Sorex_araneus Locus TNPO2
snOPY snoRNA Orthological Gene Database
Sorex_araneus TNPO2
Sorex_araneus
TNPO2
GeneScaffold_1459
SNORD41
4952..5021
9047
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGGGTAGTAGATTCTCGCCAAATTTAGGTTTCTCTTTC
TGGGGGATTGAATTTGCCATTTGAGTTAAGGGACTGGGGGTGTTATCAGAGCATCCCGGT
GTGCTTGTCTGTCGCACAGAGGCTCTAGGTTCAGGCACCCTCAAACCGAAAGCCAGTAAG
AGATTAGATTTGGGTCTTCCCAGCACGTTCCCTCTTTCCAGTTGTGATGGTTTGGGAGGG
GGGTGGCTGCTGATCCTCACTTGCTCTTAGGACGGGGATAGATGCAGGCTGTGGGTGGGG
GTCCCCCACCCGAGTCCTTTAACTCCTTAACGAACTGGCAGAAACTCAAACAACTGAACC
AGTTTCCAGATTTCAACAATTACCTGATCTTCGTCCTGACCCGACTCAAGTCGGAAGGTA
TGCTCTGGGTGCCCCTCGGTGCCGGCCACCCCCGCACTCGTCCAGGCCCCCCCTTAGTGC
CCCTCTCTCTCCCCCCAGATGAGCCCACACGATCCCTTAGTGGCCTCATCCTCAAGAACA
ACGTGAAGGCGCATTACCAGAGCTTCCCACCACCTGTGGCCGACTTCATCAAGCAGGAAT
GTCTCAACAACATCGGGGACGCATCCTCTCTCATCCGCGCCACCATCGGTGAGGGCCGAG
CCTCAGTGGGGAAACTGAGGCACAGCGATGGTCAGATCAGGCCCCCAGTCCCACGCTCCG
GAAACCGCCATGCTGGCTCTGGCGGGTAGTACCTATGTGTGCCGAGGGATGCTGGGTCCT
GGCTGGACTCTGGCTGGGGTGGCCTCAGGGCACAAGGATGATCCAGCCCAGCCTCCTGAC
TACCGGCACCAAGGGGTTAGTAGGCTGTTTAGGATCCTGCCCCTCAGGTGCTTTGCTCCC
CAGAAACACAGGTGCTTCTCCTTCCTTGCCAGCGCCTTGCTGGCTGACTTGTTTCATGGC
CATGCTAAGCTCAGTGCTAGCATGGGGCTCCAGTTCCTTTGAGCACTGCTGGATGTGGCC
CCAACACCAGAGAGGAGGCATAAAAGCCCCCTAGAGGGGCCAAAGAGTTCAGTGGGTTCA
GTCCCCGGCACCCCATAGGGTCCCCCGAACCTACCAGGAGTGATCCCTGAGCACTGCCAG
GTGTGGCCAGCACCTCCCCACCCAAAAAAATAAGAATACTCTAGAGACCACCCCAAGCCT
CCACTAACCTCAGACCCTGGCCCCTCTGGAGAGCCGCCTCAGCCCCTGGCCACTTCTGCT
CAGGCTTGGTCCCCATGTGTGCGTGGGGCGCCTGCCCAACCTGAGGCCGTGCTCCTTCCC
GGACGCCGCAGGTATCCTCATCACCACCATCGCGTCCAAGGGGGAGCTGCAGATGTGGCC
GGAGCTGCTGCCTCAGCTCTGTAACTTGCTCAACTCCGAGGACTACAACACGTGCGAGGT
GGGAATGAGTTGGGCCGGGGGGGGGGGAACGAGCGGAGAGGGCCCGGGCACAGGGGCACC
GAGCCAGCCGCCCACTCCTCCCTGCCCTCGCCCCCAGGGAGCCTTTGGCGCCCTGCAAAA
GATCTGCGAGGATTCGTCCGAGCTCCTGGACAGCGATGCCCTCAACCGGCCCCTCAACAT
CATGATCCCCAAGTTCTTGCAGTTCTTCAAACACTGCAGCCCCAAGATCCCGGTGGGTGC
ACAGCTCTTGGGGCTCCAGAGGGGAGCAGGGGGCAGTGGGGGCTGCCAGTGGAAAGGCCC
TGGGCCTATGTCCTGTCCGCTGCCTCCCCCAGGTCTCACGCCATTGCTTGTGTGAACCAG
TTCATCATGGACCGGGCCAGGCGCTGATGGACAACATCGACACCTTTATCGAGGTGGGCT
GCAGAGGCCCTCCAGGGAGTGGGGTGCAGTGAGGGCTTCCTGTGGCCGCTGACCCCGTCC
TCCCCACAGCACCTGTTTCCCTGGGCCGTGGATGACGATCCCGAGGTGCGCAAGAACGTG
TGCCGGGCGCTGGTGATGCTGCTGGAGGTCCGCATTGACCGGCTCATCCCGCACATGCAC
AGCATCATCCAGGTGCAGATGGGGGCCGGGCGAGTGGGGGGCCCCCATCCCCTGCTGCCA
GCTGGGCCTCAGCGTCTCCCTCCCACCATAGTACATGTTGCAGAGGACCCAGGACCACGA
CGAGAATGTGGCGCTGGAGGCCTGCGAGTTCTGGCTGACGCTGGCTGAGCAGCCCATCTG
CAAAGAGGTCCTGGCTTCCCACCTGGTCCAGTGAGTGCCGGTCCTGCCTGCCCCCACCCT
GCCCTGCCCCATCTGGGTAGCTGCTTCTCTTGCCAAGCTCTGAGAGGGCAGCTTGAACAA
TTTCCAAAGCCAGGAAGTTGGAGGGGGAAATAGGGAAATGACAGCTTCAGATACAGCTGG
ATCCAGGTGCCCTGTGAAGGGGCCTGGGGGTCTCTAACTGCTTCTGTGTCAGCTTTGTTC
TCATAAGAGTTCTGTGTTTGCTTTCTTCTATTATTGGGGCACAGCTGGTGGTTCCCAGGG
GGGACTCAATCCTATCTTATGGCTTTGGGGATTATACGGTGCCTAGGGTTGGAATCCCAG
TTTCCTGAAGGCGGAGCGTGAGCTCTGGCCCTTTGAGCATCTTTCTAGCCCGGGAGGTTA
GTAGTTGGTGCTTGTTGGGTTTTTATTCTGGTTTTCGGCCACATGGACAGATTAGCACCC
CCACCCCGACCCATCTCCCAGACAGGCCAGGTTTCCCCAAGCTGCGTCCAGGCTCCGTCC
TGGCCCCCTGCTCCTCTGCTCACGCCTCTGCCTCTTGGCCCCCAGGCTCATCCCCATCCT
CGTGAATGGCATGAAGTACTCGGAGATCGACATCATCCTGCTGAAGGTGAACAGGGGCTG
GGCCCGGGCGTGCAGGAGGGGTGGGTGCATGTGCACAGGCAGTGCTTACGGCGGGCCTGG
CCTCCCAGGGTGACGTGGAGGAGGACGAGGCGGTCCCCGACAGCGAGCAAGACATCAAAC
CGCGCTTCCACAAGTCCCGCACGGTCACATTGCCCCACGAGGCCGAGCGCCCCGACGGCT
CCGAGGACGCGGACGATGACGATGATGATGACGCTTTGTCCGACTGGAATCTGAGTGTGT
GGCTCGGCCTGGGGCAGGGCGGGAGTGGCGGGGGTTGGGGGGGCCCTTGGAGCCCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
ATGACCTGACCTTCAGACGACGCCAGCATCGGAGCACAAGAGGTCAGAGCAGCTGCAGTG
ACGCACCGGCCCCCACACACCCCACCCCCGCCTCTGAAGTGATGACACTGTGTGAGCCTG
ACCTCGCACTGATTCCTCTTGTATTGGTACTGGCTGATCGGAGGGCGCCTGCTCAGCTCT
GCCTCGCCTACCCCTGCTAGAAGTCAGTCCACTGACCGCCCCTCTCGCCCTGCAGTGCTT
TTGCCACCCTGGAGGAGGAAGCGTGCACGGAGCTGGTGCCCTACCTCAGCTACATCCTGG
ACACCCTGGTCTTCGCCTTCGGCAAGTACCAGCACAAGAACCTGCTCATCCTCTACGATG
CCATTGGCACCCTGGCTGACTCCGTGGGCCACCACCTCAACCAGCCGGTGAGAGCCGGTG
GTGGCCCAGGGTGGGGTCAGTTCTCAGTGTTTTGGGGCCAGGGGTTCCCTGGGCGTGCCC
AGAGGGTGGAATATGGGGACTCACAGGCCCCTATCTCCTGGAGCCTTTGGGAGGAGCCCC
GAAGGGACCAGCTCAGGACAGCAGGGGCCCCAACACCCTGTTCCCCTGCAGGAATACATT
CAGAAGCTGATGCCGCCACTGATCCAGAAGTGGAACGAGCTCAAGGATGAGGACAAGGAT
CTTTTCCCTCTGCTGGAGGTATGGGGTGCCCAGCCCGCTCCCAGAGCCTGAGCCCCGCGC
CCCAGAGCACAGCTCACTGTTCCTGTCCTGCTCTCCCAGTGCTTGTCCTCCGTGGCCACC
GCCCTGCAGAGCGGCTTCCTGCCCTACTGCGAGCCCGTCTACCAGCGCTGCGTCACACTG
GTGCAGAAGACTCTGGCCCAGGCCATGGTGAGACCCTAGGGCCTGGCCCCAGCCCTTGTG
CCAGGCCACACCCCCTTGTCAGGCCCCACCCACCTTTCCTGCCCCTCCCTGGTGCCCCCA
CTCTGCCCTGTCCCCCTCACCCACCCCTTTGTGGCCAGATGTACACCCAGCACCCGGAGC
AGTATGAGGCCCCCGACAAGGACTTCATGATCGTGGCGCTGGACCTGCTCAGCGGCCTGG
CCGAGGGCCTGGGCGGCCACGTGGAGCAGCTGGTGGCCCGCAGCAACATCATGACGCTGC
TGTTCCAGTGCATGCAGGTAAGCGAGGCGACTTCACACCCCTGTAACTGCGCATGGAATC
TCAAGGCTGCTGCCCCAGCCTGCGCCCTCTCCTCTCCGCTCTGGACTATCAGAATGGGTT
GCGGTAGGCCCGGAGAAATAGTACAGCAGGGAGGGCGCTTGCCTTGAATACAGCCGATCC
CAGTGTGGTCCCCAGCCCCTCATATGGTCCCTTGGTCACCTCCAGGAGTGATCCCTGCGC
ACAGAGCTAGAAGGCCTTTGGGGTGGCAGTGCCAGGGTTGAACATCACTGCCCACACACT
GTGCCTGGACACCATGCCATCTCTCTGTACCATCCCCATGCTCTGTGAAGGTGCCTGAAT
AGGGCAACTTCTCATGCTGTCCCCTCTGCCCCACCCCAAGTTTCGGGTTCGGGGGAAGTT
TTGGGGGGAGGTGCCTGCTACCCCAATGCTCTTCTGACCCCTAGGACTCCATGCCTGAGG
TCCGGCAGAGTTCCTTCGCACTCCTGGGAGACCTCACCAAAGCCTGCTTCATCCACGTGA
AGCCCTGCATCGGTACGGCACCCCACCTCCCCCGGACCCCAGCCTCGGCCCCCGGTGATG
AACCCATGACCAGGGACTCCCATGACCGCACCCGGTTGTATTCGTACTGTCTGAGGGGGC
CTCCCGGCACTTGCCAAGGAGCGGGCCCCGGTGGGCCCCATTTCTCAGCACCCCTTTCTC
CCCCGCAGCCGAGTTCATGCCCATCCTGGGCACCAACCTGAACCCTGAATTCATCTCTGT
GTGCAACAACGCCACCTGGGCTATTGGAGAGATTTGCATGCAGATGGGTAAGTGCCCTGC
CCTCGGCCCCTATAGGCTGGGAGAAAAGCTGTGATTGGCTCCTCTGGAGAGGTACAGTAG
GAGAACAGCTGTGATTGGCTGTTCTCCAGAGAGGCGCGCTAGGAGGCCTGTTCAGATTGG
GCCATTCCCTTAATTAGAGCTGGGAAGATCCCAGGCTGGGGCCGAGGGTGAGAGTCCACC
CAGAGCCCCACCAGGATTCCAGGGATGCATCTGGCGTGTGGAGGGTGTGCATCTGTCAGG
GTTGGTTCTCACTGGTGGGTCCCCCAGGGGCAGAGATGCAGCCGTACGTGCAGATGGTCC
TCAACAACCTGGTGGAAATCATAAACCGACCCAACACACCCAAGACGCTTCTTGAGAACA
CAGGTGAGGGGGTCAGGTAACCTTTTGAAGGGGGTCTGGGGGGAGCTGCCAGCCTGGAGA
GACACAGGGACAACTGAGGGGGTGCCCAGACCCCAGCCCGGGCCCAGGTGGCCTGCAGGA
GCGCTTCCCCTGGGGTTCCGGGGCGGGGCTGGTGCCTCGAGCAGAGGCCCTGCCACGTAC
CGTCCCGGGGCCGCTCGGGCTTTCAGGTCGCCTGACGAGTTCCTCTGCCATTCCAGCCAT
CACCATCGGCCGCCTGGGCTACGTGTGCCCCCAGGAGGTGGCCCCGATGCTGCAGCAGTT
CATCCGACCGTGGTATGTGCCTGGCGGGGGCTGCAGTGGTGCGGTGGGCAGGAGGCCCAG
AACCCTGCAGGCTGAGGTCCCACCACTCCCCGCAGGTGCACCTCGCTCAGGAATATCCGG
GACAACGAGGAGAAGGACTCGGCCTTCCGGGGCATCTGCATGATGATCGGTGTCAACCCA
GGGGGCGTCGTGCAGGTGAGGGGTGGGCTGGAGGGGGGTGGCAGGCACCAGGTGCAGGGT
GGCCCCTCACCCCTCCTCGGTCCCTGCAGGATTTTATCTTCTTCTGTGACGCTGTTGCCT
CCTGGGTGAGCCCGAAGGATGATCTTCGGGACATGTTTTATAAGGTGAGGTGTCCCTGGC
CCTCCTGGGGGCAGGGCCTTCTGGGGTGGGGTGGGGGCACCTCATGCTCAGCAGCTCTGT
CTGTTCCCCGCCCCAGATTCTCCACGGCTTCAAAGACCAGGTCGGGGAGGAGAATTGGCA
GCAGTTCTCAGAGCAGTTCCCGCCACTGCTCAAGGAGAGACTGGCCGCGTTCTATGGGGT
CTAGACAGGCTAGCGGGGGGACTACCAGGTAAGGGGGGCCCAGTGGGCGGCTGCAGGGGA
CCACGGGGTGCGCTCAGGTCCCTGACCTCCCTCCACACTCTCCCACAGGTTTCTGTCTGC
GTCGTCGTCAGAGGGGTCTCTAGGGAGCACGCTGCGTTCAGGAGTCGCCGTGCCCTGGCC
GAGGGGGGTTAGGGAGGAGAGGGCCCCGCATCCAGACGCGCTCCCCAGCCGTCTCCCTGC
CTCGCCTGGCCGGTGCTGGTGGGTAGGTGGAGGGGTCTCCACGCTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTCACAGCGAACAATCTGTTTCTATTTGTA
CATGAAATTAGAGAGTTCTGAGTGTGCCAAAGAGATGTTTGACATTCTCGCTATATATCC
ACTTGATTGCTAGACACTTGGGAATACACAGATAGATAGTTTTCAACTGGCAACGGCTGA
GTATGAGTAGTTTCTGCGATTTAATGGGATTGGGCGCCGATTGTGGAAAAACAAAGCTTT
TGGGGTGGTGTAGATCAGCTCTTCCATCTCAGTCCTCCATTCATCTCAGAGACAAACACT
CCCATTCACACACACACATACACAGTCACACACACACAGAGACACATACACACACGCTTT
GGGCCTGCTCCGCACACTTCCTGCCACTGGACAGCCACTGCTGTCCGTGTGCTCCCCTCT
GCCCTGGCCGGAAGCGTGGGACCATCAGCTGCTGGGGGGGGCACAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1158..1307, 1991..2097, 2197..2329, 2331..2331, 2432..2477, 2480..2512, 2589..2711, 2791..2909, 3465..3525, 3608..3773, 4172..4324, 4661..4858, 4895..4911, 4913..4917, 5095..5266, 5451..5537, 5619..5726, 5858..6016, 6464..6551, 6728..6826, 7107..7202, 7406..7511, 7595..7694, 7769..7843, 7936..8041, 8046..8047
1001..1076, 1158..1307, 1991..2097, 2197..2329, 2331..2331, 2432..2477, 2480..2512, 2589..2711, 2791..2909, 3465..3525, 3608..3773, 4172..4324, 4661..4858, 4895..4911, 4913..4917, 5095..5266, 5451..5537, 5619..5726, 5858..6016, 6464..6551, 6728..6826, 7107..7202, 7406..7511, 7595..7694, 7769..7843, 7936..8040
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved