCTGATG
ACGTCTTGGAGACATCAGCAGACTCCTTGGAGCACGTCCTTCACTTTATCACCATCTTCA
CTGGAAGCATAGAAAGGTAAAGTGGCAAAGGCCCAGCTCTGCTGCAGCTTGATAAACAAG
GCCTCCAGAAACTGGTTAACGCTAGCAAATTAGCTGACCTTACCGGTAGCCGAAAATGCC
TCTCCTGAGAGGCATAATCAGCAAAGGACTTAGTCCACAGAGAATTTGAACCTGCATATA
AGGTACCTGAGGGGAATTCATTCCACTGCCGGCCCCTGGTGAAAATAGTTACCTTAATGC
CAGGAACCTTTCCAGGCAGCTGGTGCTGACGATCTACTAATAGTTGTATGACAGAATTTG
CTCTTGAAATTCAGAGTGAGAGAAACAGGGAACATGAGGTAGATGTTTTTTGACCTCTCT
GGTGCTTTTTCCTAAAGGAAGATACTCCCAGTGATCCGTGGAGTTCTCTGAATTTTGTTT
ATTTAGTTTTTTGTTAATGGGCCATGCCTGGCAGTGCTCAGTTGTTACTGCAGGCTATGC
ATTCAGGAATCAATCCTGTCAGGGCTCGGGGTACCCTCACAGGGTGACAGGGATTGAACC
CAGGTCAGCCACATGTAAGCAAGAGCCCCACTCACTGTACTAGCACCCAGGCCCCGTTTC
TCTAATTTTTGCCAAATTTTTGCCAAAACAAAACAAAAGCCGTATGTGGAATTGAGGTTC
TGCTGTACACAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAAGCAGCCCCCCAAAACGAGCAAACAAATTTAACACATTTTTTTTTAATAAAAG
GGAAAATGACTAAAAGGAAACTTCAATCTTGATCCCCTCTTTGATGAGCTGTGATTTCAT
GTGTTAAATGGGGTCCCCTGGATTAACCCCCAGAAGTTCACAGACTTAAAGTTAGAATCC
TTCTCCCCTCCCCGACCTCAAACCCTCCCCCGCTCTGCCCCAACATGGTAATAGGGTATT
TGGCTCCTCCGTAGAAGAAACTGTTCAGCACATTGGGAGTTTGTTTCCTTCTGGCTTATC
TTACTGTCTGCTCTGTTGGCAGGATGAAGAATCCTCACCTAAGAGCCAAACTGGCCGAGG
TGTTGGAAGCAGTGATGCCCCACCTGGATTCAGCCCCGAGCCCCCTGCTGTCCAGTGTGT
TCCACCGGAAGCGCGTGTTCTGCAGTTTCCCCCACGCCCCACACCTTGCAGAAGCGCTAA
TCAAGGTCTTCGTGGATATCGAGTTTACAGGTGAAGCAGTGCGGAACTGACAAGCTGTCT
GGGGGGCATCCCATGCCCTGGCCAGTACCAGGGTGTCCAAGACGGCCTCTCTTAGCGAGC
CCCGGCCGTGCCCCAACCTTTAGGCTCGGTACTGTTTTTCACCTGATCTCATTATGTGTC
AGCCTCTAGAGCGTTGTGCTGTATTAGCCCCACTTTTCACACAAGGACGTGGATGCTCAG
AGTGTTGGCCTGCGTCGTGCAGCTGCCCGGTAGACAGGTTTGTCTCACCTGAAAATCACG
CTCTCTCTTCTGGAGAGATGGTACAGTGGGCAGTGCACTTGCCCTGTATGTGGCCAGCCT
GGGTTTGGTTCCTGGCACCCTGTACGGCCCCTGAGCCCTGTCAGGAATAAGCCCTGAGCA
TCACTGGATGTGGCCCTCCCCCAAAAGAGAAGCACTGTCTAAGCAATTGGATATATCGTA
CTCACACTAATTAGGGTCATTGAGCTTCTCAACATGAGGTGCGTGCTCTCAACTTTCTCC
CCGTCTGGCGAAGGTGGGATTCTCTCGTGAATGTCTCATTCTCACTCTCCACCCCCTGCT
AAAATTACAGACTAAACCAGGGAAATAGCTCAAAGTGCTGGAGCGGTGCATGCTCAGTCA
CTGGCACCACACAGTCCCCCCAAAACAACACCTCTGCTCCCCATTAAAATTGCAGTGTGG
TAGATAATGACATAATGTGCTGATGGGAATTTGGTGGTGGTTTTGTGTTTTTGTTTTGTT
TTGTTTTAGTCTTATCCAGACTATCTTGACTTTCATGATCTCATTGTTTGAGAATAACAG
CAGATATGCTTTCTCCTTTGGCCTCATGAAATACAGCCTTGAGATGATGTCAGAGGAAAC
AATAACTCTGGCTCAACTCCCAAACAAAATGTGTTAACGAGTTATTTAAGACCTTCTTTT
TATGTTTAAGTTTTGGGATTTTTTTTTTTCTTTTTTGGATCACATCCGGCGATGCTCAGG
GGTTCTCCTGGCTCTGTACTCAGGAATCACTCCTGGCAGTGCTCAGGGAACCCTATGGAA
TGCCAGGGATTGAACCAGGGTCAGCCGCTAGCCAGGCAAACACCCTCCCCACTGTACTAT
CACTCTGGCCCTTCTTTTTAAGTTTGTTTTGGAGGCCACACCTAGAAGTGTTCAGGGGCT
ACTCCTAACTTAATGCTTCAAGGTCACTGCCAGTGGTGCTCGGGGGGACCATACAGTCCA
GGCCTCAGGCCCTGGCCTCTCCTGCAAAGCATACACTCAGTCTGCCACACTCGCTAAGGG
GGATGCCCTGCTATTCTGCAGGAGCAACTCCCGCCCCTTAACGAGGCAGTTCACAGTGCC
AATGGCCTTTCTAGCTTTCATTTGACTCTTCACCTCTGAGCCTTACTTTCCTCACCTGCC
CAAAAGGATTTAAGTGCCCAATAGCTGGACCGGGAGGTAATTTAATTGGTAGACCACATA
TGTGCCCAGCAATTGCTAGGCCCTGAGATTGATCCCCAGCCCAAGCGTACCTGGGTATAG
CCACAAATATAATTGTTCCACAGTACAGGCCAGAGAGAGAGTACAGGGATAAGGTGCTTC
CAGCTTAGTACCTTATACCACATATGGTACCCCAAACTCAGCCAGGAGTGATCCCTAAGT
ATAGAGCCAGATGTAAGCCCCAAGTACAGTTGGTGTGACCCCAAAATAAACAAAAAGAAG
CAACAGCACAACAAATGGCTGAAATTATCTCCCAAAACAATCCATTACACTTCCTTTGTT
ATTCCGTGCAGGTTTAAATGGTGAAGCACCTTGCATCAGTGGCAGGAGCCCCGCCCTCCT
AGCTCAGGCCCCTGTTCTTTCCCTTTTACATGCCACAGCCCGCAGAGTCAGGGCCGGGTT
TGGCATGGCAAAAGCAGTACCGACTTGCCATTTTCAGCTCGTCTGTGTGCGTTTTGTCGT
TGTTGTCATTGTTTTGATTTGGAGGGAACACACTTGTGGAGCTCAGGGCTCAGTCCTGAC
TCTGTGGCCTGGTATGGAATCGCTCCTCGTGGCATGATCGTGGAGGGGACTGGCAGCATG
TTCAGGGAACCCTGTGGTGCCAGGGATCAGGCCAAGGGCTCCCACGGGTAGGCATGTGCT
TGGCCCTTAAAGCTCTCCCCAGCCCTCCAGTGGATGTTTGTTTGGGGGCCACATCTGGCA
GTGCTCAGGACTTATTCCTAGCTCTGTGCTTAGGATTACTTCTGGCGGGCTCAGGGGACT
GTATGGGGTGCCAGGGATTGAACCCAGCTTGGCTGCATGCAAGGCAACGGCCCTCCCGCT
GTACTATTGCTCTGGCCCATCCGGGGGCTTTTATTGGACACACGGTCCATGTCCTTCTCT
GTGAGGACAGCTTCACATCTGTCTGCTCTTAGCCTGTCAGCAAGGAAACAAGGGAAGGCT
TGGCTGGAGGCTGTGAAAACCCCCCTGTAGGCTTGTCCCCACACTCAGCTTTGGTCAAAG
CTCCCTGTGTCTAATGGAGCCATCTTTGTTGGTTCTCCCCTCACTCCCCTCACTCCAGGA
GACCCGCATCAGTTTGAACAGAAGTTTAATTATCGCCGCCCCATGTACCCTATCCTGAGG
TACATGTGGGGAACGGATCCCTATCGAGAGAGTATTAAGGTGAGAGGGCTCAGGGGGCTC
CAAAGCTGGGTTCCTGAACCACCAGGGTGGTGATTGCTTCCCTTTTGGTCTGTGACATAC
AGGATTTAGCAGACTATGCCTCGAAGAACTTAGAAGCCATGAACCCCCCACTTTTCCTCC
GCTTTCTCAACCTGCTAATGAATGATGCCGTCTTCCTCTTGGATGAAGCCATACAGGTAA
ACAGAGAAAAAGTGGTGTCACCAAATCATCCTTCGTGCAAACATTTTTTCGTTTTTCTTA
TTTTAGTCTTTTAAGCAGACGGGAGGGATCTACTGCTCTAGTACTTATCCTGACGCCACA
GGCCTTGGGCTCCAGAAACCCGTGTGCGGGTTCCATGGACCAGGGTGTACTTCATGACGG
GTGGAGGAGAAAGTGTGATGAGGCCAAATGCAGGCACATGGCAGGAGGATCTTGCTTTTT
TCCTCAGGGACTCGTAACTTCTACCCCAGCCTGTCAGTGACAGGGGCTTCCTTGGCAATG
ATTCTCTAGCCCTCTTCAAGACTTGATTTTTTTTGTTGTTGCTTTTTTTGGAGTCACACC
CAGCAATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACCCCTGGCAGTGCTCA
GGGGGCCATATGGGATGCTGGGACTCAAACCTGGGTCAGCCGCTTGCAAGGCAAATGCCC
TACCCGCTGTGCTATCACTCCAGCCCCTGATTTTTTTTTTTAATCACTTGTTTGGTTTTG
ATTTGGGGCCACACTCAACCATGCTCAAGGCTTCTTCCTGGTGCGGTGCACAAGGGTTAC
TCCAGGTATGTGCGGTGCTGGGGATAGAACCCAGGTTAGCCACATGCAAGGCAAAATGCT
CCACCCACTGTACTGTTTGCCCAACCCCTTGGAAAACAATCTCTGACCTAGGATTTTCTT
TTTTTCTATAGAAGGACTCTAAAACCAATATCCCTCTCTCTACTGCCTCTGAAATCTAAT
CAGATTCTTTTAGGGTTTTAGATAGGTTTTCTTAGAAAACAAAACAATCATAGAACAAAC
TGGCCCTTCTCAGCAGGAGCATGCAACAGAAAGACCCTCGAGTTCCAGGGCTCAAGCCAG
AGTGCAGCTGGGAGGGCGCTTCCCTCGCACGCGGCCCACTCAGGATTGATCCCTGAGCCC
CGCCGGTGTGGCCCAAAACCAAAAAAACTTGGGCTTTCCTACGCTGTTTCCATGGTCCCT
CACAATTTCTTTTCTTTTTTGTTTTTAATGAGGGGGTCATTCCCAGCACTGTTCAGGGGA
CTTATGTGGTGCCGGGAAAACCGGCACCCGGAGTCCCAGCACACTCTCCATCCCTGTCCT
TGGCCTCAGTTTCTCTTGAAGCTTTCCCTGTAAGCAGAGGAACCAAGGCTCGAGGCTCTT
CCCCAACTCTTGGGATTTCCCAGCCTAGTGCACTAGGTTGGAAATTGGCCCTCTTCAACA
TCAGCCTCCCTTTCTTCCCTGGCCACAACCCTGCTCTGATTTCTGCAGTATTTGAGCAAG
ATAAAGATTCAGCAGATTGAGAAGGACCGTGGCGAGTGGGATAGCCTCACGCCAGAAGCC
CGCCGGGAGAAGGAGGCCGGCCTGCAGATGTTCGGACAGCTGGCCCGTTTCCATAACATC
ATGTCCAATGAAACCATCGGCACCCTTGCCTTTCTCACATCAGGTAAGAGTCCAGGGCAC
CGCATGTCCAAAGCGGCTGTGGTCAGCCCCTGAGGGTCTGGACACAGGGCATCCCCACAC
AGCTGCCCATCCGGAGGGCAAGTTAGCCACATGCAGAATCAAGTGAAGGAGGGATGATCA
GAAAATGTTCACTGGAAGGTGTGAGACCTTTTGGGGGACCCCCAGCAGCCCAAAATAAAA
CATTAATTCTGAATAAATGTGGCAGTCACTGTTCAGTTCAGCGGCCCCTTGCACAGATAT
GTCAAATGTGGCTAGTCTGAGCAGCCTCTGTCCTCGGGCCAGCCCAGGTAGCAGAGAATG
ACGGGGTCCACAGGCCTCACGAGCATCACTTGGGAGACCAAAAATAAGAAAAGGTTATAG
GGGCTGGAGAGGGGCTTCAAGGGGCTCTGTGTGGGGCACCTGGGCTTGACCCACAGCACC
ATATTAGTTTCTTTTAATAATTTAAATTAAAAGGGGGTAAGTCATTGCCATCATTTAGAA
CTCGCTATGATTTAGGTACTTGGGGGAGGACAGTGCTTGGGGGCTGCTCCCAGCTCTGTG
CTCAGGGGATTGTTCCCAGTGATGCTCAGGGCACCATGCTGTGCCAGGGGTCCAACCCAA
GCATCCTGCTGGCCAGGGTGTGCTCAGTATGTTCTCCAGAGCCTAGGATTTAAATAGTCT
ATAAATGGGCTTTCCCATACTAGCCATTTGTAACTATAGAACACTTAGGATATAGCTGTG
GATAGATATGTAGATAGATATCTTTAAAACCCTGAATGAACGGTTTGAGGCTCTTCCTGT
TCTGGAGCGAGCAGATATCATTGGGGTACACTAGCACGAAACAGGGCCAAATGGAGACGT
TACTGGCGCCCACTCGAGCAAATCGAAGATCAACGGGAAGACAAGTGATACAAGTAATAG
GATATACCTGGTGCGAAAAACTGACTTTATCTTGATTAATTGAATTAGTACATAGAGTTC
AGGGATGTTACTCGATGCTTAAGCACATGCCTTGTATGTGAGGCCCTGGGTTCAATCCCC
AGCACTTCTACAAATAAATAACCATGTGGGATCGTGGTCAATATTGTTGGTGGCATCGAA
GCAGACTTCTTAAATTGGGGAGATGTTCGTGGTGTAGTGAAGAGAATCAGTGGAGAGAAT
GTTTTCATCACAATCATCTGCTTTCTAAAGATGCATGTATGTAACGGTAGCCAGGAAATA
GGCGCCACATATTAGCGGTGTTCCCTCCTGGGCAGTTGTTCTGTTGTACTTGCTTTTGCT
TGCTAACGGATTGCACACTGGCCTTTTGTCCAGAGATCAAGTCCCTCTTCGTGCACCCCT
TCCTGGCCGAGCGCATCATCTCCATGCTAAACTACTTCCTCCAGCACCTAGTTGGGCCCA
AAATGGGGGCCCTCAAGGTCAAGGACTTCAGTGAATTTGACTTCAAACCCCAGCAGCTCG
TGTCGGATATCTGCACCATCTACCTGAATCTCGGGTACCCATGTTGAACAGCGGGCAGGC
CGCATCGGGCAAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGCCAGCAGGCAA
GTGCCCTCCCCACCATACTACTGCTCCGGCCCCCAAGCAGCATATTTGAGGGCTGCAGGA
TACTTGGTAGACTTCCTGCCTAAATATTAGAGATACCATACAGTATCAAAAGAACACGAA
TGGAGTAACTCCATTTTTATTAGGCCATGACCATCTATAGGAAGCCTAGGTGTTTCTGGA
TTTTTGGGGTTTTCTTTTCATCCAAAAAAGAAAAAGTCATTTATGGCAAATGATAGGAAA
CTTGGTCACTCTTGCTCCCTCATGGACCTGCTCTGATGCTCAGTTTCTCTTTAGGGATGA
GGAGAACTTCTGTGCAACTGTGCCCAAGGATGGACGCTCCTATTCCCCGACCCTGTTCGC
ACAGACAGTTCGAGTCCTGAAGAAGATAAATAAGCCGGGGAATATGATTGTGGCATTCAG
CAACTTAGCAGAAAGAATCAAGGTGAGCAAAAGGAAAACTAACTTGTTAAGAGGACTAGA
GAGGACAGTGGCTGAGGCGCTTGCCTTGCAAAAGCCAACCTGGGGTTGATCCCCGGTATC
CTAGTAGTCCCCCGAGCCCTACCAGGAGTGATCCCTGAGCACTGCTGGGTGTGACCCAGA
AACAAACAAAAAGTCAATTTCCTAAGTGGGAAAAAACATTGCTTGAAAAATATAAAGCGG
CAAAGCAGAGAGTTCAAAGGGTTTGCATGCAGGAGGCCAGGGTTCACTCCTCAGCATGAT
CCCCTGAGCACCCCTGGGAGCAAAGCCCAGGCAAAGGTAAGAATAGCCCCCCAAGCACTG
TCCCAAAACCAAAAAGAAGCAAAAAGGTAATTGATTCTTCCCGGTCAGTTCAGACATTAG
AAGTGCCATGTTCTTTTCGTCTGAGGAGAGACATATTTATTGATGTTGAACACTGCCAGT
GGCTCATCGATGAAGCACCTTCCTGGCACGCATGAGACCTGGGTTTGATCCCCAGCACTG
AAGAACCGAGAAAGGGAAAAATCTTGATAACAGACCCGCTGTAAATGTCACAGTTGGGAA
GGATCTGGGGGTGGCAGGGTTCGCATTTGCATAATTATAGAGTCACTCAGGCAGTTCCTG
TACGAAAAACAGTTTCTGGTTTTAGGTACAAACAGGTACCAGAATTTAAAAGTGACTTCA
AGAAAACAAAAAATGAAAGTGGCTTTGACATTTGATTCCTTCATGACTCTCGGTTCTTTG
GGGGCTGACTCGGTGACAGTCTCAGTATAGAGACACTAATACCAGAGGGGCAGCTTTCAG
ACTGTGGGGTCCTTCCTTCTTCTTAATATTTGCTCGTGGAGCTACCATACACCAACCACA
GTGATTAACTGAATACAATACTGTAATTTTTCCCCCTTTTTTTGAGTCATATCGAACAAT
GCAGTGCTTTGGGACCTTGTAACAAGGGTTGAACCTGGGGTTCCAGCATGCAAAGCTGAA
ATGCAAAGCATGCATGCTTGTCCTTGGAATTCTCACCTTGGCCTTGTTTTCCTTTTTATC
TTTTGAATCTCTTCACCCATTTTTCCCCACTCCTTACCCACAGCCTTTGGCACAGTGTTC
TCATTTTTAAAATGTGTGGATAGGGGTTGGGAAGATAGTACAGCAAGTAAAACTCTTGCC
TTGCACACAGCGACCCCAGGTTCTGTCCCCAGCCCCCTCATATTGTCCCCAGAGCCTGCC
AGGAGTAATCCTGAGTGCAGAGCAGGATAAATCCCTGAGTATCGCCAGATTCCGTTCACT
CTTTTTTTTTTTCTTTTCTTTTTTGGGTCACACTCAGTGATGCTCAAGGGGCTACTCCTG
GCTCTGCACTCAGCAGTTACTCCTGGAGGTGCTCAGGGGGTGATACGGGATGCCAGGGAT
CGAACCCAGGTCGGCAAATGCCCTAACCACTGTACTATTGCTCCAGCCCAGATTTTGGTT
GTTTATTTATTTTTTTATTTTATTTTTTTAAACGAATCACCATGAATACAATGATCAAGT
ACCCATCCCGCCACCGGTGCTCATTCTCCATCACCAATGTTCCCAGCATCAATTTGGCCC
AGTTTTTATTAAAACATATTTAGAAAGATGAGAGGAAAGGAGAGAGGGGGGAGAAGTATG
TGTTCGAGAGAGAACACAGGCTTCTCCACAGTGGGAGTAAGCAAGCAAAGAGGCATCAAG
ACAAGCACGTGAGATCTGTGTTCAGATCTCAACCTGTGTTCAACCTGCGGAGCCAGACAG
GTTGCCGAGATGGAGCTGGCGCTAAGCTTGCTCTGCTGCCTTGGAGACCATAAGCGAGTT
TTGTCACTTCACTTTCTGAGATCAAGGTCTAGGGTGCCCAAGAGAAAGTACAGGGGCGAG
GTCCTTGGCTTGCAGGTGTGACCCCGCTTCTCTCCCCAGCACCCCAGAAAGTCCCCTGAA
CCTTGCCAGGGGCCACTCCTGAGCTCAGAGCTGGGGCTAGCCCCAACCCCCCGCCTCCCA
GGAGGGCAGGTGAAGGTGGTCGTGCTCTGAGGAGCGGGGGTGACTCGCGTGTCTGTGCTC
AGTCTCTAGCCGACCTCCAGCAGCAGGAAGAGGAGACCTACGCAGACGCATGCGACGAGT
TCCTGGACCCCATCATGAGCACGCTCATGTGTGACCCTGTGGTGCTGCCGTCCTCCAGGG
TCACTGTGGATCGCTCCACCATTGCCAGGCATTTGCTCAGGTAGGTGCACAGTGCGCTCC
AGACCCCCGAGCCAGGCCTCTGCACCCCAGGAGTATCATCAGTTTGCCGGTCAGTTGGAG
AGGCATCTGGATAAAGGTCTGCACTTAACTGTTAGGGACCTAAAGACCCTATAAGAATCC
TATAAGGGGGGGCTGGAGTGATAGCATAGCGGGGTGGGGCGTTTGCCTTGCACGCGGTCA
ACCCGGGTTCAAATCCCAGCATCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 18275..18448, 18549..18661, 18762..18914, 19015..19195, 19296..19498, 19599..19790, 20450..20783, 22742..22862, 24674..24978, 26403..26535, 28342..28529, 31078..31178, 31262..31375, 32688..32862, 34173..34353, 35094..35241, 37322..37477
1001..1121, 18275..18448, 18549..18661, 18762..18914, 19015..19195, 19296..19498, 19599..19790, 20450..20783, 22742..22862, 24674..24978, 26403..26535, 28342..28529, 31078..31178, 31262..31375, 32688..32862, 34173..34353, 35094..35241, 37322..37477
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved