Sorex_araneus Locus ENSSARG00000011802
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000011802
Sorex_araneus
ENSSARG00000011802
GeneScaffold_4171
SNORA21
21286..21399
27135
GCGGGAGCACCCGACGCCGCTTGACCGGGAGGGGATGCGGGTGTTGAGTTCCTGTTGGA
GGGGCGGTCGGGGGAGGGGAGGCCCAGATGCGGCGCCAGCCGCCGATCCTTAGGCTCTGC
CCTCCCCCTTCCTGCTTTTCTCCCCTTTCCAGATGTGCCGGGACGGGAGGCAGGGCTGGG
GTGAGCATTTGTGACCCCGCGTTCCTCTGGACCCTCCCCACCCCCGCCCCCGTGTTTTTG
CCGCCTTCGGATGCTCCTTTCCAGCAGCCTGTAGCTTCTCGCATCGGGAAGAACGCTCCG
CCTGCAGCCAGAGTCAGGCTTCAGAACGTGGCCCAGCCCCTCCAGTGTGCATGCCCCGAG
CCGCAGTTTACCCCCGTGTTTTTACCTGGCCTCCGGGGGTCTTGAGGATCAGTATGACAC
AGAAATCGATAAAATGGACATTTGTTGAGTTTCTGCGCGGCCAAGGACTATGCAAATACT
TTACCTGTCATATTTAGCCGTCGTTACTTGGCGTTCTTAGAACTCTCAGTTCCCGGAGTC
TTAAGCCCACCAAGGGTCCCGTCATTTTCCTCGCGTAACCCGTGAGCCGGGGAGAGAGGA
TTCGACGTGAGTTGGTGCGCTCCAGAGTGAAGTTTTTTTCGTCAGCTGCTTCCTTTGCGC
TGCTGGCTGAAGCCAACCCCTAACCCTAGAACAGCTGCTTCCTGATTTTCTCCCCTGGTG
AATTCCCCTTACTGGGTTCCTCCCTCCCTCCCCACTTTCCGGGTGAAGCATGCGCTGCAC
TGCTTATGCCTTGATTACTTTTGAAATAAAATACAGCAGACTTTCATGCAGGAGGGCAGA
GTGGAGTTTAAGATTCTTGTCCTGGTTCTGCCACTCAGACTGTGTGGCCCTGGGCATGCC
CCTAGTCTGGGTGTTCTAGCTGCTCTTTAACTGAAATGGGTAAGCCCCGCTCTCTTTTCT
CCAACAGGCTCTCTGTGGACGCCCGGACCCCTCTACTCCCCATGGGCAGCTGCCAGGCGG
GCCACAACCTGCATCTCTGTCTGGCCCACCACCCACCTCTGGTCTGTGCCACTCTGATCC
TGTTACTTCTTGGCCTCTCTGGCCTGAGCCTTGGCGGCTTCCTCCTGACACACAGGACTG
GCCTGCGCAGCCCTGACATTCCACAGGTAAGTAAGTGCCCTCCTGCACCCCTTCTCCGGA
GGCTTGCTCACTGCGGCTCTCACCTTTCTCTCTGTTTGCTTGTGTACACAGGACTGGGTC
TCCTTCTTGAGATCCTTCGGCCGGCTGACCCTGTGCCCTGCGAATGGGACAGCCCCTGGG
AAGTGGCATGGGTCTCATGTCGTGGGCTTACTGACCACCTTGAACTTCGGAAATGGTCCA
GACGGTAACAAGACTCAGACATTCCAAACCAAGGTCCTGGGAAGTCAGATGGGATTGAAA
GGTGAGGTGACAGTTAGCCATTTAGATCTGGGCCCAGCCTTTGACCTCACCCACATATCT
GGGCCTTAGTCTTTTCTGCCAGATACCTTCCATGAACACTACCCAAAGTATAGGTTCTCA
TAGATGTTTTTTCTCTCCTCTTTCTGCCCTGACGTACTTTGATTCTACCTTTGGAGGTCT
AATTAGATGGGCTAGAAAGCACGCAATGTTCTTTCCTCTTAATTCTTGCAGTCTTCTCAG
AAGCACATTCTTTGTCCTCAGGGAGATCAGAGTATGTTCTATTCACTTATACTAGTGTCT
TGACGCCTGCTATGTGTCTAGCACAGCTCTCTCTATGAGAATTCAGAAAAACAGGCCTCA
TCTATTCCGAAATTGCTTAGTGTCTTTGGGGGAAATGATGTGTAAGAGCCAACAGATGTC
ATTAATTTCTGCATAAGATTTGGCCTCAGATTCCTCACCTGAAAAATAGAGCAATAAAAT
ATCAAAAGGAAAAGGAAAAGGTGGAATTCTCTACCTTCTGAGTTTCTTTTACTTTCTAGC
CTCCTTTCAAACTCTACCATGATTCAAAGATTCTTCCATGACGGACCAGAATATGGCAGG
TAGGGCCCTTGCCTTGCATGTAGCCAACCTGGGTTTGATCCCTGTCACACCACATGGTTT
CCTGAACCCTCCAAGGAATGATTCCCTGAATGAGTGTCAGGGTCACTACTGGCTCTGCAC
TCAGGAATTAGTCTTGGGGGTGCTTGGGGGGAACCAGAGGGGATGCCCAGGATCAGATCC
AGGTTGGGCACATGTAAGGCAAACACCTTACCCACTGTACTATCTTGACAGCCCCTAGTT
GTATATTTATTAAACGGGTGATTTTATGATTTATGAATCATAGCTGAATAAAAATCGGAA
AAACTGTTCCCCTGTTATATCACTACCACATCCAGTGGTGTTCAGGGATTACTTACGGAT
TTTCTCAGGGGACTTATATAAGGTGCTGGGGATTGAACCAGGTTGGCCACATGCAAGACA
AATACCTTACCTGCTGTACTATCTGTCACTGTCACTGTCATCCCGTTGCTCATCGATTTG
CTCCTGCGGGCACCAGTTACGTCTCCATCGTGAGACTTGTTGTTATAGTTGTTACTGTTT
TTGGCATATTGAATACGCCATAGGTAGCTTGCCAGGCTCTGCTGTGTGGGCGAGATACTC
TCGGTAGCTTGCTGGGCTCTCTGAGAGAGGCAGAGGAATCGAACCTGGGTGGGATCAATT
GCGTGCAGGGCGAATGCCCTACTCACTGTGCTATCGCTCCAGCCCGTGATTGCATAATAT
AGGCAATAATTAATGAACACCTCCTGTAAGGATGGCAAATAGATCCATAATCCATGGGTC
CTAGCCTCGGTTCCTTATAGTCTAGCAAGTATACAGATGTTAACAGAAATATCGACTTCA
GTGTGTGAAATAGAACACAAGGGGAGAGTATGCAGAAGCCCATCAAGCAGGTTTGGAGAA
ACAGGCTGTGGGAGGCTTTTTGGCATGTGAGGAGCATATGCAGTGTTAGGCAGGTAAGAA
TGGTGTTGCTTGTGACTCAGGGGAAAGAGGACTAGTTGAGTGGCAGAGATGATTCTGAAG
ATGCAAACAGAATCCCTACCGAATACACTGGGCAAGCTCAAGAAATTTTAATTGAGCTAT
AAAAGTAGTAGATTTTTGTGGTTGTGGTTTTTGGTTTTGGGTCTGTCTGCAAAAAAATCA
TCCTCTATTTGTTCACTGCCTGTAAGGAATGTATTTAGACACAGGAAGATTATTTGGGAG
GTGAGAATGAAGACCGTGAAAGAGAGGGCCTGGTTTAAAAGCGTATGGAACAAATTGAAA
GTATGAAATGGGAGACTCGGTGACTGATTTCACACTGGGAACCTAGAGCCTGGAGAACTG
TGCATATGCATTTCTCACAGGATGGATATATATATATATATACATATATATATATATGTA
TGCGTATATATATATATATACGCTTGCTTGTGTTTCCTTGATTTTTACTCATGGCATTGT
ATTTTTCCATGTTAGTGAATGATCTGAACATCATCATTTTANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGACAGGAGTAAGCCCTGGACACC
CTAAAATTGCAACAAGTAAAGCCAAACTGTCTTTTGAAAGGTGTCACCAATTGAGAGTGC
CCATTTTTCCACATCTTTGACAACTCTTGTTATTACCAGTCCTTTGCTTTTTTTTTTTTT
TTAACCAATGTAATGGACAAATGTGTTGCTTAATAGTTTCATTTACTTTCTTCTAATTGC
TCCTGAGGTTGGGCATCTTCAGTAAGTTTATTAATCATTCACTTCTACTGCAAATTTCCT
GCCTTTATTCTTTGTTCATTTTTCTTTTATTTGTCATTTTCTTCTTGATTAATAGAAGAC
CTTTATGCATGCTAGTTAACAAACCTTTCTGCCTATTCAATATATCATAGGTACTTTGAA
CCAATGTGTGATTTTTTTTTTTTTTTTTTACTTTTTGGGTCACACCCGGCGATGCACAGG
GGTTACTCCTGGTTCTACACTCAGAAATTACTCCTGGCGGTGCTCAGGGGACCATATGGG
ATGCTTGGATTCGAACCCGGGTCAGCCGCATGCAAGGCAAACGCCCTACCCGCTGTGCTA
TTGCTCCAGCCCCCCACCAATGTATGATTTTTGAAAAATCATATCTACCAAGCACTTTGT
GTTACACTGAGGCATCAAGAACGGGCAGAGTAAAGACAACACTTTTGGGTGAAGTGGCGG
CATGTTGTGTTCTTTGGTTTCAGTCAGCTGTGTAACAAGGCAACTCCCCCCTCCCCCCAA
ATTATCCATCCTAAATTAATTTTTATGAGGTTGGATTTATTGCTCTTGTCCTTTACTTAG
GCACTTAGGTTTTCTTTTTATATATATTTTAATTTTGAAACCACTTCCAGTGCTTTACAT
GGGCTTCCAGGTGGCAAAATATTTATTCCAGCCCTTCAGCTATTTATTTATAGGACACCA
TGTATTGGGCATTAGGAGTTCTTCCCTTCTCTCCTCTCTCCTCTCTTCTTCACTCTCTCC
CAAGCAGTGCTCTGGAGGCCTGGGAACGTCCTGGCTATGCTCAGGGACCATGCAGTGCTG
GGAATCTAGGAGACCATGCATGCTGGGAATGTAATGCAAGGCCTCTGCATGTCAGACATG
TACTCCAACCCTTTGACTATCTCTCTGGCTCTTTCTATCTTTTTTACGAAGTCATTCCTC
ACTTTTAAATTAGAAGAGGGTGGGCGTATCGACAGCGGGGCAGAAAGATAGGCAAGGCAT
GTGGCCACAGGTTCAATCCTCAGCACCCCATGTAGTTCCCAAGCACTGCCTGGTTTGATC
CCTGTGCTGAGTAAGTAGTAATCCCTGAGCATCACTAGGTGTGGCCCAGAAAGCAAATTA
AAAAATGAAAGGGTGGGGCCAGAGCGATAGCACAGCGGGTGGGTGTTTGCCTTGCACGCG
GCCGACCCGGGTTCGATCCCCGGCATCCCATATGGTCCCCCAAGCACCGTCAGGAGTAAT
TCCTGAGTGCAAAGCCAGGAGTAACCCCTGAGCATCGCTGGGTGTGACCCAAAAAGAAAA
AAAAAAATGAAAGGGTGATGGGCCAGAGTGATAGTACAGCAGATAGGGCACTTGCCTTGT
ACTCAGCCTACCCAGGTTCAATTCCCGGCACCCCATATGGTTCCCCCAAGCCTGCTAGGA
GTGATCCCTGAGTGCAGAGTCAGGAGTAAGTACTGAACATAGGCAAGTTTGGCTCAACAA
TTAAGAAAAAAAATTAGAAAATGTCCTTTATTTTCTTTGACTTTCCTTGTTTACTTTTTG
GGTCATACCCAGCCATGCACAGGGGTCACTCCTGGCTCTGCACTCAGGAATTACCCCTGG
CGGTACTCAGGGGACCATACGGGATGCTGGGAATCAAACCCGGGTTGGCCGCGTGCAAGG
CAAACACCCTACCCGCTGTGCTATTGCTCCAGCCCCGACTTTCCTTGTTTAATTTGTCTG
AGTAGGTCTTTACTGCTTTGGGCCCACACCCATCTGTACTCAGGCTCTACCCTTAGCTCT
GTGCTCTGGGATCACTCCTGACATGCTCTGGGGACCATAAAGTACACATACTGTATCATC
TGGATTTTATTTATAATTGAGATAAGTCTTTTTTTTCTTTTCACAAATGGAAATTGTCCC
AAGGCCATTGACTGAAAAGCCATTCCATTCCTTTCCCACAAATTTGAAATGAAGTGTGAA
TCTTTATGGGGATAAAGATTTTGGTATCTAGTGGAAGTTGCTTTATTAAAAAGAACTAAC
TAGTTTATACGACCTAATGTTAGCAATGTTTATCCCAGCTCCACTGCCACCTGTGAGTAT
CGGTATGGTTGTTAGTTATAAGCTAATTTAAGTTGATTTTTTAATTTACATTGATACATG
TTATTTTCATTTTTCAAGGATGTAAGTGATGGGATACAGAATGTTTTATTAAAAGGGATC
AATGGCAACATACTTGGTCTCATAGGAGGCCTTAGAAAGTAACGGAAGGGACGGGAGAGA
AAGTACAGGGGAGGGGCTGGAGAGATAGTACAGCAGGTAGGGCATTTGCCTTGCATATTG
CTGACCCCGGTTCGATCCCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGAGTAATT
CCTGAGTGTCAAGCCAGGAGTAACCCTTGTGCATCGCCGGATATGACCCAAAAAAGCAAA
AAAAAAAAAAAAAAGAAAGAAAAGAAAAAAGAAAGTACAGTGGATAGGGGACTTGCCCTG
CAAGTGGTCAACCTGGTTTGATCCCCGGCATCCCACATAGTCCCCTGAGCACTGACGGGA
GTGATCCCTGAGTGCAGAACAGGGAGTAAGCCCTGAGCATCACTGGGTTTTACCCATAAA
ACAAGAAAGGAAGGAAGGAAGGGACAAGGGGAGCGAGGGGAGGAGAGAAAATGGGAAAGG
GAAAGGAAAGAAAGGTGTGAAGATAGCCCCACTCTCATTTTCTTGCATCTCCTCTCCTGT
GATAGGATCTCATGCAGGTGAGCTGGTCCTCGTCACAGCCAGGGTGACCACAGAAAGGAC
CCCAGGAACCTGCCTGTATTTTAGCGCTGCTCCAGGAATCTTGCCCTCCAGCCAGCCACC
CATATCCTGCTCAGAGGAGGGAGCAGGCAATGTGACCCTGAGCCCTAGGATGGCCGAGGA
GTGTGTCACGGTCTGGAGCCATGAACGCCTTGTGCTCACCAAGCTGCTCACCTCGGTAAG
AAGCTCCGCTCGTAGGCCTGGAACATAGTTCAGTGGTAGAGCATATGCTTTGCATATGTG
AGGCCCTGAGTTTGGTTCCTGCCTGGCATAAAAAAAAAAAAAAAAAAAAAAAACTTGGAA
AGGGAGGGAGGGGAAAAGAAAAAAAAAATACGGTTAAGTTGTTGGTTTTTCATAGGCTGC
CATGCTGAATATTGGAGATCAATTTTACTCAGTTGAAAAAGTACACAGACTTGGGACTGG
AGCAATACCACATCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATTCCC
AGCATCCCATATGGTTCCCCGAGCACCACCAGGAGTAACTCCTGAGTGCAAAGCCAGGAG
GTAACCCCCCTGCATTGCCGGGTGTGACCCAAAAAGCAACAAAAAGAAAAAAAAAGAAAA
AGTACAGACTTTGTGTCTGGGGAGATAATACAGTGAATTAGGTGCTTGCCTTGCATGCCT
CTTACCTGGGCTCAATCCCCGGCACCACATAAGGTCCTCCAAGCCCACCAGGAGTGATCC
CTAAAATTTTGGGCATGGCCTAAAAATAAAAAGAAAACAAAAAAGATCACAGACTTTATC
GTAACCTTAAGCAAGCTCTCTGAACCTCAGCTTCCGCATTATAAAGTGGAAATCACGATA
CCATCTAATTTCAACAAATAAGGATAACAAGACTTAATGTAAAACACCTGGGACAGTGTT
TGGTACATAATAGGGGTTTGATAAATAACAATTATTACTATGAACTATTTTCTTTAAATA
CAATAAAATAAGATCTCCACCTCAAAGGAATTCAGAAACTGTATTAAGAGGCTAATTGGT
ATCAGAGAGATCTGAGCAAAGTGTTGTACAAACACAGAGTAAGGAACAATTAACCCTAAC
TCCTACATTTATAGAGAGTGCTTCACAGAGAAGATGGCATTTAAGGAAAGGAATTGTGTA
TAGTAGTTTATAATGTACAAAGTACTTTCAGGTTCATTATCTCATTTGATCTCAAAATAG
ACTTTTGAGGTAGCTATTATCCCATTTTACAGATGAGGAAATAGGCTTAGAGAGAGGGAG
TGAATTGCCTTAGGACACACAACTGGTTAAGTGGCTGAGCCAGCAGAGCAACCTGTGCCT
TCTCACTCCCAGTCCTAGGCTTGTTCTGCCCTGTCAGGGTTATCCTTGAAGAATGAGGAT
TAGTGCAGGGTGCTCAGAAGAGGGGACTCATGGGGCCGGAGCGATACTACAGTGGGTACC
AGGTACGGCACTTACCTAGCACGTGGCCGACCCAGGTTTGATCCCCGGCATCCCATATGG
TCCCTGAGCACTGCCAGGAGTAATTCCCAAGTGTAGAGCCAGGAGTAACCCCTGAGCATC
GCTGGGTGTGACCCAAAAACAAACAAAAAAAAACTAAGAGGAGATTCTGAATGGGGAGAT
GCAGTGCAGGCAAAGATACCTCAGCACATTCTAGAGAATGATGGGGCACACCACAGCATG
AGTTCATGGGACTCCCAGCCTCTTGGACTGAGAACCCTGATTCTCCATCACATTCGTGTT
TATTCTCTTAATCACAGCAATTTACAGACATTTGTCTATCTATGCCAGTCTAAGCAGGTT
AAGCTTTTACATATCAAAGGGGACTAGAGACTATAGGTGCAGAAGTCTCTAAGGTGCATT
TATTTCAAAAGAACCTTCTCTGGAAGCTGGAGCAGAGATAAGAGGTTACAGAACCCATAC
CAAAGGAGCTTCCCCTTGTGCTGGCTTTCCAGGAAGCAAAGGAGCCACAAACCCCTCTAT
CCAGCCAATCTTTGAGTCTGTCTAATCTTTTCAATTAAATGTAATCATATTTATATGCAA
GTATATGCATCTTCGATATAGGTAGATGGGGAGATCTCCTTTCTCATGAAGTCATTATAG
GGGTTCAGCTAAATGGCAGTGCATGAAAGCACATTGTGGATTACTTGTTCCCTTTAGTTG
CTCGCAGCATGTAGAGGGCCCTCTTCCCCATGGACGCCTCTCTCTAGCCTCTGGGCCGAG
GGAACTCATGTCTTCACCAGGGAAGGGCCAATGACAGTTCTTCTCATTCATTCATTCTTC
CCTCCCTGTGTTCACCCCCAGGAAGAGTTGGCTTTATGTGGTTCCAGACTCCTAGTATTA
GGTTCCTTCCTGCTTCTCTTTGGCCTTCTCTGCTGTCTCACTGCTATGTGCTTCCACCCA
CGACGGGAGCCGCATTGGTCTCGAACCCGGCTTTGAGGACACTCAATGTAGTTTCTGGCT
TGTTCTCAGGTAAGGAACTTTGCTCCTGTTGTATGAGATTAGGTGATTGGGTAGGGGTGG
CAATTATAACTGAGATTGTTATTTCTACTCAATATGGTTCAGTTTTATTTTATGTAGATG
GAATATTTTATAATTTAATACATATTCTATTGTGACAGACATTTTGGTTAACACACATGG
TTTTGTTTTTTTGGTTTTGGTTTTTTATTTCTTTTTGGGTCACACCCTGCAATGCACAGG
GGTTACTCCTGGGTTTGCACTCAGGAATTACTCCTGACGGTGCTCAGGGGACCATATGGG
ATGCTGAGAATCGAACCCGGATCAGCCATGTGCAAGGGAAACGCCCTACCTGCTGTGCTA
TGACTCCCAGCCCCCAAACATGGTTATAAGATTCATTGATAACAGTATTTCGCATTATCC
GAACTTTGGGGCAACAGTGGTAAGTTTAAGAAGGTTCAAGTCTGGGGGCTGGAGTGATAG
CACAGCGGGTAGGGCGTTGGCCTTGCATGCGGCCGACCCCGGTTCGATTCCCAGCATCCC
ATATGGTCCCCTGAGCATGGCCAGGGGTAATTCTTGAGTGCAGAGCCAGGAGTGACTCCT
GAGCATCACTGGATGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAGACATAAAAGAAGGT
TCAAGTCTGGGGGCTAGAACAATAGCACAGTGGGTAGTGCATTTGCCTTGCAGGTGGTTG
ACCTTGGTTCAATTCCCAGCACCCCATATGGTACCCCAAGCCTGCCAGGAGTATGGCCTG
AGCACTGCCAAGATGTAGCCCCAAAACTAAAATAAAAAAGAGGGTTCAAGTCTGATGTAT
CCTGAATAAGTTGGTTTATCTTGGGTTTGTGGCCAGAAAAACCTGAAATTTGTTTGTCCT
GAAATTCTGATACCTTTTTTTTTGATGCAAACTTGTGAAATTCATCTTGAATATCTCAAA
AGAATATGATGATGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1165, 1251..1440, 23645..23874, 26001..26135
1001..1165, 1251..1440, 23645..23874, 26001..26132
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved