Sorex_araneus Locus DHX15
snOPY snoRNA Orthological Gene Database
Sorex_araneus DHX15
Sorex_araneus
DHX15
GeneScaffold_1680
SNORA42
10935..11068
24297
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTGCATTTCTTAGGGTGCTAAATTTTACACTTCTCACTTCAGGAATGTG
ATATGTTGTGCTACACCTGGTAGTTCTCAGGGCTGCTTGTGACATGGTGGTTTCCCAGTG
ATGCTTGGGACACCATGTGGACAGGAATTAAACCAGGGTCTCCTACATACCAAACATGCA
TTCCAACCCTATCTATGTATCTCTCTCCCAGCTCCCCCCAAGTACACCTGCTGTTCTTCT
ATGGTCCTTTTGAATGGGGCCTCCAGGAAGGGTGATGATCTGAGCCCTCTCTTGGCCCTA
AATGGGGGTGGGGATTATTAAGATTTTAAAGTAGAGGTTTTCAGGCATCTTGGCATTCTG
CTCGCATTTCAAAAATAACTAAGCACTCTTCCTTAAAATCTAACTTCTTCAATTGGGAAA
TACACCAAAGGAATATACATTGCTTGTGGCGGTAGCATAATGATTTGAGGCAACTTTAAA
TGGTTTCTTGTTCTTGTTTTGCAGTTGAATGAATACTTGTATGTTATAAATTTCATTTCT
GCAGAAAAAGTTACAATAAGTAGTTTTGCTTTTCCAAAACTAAGCTGACTTTACTTTCAC
TCCAGAATATCTCAGTATTGACTCATAGCTGGCAGGACTAGTGTATAGCTTGTTTTGGTA
CATAACACAAATTTTTATTTAATGCTAAGTTTGCAATTGATTATGAACAACAGAATATTT
GATTTGTGGAATTTTGTTTAATTTTGACTTGTGATTGTATGTTCTGAAGTTCAGTTTCAC
ATGCTGTAAATATTCACCAACATGTACTTTGTAAATACAGGTATATGACTGATGGGATGT
TACTTCGTGAAGCTATGAATGATCCACTCTTGGAGCGTTACGGTGTAATAATTCTTGATG
AGGCTCATGAAAGAACTTTGGCTACAGATATCCTCATGGGTGTTCTGAAGGAAGTTGTAA
GGCAGCGATCAGATCTAAAGGTGGAGTTATTTCTTTTACCTATTTACCATAAGATGTCTG
GTGTGTAAACCAAAATGTTTCCTTCACACCCCCAAGCCCCCCCTCATCACTCTCTATATA
TGGGTAGTTTTGTAACTATGAGGCCCACTCTAACTCCTAGTGCTGGAAGCAGGAAAATAC
AAACCAATGGTAAGCCTCTTCAGAAATAACATTTGTTTTACCGACTGTGGACTGGAGCAA
TAACACAGCAGGTAGGGCCTTGCATGCAGCCGACCCGGGTTCGATTCCTCTGTCCCTCTC
AGAGAGCCTGGCAAGTTACCCACAGTATCCCGTCAGCCTGGCAGGCTACCCTTGGTGTAT
TCAATATGCAAAAAACAGTAACAAGAAATCTCAAATGGAGATGTTACTAGTGCCTGTTCG
AGCAAATCGATGAGCAACGGAAAACAGTGGACAGTGATACTGCTTGCACTCTTGCCAGTA
TTACTGTGTAAAGGACATGAAACTTCTGAAATTTTGATCTTTCAGATTTTTGCAAAGTAC
CCCTTTTTGCGTTGACTTTTTACTATTCTTTGGAATTTACATTAGGTTCGTAATAACTTA
ATGTTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTATTATTA
CTATTATTGCCCTTTTGGATCATATCTGGCAATGCACAGGGGTTAGCCTTGGCTCTGCAC
TCAGGAATTAACTCCTGGGGATGCTGGGGATCGAACCTAGGTCGGCCATGTGCAGGGAAG
ATGCCCTACCTGCTGTACTAGAGCTATGGCCCTGTAAATTTTTTACTTTTAAGGTATTGC
TTGATAGTTATTGAATATCAGATTAATTTCTAATCGCTGTCTCCCCTGTCCTGGGAATCA
AACCCAATGCTTCACGTGGGAAGCATGCTTTCTGCAACAGAGACATATTCCCAAGCCCCT
ATTTCTAAAAATTATTGTGTTTAATATACCCATCCCTGCCAGGTAGCTACTAACCCAGGG
ATTTGTCACGGGTAAGGCATTTGCACTTGGAGCCACATCCTCATTATATGTTTAACTTTT
TTTAAAATTGCAATTTGTTTATTATATTTATAGACATAATATTAAACATTGTACTTGTAT
TTTTTTAATGAATGCATAAAAACTTTTGATGACGAATTCAATAATGTATTGCCTTCCCTT
TAGGTTATAGTTATGAGTGCTACTCTGGATGCAGGAAAGTTTCAGATTTACTTCGATAAT
TGTCCTCTGTTAACCATCCCTGGACGTACACATCCTGTTGAGATCTTTTATACTCCCGAA
CCAGAGAGAGATTATCTTGAAGCAGCAATTCGAACGGTGATCCAGATCCATATGTGTGAA
GAGGAGGAGGGCGATCTTCTTCTCTTCTTAACTGGTCAAGAGGTATTACTGGCTTGATTA
TATAGCCTCGGGCATGTTCTGTTTCTCAGCTCTGTGTTTGGGGGTTCAGGTATTTTTGGG
GTCAGACTGTATACAACCTTTAAACTTAGAAATTTGGTCTAAGTTTAAAGAAATCTTCAT
CTGAAGAAATTAAGGTGCTTCTCTTATCCCAGTGTTTAAAACATTTTTAAACTTTGTATA
TGTTTATGAAGTCTGTAACTACTTTTATCTTTATATTCTGTGAGAACTATATCGTTGTTT
GTGTTCTAGTTATCCTATGTTTTTAGTTTTAGGATTTTGTGATTGTAGTCTCATCTTAGG
AGAGCTTGGTGATAAAAATGGCATGTGATTTATCTGCAGTTTTTCTTGTGCATAAATTTG
AGTCACAGCTTTGGTAAAACCTGGTCATCATAGTCGCTTAGTTTTTGGAGTGAACTGGAG
TAATTTTGTTGTCATTGAAGAATGGGAGGCATCAGTAAAGTACCTTGATTAGAATCTTCC
TTTTTGAGATAGGTTTTTCTTCAGGTAAGGCATTTTCTAACCTTATTACCATAGGTAACA
AGGTTTCATGGGAATGTTTGAAATTCTTTAGTGGAAGGAAATAAAGGGAGTTATCTGAAT
AGTAGTTATGGTTGAATTTCTCTCCCATAAAGAGCTTATAGCATTGTTAAGGGATTCTGT
ATTTTACACACACACACACACACACATTTAAAGAAGATAAACTCATAAGTCTCACTAGAA
AACCAGAGAGGCCAGAATTTTATTAAAAAACAAAAAAAGATTTCTGTACATGAAGTACTT
TATCAAATTCTAATGAGAGCATCTGATACCCTTAGCCAGTTACTTAACCGTATTTTTCTT
TTAGTAATGAGGTTTTGTTAGAGCTAACCTTGTCTTAAAGGCTTTGTGAATTTTCTGGAA
TATGCTTAAATGAATGGATTATCACTTGGAAAAAAATGAAGATTTTGATTCTGTATGTTT
GGTGGGGTCTGAGGGTTTTATTTCTTCACTCGAATGCTGAGTCTTTGTAATGTTTCTCAG
CTGAAGCTCTGGAGTAGTGTGACTCCAATATAACTAGAATACCAGAAACGTTCTAAACCT
GTTCAATATGGTAGTATCACCAACTTGTCTTTATTCTATTTGAAATGTGACTAGTGAGAG
GTGGTACAAGTTAGAACTTCACATAATTTTAAAGACTCCTTTTGACATTCTTTGCAAAAA
AGCATTTAGTAGAGATGGTATATAAATGCAGACCCTGAAATGCTTTGAGCATTTACAGCA
GATCTGACCACTGCTCCACAGCATTTTTTATTAGAAGAGTGGGCTATGGGTTGCCTGACT
AGGGGCACAGAATTTCTTAGAGCAGGTACTTGGCCCCTTTCCACATTGCTGAACAGGTGA
AATACAGAATTTTGCGTTTTGAACAGACTAAAATGATTTTTATGTTCCTTTATTGGATTT
TACTGTTTCAAAGTAATATTTTGCCCTAACACCCATGGCACCTCAATAAAGCCCTAAGCA
GCATTGTGGGAATTGGCCTAGTCATCATGGGTACGTTGTACACGCCAACCTGTACTAGCC
ACAAGTGAACGATGTCACTTGTGTTTTTTGTTTTGGGACCGCATCCTGCTGTGCTTACAT
CTGGCTCTACTCAGGGATGACTCCTGGCAGGTTCTGGAAAAATGGGGTGACGGAAATCAA
ACAGAGGGCCAGTTACCTGCTGTCCTATTGCTGCAACTTTTCCCCCTAATTTTGTATTTC
TTCATTAATGTTAGAATGTTCTGTGGTTGTCTTTCATTTGGTCATATTTCTTTTTTTGTA
AAGTGTTTTTGTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACTTGGACCTTAAATTGATTTATTTCTGGGGATTAA
TATTCTTTCATAAATTTGAAATACATCCATTTATCGCCTGGATTTTGTGTGTGTGTGTGT
GTGTGCGCGCGCGCGCGCGTGAGTGCTTTTTGGGTCACACCCCGGCAGTGCACAGGGGTC
ATTCCTGGCTCATGCACTCAGGAATTACCCTTGGCGGTGCTCAGGGGACCATATGGGATG
CTGGGATTTGAACCCGGGTCAGCTGCTTGCAAGGCAAACGCCCTACCCGCTGTGCTATCA
CTCCAGCCCCTATCTCCTGGATTTTTTAAATGATATTAAAACCATATTAACGTGAGCCAT
GGGAAGTAACTTCTATGATTATTTTGAGTTAATTATCAGTTTTAATTGGTGAAAGGTTGG
GATGTTTTTGTTTATAGAATTTTTTTATGGTAATGAATAAAAACTTGGACTTCTGATTAA
AATTAAATGTTTCCCAGAAGTCCTGGGGCGTGGATTACATACTGTTGAATTGGATACAAG
ATTATAATTGAAAGAGCCATTATAAATACTTAAAAGATGTTGAAACACTTTATTTTTTTG
TTTTTGTGTCACACCTGGTGGTGTTCAGGGCTTACTCCTAACTCTTAGGTTAAGGGATCA
CTCCTATGGGGCTGGGTGGGGCAGGCTATGTAGGTTGCTGGAGATCAACCCAGATTGGCC
CACATAGAAGACAAAGTGCAGAACCAGCTGTTCTATCCCACCCTGTTTGCTTTTTGTTTG
TTTGGACCCCACACCCACCCAATGCTCTGGGCTTTGAAACAGCACTTAGAGCGACACTTT
TTAGTAAAATCTTGCAAACATGTTATGAGTTTAACCACTATAAATTAGTGTGGTTCCTCG
GTTTTCTTATTAGAGGTGAAAGCTCCTGATCTTTTGTCTGTTTTCACTGTTGGCAATAGT
AATTAGAGGATGTTGTATTGCCGAAGAACATCAATAAGTTTTTTAACTGACTTTGATTAT
GGACATTTGGTGAAACTTGGGAAAAATTGTGTTGGAGTTTTAAAATAGAATATTCAGAAC
TTTTTACGAAACAGGTGGCATTTTTTTCATCCACTTTAGTCTTTCTATCCCATGAGATAA
GATTTTTTTTTTCCTACTTTGGCTTAGCAAATTGGCTAGTTCTGGTCGCAAGTAAAATTC
AAAATTACCTTCTTTCAAACAGGATTTTTGGAGCTATAATTTTTCAGTGTGAAATCTAGG
TACTTGGTTATTTCTGAAGATGTACTTTCTAGTAACTCCAGGATAAAAATAACAGTTGTA
AATATTCTGAGTATTGGCATCAATTTTTTTTCTTGTTTTTTCAAAAATCTTGTTTTGAAT
TTATATTTAAACCTTTTTTTAGATATGGAACCTATCTAATTTTGTATTTGCATACCAGCA
GGGGGCATTCTAATCTAGATACAGCATTATTTTCTTGAAAGCGTCACTTTTGTTCTGTTA
TTCTTCTAGTCAGTAGAATTCTTTCACTTTTTAAAATTCCCTATCTAAAGGAAGTATTGA
TACATGGGCTCTTTAGTAGTCATTCTCTTTGAAGATTTTCCAAGAGTGCTAGTATGTTTG
CCATAGATGAAAAAAATTATTAACTGCAAGAACTTAATTGCATGGCATGAAAACTTTCAA
TTTGAAATAATTTCAAGAAAGATAATTTCACCCAATATAGTAAATTATGGAATAAATTTA
CCTCATAACCTTTGCTAAAGAATAATGGGGTTTTGGTTTATTTTTGGGTTTTGTGATGAA
GGCTGGAACCCTGCGTTTTAGACACTGGGCTACATCACTAAGCTTAGGACTGTTTTTTAC
TGGGTAGTTAAAGTCATCCAAGTTATTTGTTTAACATACTTCCAAATTTGACTGAAATAA
TACTTAATAAAAATTGTTTCCTTTAGTTTTTAATTCCTTTTGCCACTCTTTAGTGCCTCC
ACTCTTTGGTCTCAACTCTTGCGCATGCTCTTTAAACTTTGGTTTGAATGCAAATGCATA
GTAATAATTTACTGTTAGGGAAATTCCTGAAGATGCTCTCCATATTTGGGCTAGCCTGCC
TTACTTTCTATGTTGATCCTGTAAAGGTGTTTGTTCTCATTAGGCACAATAAAGCAAGTC
TTCCGTATAATTTCATTAGTGATAAGTGACATTAAATTCTTAATTGGCTTGTTTAAAATA
TCTGGCCTATCAACTTCTTTTAGGTTGTGAAAATTATGATTCCGTTAAATTTCAGTTTTA
GTATAATTTGTTGAGAATTAATTAGGACATCCAGCTCTAAGAAAAGGAACATGGAATGCA
AATAAGGCAGTTCGGTGTTTTGCGGGGCTGGAGAGATGATCATTGGCACTTCATTGGGCC
CTGAGCACTGCTGGGTGTGGCCAAAATCAAAAAAAAAAACTACGTTGTGTTTGGAAATGC
ACAAAATTTAATGACTGAATTGAAAATATGGGGCATAGAACTAGGATTTTGAACAAATAC
CTTAAAGTGGGTTTTTTTTGTATTTTGTTTCAAGACATATTTTATTTTGTAGGAAATTGA
TGAAGCCTGTAAGAGAATAAAGCGCGAGGTTGATGATTTGGGTCCTGAAGTTGGTGACAT
TAAAATCATTCCATTGTACTCTACGCTCCCACCTCAACAGCAGCAACGTATTTTTGAGCC
TCCACCTCCAAAAAAACAGAATGGAGCAATTGGAAGAAAGGTAGCATAGAAATATTCTCA
TTTTACTAATACTGAAACAGTTGTCTGTTGATTTTTTTTTAAGGTACCTAGTTAAGGGCA
GTTTCAAAGGTAGGTTAAAAATGTGTGGTTATTCACCTAACTTTAAGCATACTGCTCTCA
CTCCCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTGGTAATAGGAAGTGGACACTGGAA
GAGGCGTCCGTGTGGTCTTGGAAGGTTTTGTGCATGAAACTTGAGCATTAGCAGTATGGT
AGACCATAGTGCCTCAAAACAAATTTATTTTTAAAAGAAAGAAGGACGATGGCCAAGTGG
TGGCATCTGCCATTAAATCACCTCACAAAACTAGGTATCCAAGATCTAATCAAATGTCCT
ATGTAGAAGTATGTCGAATGATGTACAGATCTCTTCACAGCAATAGCATGACCTTCACAA
TAGCGTGAATCATGCTGCCTGAGTGTGTGACTTTCTTGAGCGGGAATTAGATTCTTTGGA
GGGCAAATTCATTTGCTGGCTCAGAAAGGGAGAGACAAGGTTTTCCAACCGTTTGTGGGC
AGTTTGTTGAGATTGAAAGAGACTCAGTTTGAAATAGCAGCTTTGCCCTTTTGGTTTAAA
TAAGATGGGGAGTCTAATAGATTATTTGAAAATGTTGCTTGAACATCACTATCCAATAGT
CTAGTGAAGTCAGGTGGGCTATTTTTCAACCTGGTCTTTTTTTTCCTTCAGTTTTTATTA
ATTTTTAAAGTTAAACTAGTTTTATCTAGATGTACTATTCAAACAGGATTCAACAGAGCA
TCTCAAGAACTCTCGGTTTTACTTTGAAGTAGAAATTTTGAAATAAATGACTTGGAATCC
ATTAGTGGGCATCTAGAGAAAAGAGTTTTTTGGTTTTGTTTTGCTTGATTTTGATTTTAG
CATCACACCCCAGCTGTGCCTAGAGATCGAACCTGGGTCCATCCAAGGCAAGCTCTATAC
ATAATGTATTAAGCTGCCCTGACCCCAAGGGAGGAGTTTTATCTAGATAAAAGTTTACCT
AACAGCGCATTAAATACAAAATTGGGAGTAGCATCATGTTTTTGCCATAGCTTTACTTTA
TATTTTAGGGGGTCTTTTTCCATGTTTGATATTTAAGCCAGTGAGATTTGAGTCCTTTCT
AAGGCATCCCCTCCACCACAACACTCTATTCCTTATACACACACACCCATACACACGAAC
ACTTAATGCCAAGAACTTGTGCTGTGTATGTTCCCATTGGTTATATAAATCATTTGACAA
AATCGAGAACATGTTAACTAGATTACATGCTGTTACATCCAGGTCATACTAAGGGCATAC
CTAACTCCTCTGCTAAGGTTCTGGGCAAGTATGTAATGTTTAACATTTTTCTGCTGTTTC
TTCCACATAATGAATGTATGTGTTGCATAACTGATATTACTTTTCTAGCTTTAGAAGTAG
TTTAAAATTTGTATAATTTGTTACATGACTTTTTGTCCTCAGCCTGCCTTAATATTTCAG
AAACTTACTCTTCTTCTTAGGATTATAGACTCTTAGCACTAAATAAGTTTGGTAACTGGA
TCCTGCTGAAAAAATTTACTTCAAAGCTTTGGCGGGATGGGGTTAGAGGGCCTGTGACAC
CAAGGTGGAAACCTGGACTCCACATGCATAGCATGCATTTCTGCCCTTTGAGTTCTCTTC
CCCCGCCCTTGCTTAAATCTTCATTTAGCTTGCCTTTAGTATTTGAAAATCTTGGCTCTC
TGATTTTAACACCCTGGTGCTGTGTGTGTTTCTCTCAATGTCAGTTTGTTCTTAAAGTTA
GTCCCAGTTTTTCAAAAACCCACCCACATTTCCCCCCCCCCTTTTTTTTGCATTGATAGA
CACTAAACCCTTGCCCAATGCTACACCTTTTATTTTTCAGTTTTTCTGTTTCAAGCCCTT
AACAGTACAGGCTATCATGTAAATATGTGTTTAGTATGTAATTAGTACCTATTTAATAAA
GTAAATGGTATTTTGTATGTGAGTGCTTTTAAGGGAGTAGTCCCAAAAGTACCAGTCACC
CTCTGGGGCAGGAGAATGCTGACTACATGCTGTGGGGTAGCTTCAGTTGTAACTGGGGCT
ACTTTCTCTTTGTTAAAAAAAAATGGTAGATTTCCATGTGGGCACTGAGGGCACTGCACA
CCTGCAAAAAGGCCGATCAGGCAACCACACAAGTTTGGGACCCTGCACTTGAAGTGTCCC
TGTCAGAATTCAGGTGATCCTTATTAACTGCTTTCTAGGCAGTGACATAGCAACAGGTCA
TCCTGTGTGTCCCAGGGAATATGATCCTGGGATATGAGACTGTATGTGTGACAAAATATA
TCTACATTTAATTTTGATGCTTAAGCCATTTTGTTTGAAATGTTGGATTTCCTTTCGATA
GTTTCCTTCAGTACTGCATGGGTTTGGATTTATGGCAGGTCCGTTTCCCTGGGCCTCTCA
TAGTGTCCCATGCCAAAGCAAGCTGTGGCCCTGAACCGTTGCCTGGCCCTTGCCAGTGGA
CTGCAGGCACTGAAGTGGGTCGTATAGTGCAAAAAGGGGCTGGAGGTTCTTTAGTAGTAG
TACCTGGTGATACTGAATGATGTTTAGATATTAACTATTTCAGGGAACCATTCTATGACA
ATAACTTTTTGTCGCTTTACTCACATTTTTACTCTAATGGTATCCTGTTTGAATAATGAA
AATTTGGTGTGATTCAATTATGCTTTCTGACATAACTTGTTGGGAAATTGCTATGATGAG
TGGAGTGAAGTGAATTTGAATTCTTAAATGTCTTTAAAATAATGGCCAGTGGAAGATTTA
TTGCTTGAAATTAGTTATTAAAGTTGTTAAATGACTAATCTCTATAATTTTGTAATTTAT
ATTGCATATCGTTATATGTTAACAGGTGGTAGTGTCAACTAATATTGCAGAAACTTCTTT
GACAATTGATGGTGTTGTGTTTGTGATTGATCCTGGATTTGCAAAGCAAAAGGTACGTTT
CAGTATTTACGTGGTTTAATGTTTAATTGACTTGGACTTGGTGCCTACTACTATTCAGAA
TTACTCTTTTTTTAAACTTGTTGTAAGTCATGTTAATAATTTAGCTGATCTGTCTACTGG
TTTAATAATTTTGGGGTTTTTGCTAGGGGGTATATAGATGAGAAGGTTTTTATGTAGTGA
TGGTATGTGTTTTGCTTTGTATGTTCATTGAAGATATATGTGGGTAGTAATCAGTATAAA
ATTATCCCAGAGATCAGCCTCTTACCTACCTGAATTCTTAATATTATGTGTTATGCATAT
TATTTGAAGAGTTTGTTTGCCTTATTCAGCAGTACTAAGTATCAACAGCTTCTACTTAAA
GTAGTAACTACTTTTTTTCCTATTGGGTCACACTCACCGATGCTCAGGGGTTAGTCCTGA
CTCCAGAATTACTCCTAGCAGTGCTCAGCATACCCTGTGGGATGTCAAGGATTGAACCTG
GGTCGGCCACATGTAAGGCAAAAGGCCTACCATCTGTATTATCGCTCTGGCTTCTTAAGA
GTTTTTTAAAACAAATTTTTATTCTTTGGGGGTGGGGCTCCTGAGCTGTGTTCAGGAGGC
CTGAGGGCACCCCTGTTGATACTCCGAAAACTGGACCTGTTGTTCAAGGCAAGGACACAA
GGATGTGATACTGCCTGAATTCTGTGGTGCAGGGGATTCTTGATCCAGGCTGCCCTGGTG
CTCTGGGTCTGTGTGGTTGGCACAATAGGCATGTGAACTAACTGCCCTGCTATCTCTAGT
TTTTTTTTCCATATGTTTTTGAAGTTGTTGAGAGCCAGAGATCCTTCAGTATAAGAACTG
CAGCTAACATCCAGGGCTCTGAAATCTCCAGCATCACACACACCTGCCCTATCCACCCTG
TCTCTGCTAGGTGGAACTCTGGCAGCCCCATAGTATTGGCAGGCTCCCAGTCCTCACAGT
GTTGGATCAAGAAAATGCCAGGGAAACCCCATTTTTGTCAGAAAGATTGAGAGAATTCTT
TGCACATGGTATTCCAAGTGAAAGTGCTTAAACTGACTTCAGGACTGGGTTAAAAATATT
TCTTTTAGGGATGCATTAGTACAGCAGGTAGGTTTCTTGCCCTTGCATGTAGCCAACCCG
GGTTTGATTACTGGCATACCATGTGATCACACTATGAGGCGTGGCCCTGTAACAAAAGTA
ATGTTTTCCTTTGGGGGAGGATCGATAGTACAGCAAGTAGGGCACTTGCCTTTCACATGC
CCCACCCAGGTTCGATTCTCAGTGCCCATATAGTCCCCTGGCCTTGCTGAAATTTATCCC
TGAATGCAGAACCAGGAGTAAGCTCTGAGTGCCACCAGGTGTGACTCAGAAACAACACAA
TAGAAAAATACTTGAAGTCCACCCTGAACATCTGGTGTTAAAATTGATGTTCTTTTCAAG
CAAGTGCCACGAGCACTATAATCTATTACATAGACCAAAATAAAGCTTTTGACATTTTCT
TACAAGTTAAGATGATGTGAGTTCTGTTAGGTGAGAGCTTCTTCCTATTTGCTTGTCTTT
TAGAATGCTGGAGTACAGATAGTTGATAGAAAGTTACCACACGACCTGAGGAACTCTAAT
GGCAGCATTGGTCTATAGTGATAATCAGTGCTACTTTATTAGGTATCAGCTGTGAGTTTG
GGGCATGTCTGTTAGATTAAATTTTGGGGTTTTAGTTCAACAATTATTCTCTGACTTCTA
TTCCAATAGGTATACAACCCTCGAATCAGAGTTGAGTCCCTGTTGGTGACAGCTATTAGT
AAAGCTTCCGCTCAGCAACGGGCAGGTCGAGCTGGACGTACCAGACCTGGGAAATGCTTC
AGACTTTACACAGAGAAAGCTTATAAAACAGAAATGCAGGTACAGATTTTACGTGTTGTT
AATAGCAAAGACAAAGGTTTATTGTTTGCTTTTGCTTTTGTCACCAAAAGGCTCCCTAGG
TTTTCCCTAAATGAAATTGACTCTGTGTCTTTGTTCAAGTTCTGTAAGTTAATGGTGGAT
GCCAGCAGTAACACTTCACTAAAGCTAAAATACAGTTTTATCTTTATAAATACAGTTCCC
TAAAAGTGTTTAAGATTTCCATAAGCATTTCTCTCTTACATTCTTGGAAGTAACCCTGGG
CTAATAGCTAAGGAGGCTGAGAACAGTTAACCTTTTGTTTACTGGAACCAAGAGAATTAA
AGAATGTTTAACAGAATAAACCTCTTGTGTTTTGCTAGGATAACACCTATCCTGAGATTT
TGCGTTCTAACTTGGGATCGGTTGTGTTACAATTGAAGAAACTTGGCATTGATGATTTGG
TGCATTTTGATTTTATGGATCCGCCAGGTATGACTTTTCTAAGCATTCTATGAAGAAACC
CTTTAACCTAAGAATGAGCCATCTGTGTATCATATATTTTCCCTTTTCTCTTTCAATTGT
AAGATAAGTTTTTTGTGTTAGCATTAAAATTTAAGAGTGCCACTTGTGTGAGTTTTTTTT
TTTTTTTTTCAGAATAAATTATTCTGGAAATTACTGTACTGACATGAAAATACACTTTGC
TTTGGTGGTGGGGCACATTTGCCAGTGCTCGGGGCTTACTCTTTGCTCTTTGTTAGGGAT
CACTCTCGGCAGGGCCTGGGGGACCGTATTGGGATTCCATGAATTGAACCACTGTACTGT
CTCTGACCCTACATTTCTAAGAAGAAAAATTGTTTTAGAAGGAGAATTAAATCTGGAAGA
GGCTAAAAGGGCTGGGACACATGCTTTATCTATGAGAGACTTGGATTTCATGCCCAGAAC
CACGTGCCTCTTGATTCTTGAGCCACAACCAAGAGCAGCCCTAGAGGACCCTCTGTTTGG
GCTTCACTTCCGTAGCATCCTCGCTCCAAAGTATTATAAGCGTATTGTTTGCAATTTCCT
AGTTTACTTATTAGGAAGTGTTTTAACTACAATGTAGGGAAATTTTGCTGTTCTATGACC
GATTGTTTGCAAGACCTTTGTAATTGGATTTTATGACAGTCTTTTAGTTCAGTCCAATTG
AGAATGAAAAATGAGATTGCTATTATAGTGTTTATCACATCTTTGCTTGCTAAAGGCAGC
TTGTCTAATAGATTGCTTTTTTTCCATAGCTCCTGAAACTTTGATGAGAGCTCTAGAACT
TTTGAATTACCTGGCTGCTTTAAATGATGATGGAGATCTGACAGAATTGGGATCCATGAT
GGCAGAGTTTCCTCTAGATCCACAGCTCGCTAAAATGGTTATTGCAAGTTGTGACTACAA
CTGTTCTAATGAGGTCCTATCTATTACTGCTATGTTGTCAGGTAATAGAGGGAAAAGAAT
TAAGAAAAGCCCAGCTTTTCAAAGTTTGGGTGGACTTCACTTTTCGTTTTGGTTTTTAGT
ATGTAGTATAATAGAGGGTTTTATAGATAGATTTAAAGAACAAGTTTCATTTCTTAAATA
TCTTGTATGTAGCTTCATGATGACATAGAATTTACCAAACTAAAGTCATTGTGCATAAAA
TATAGTAGCAGTATTGGCTCTTCTGAGTGAAATTAAAATTTGTAGTAATACGTTTGAACA
TAGCTGTAGCTGAATTCTTTGGTAGGTCCATCAATTTTGCTGTTTATTATTGAAAGTACA
AGGAGAACTTGGTTTTACTACTTGACACTCCTAGCCGATGACAAAACAAAACTCATTTAA
AGTGAGACTTGTGACATGTATTTTAGTGGCAAACAAATTTTTAATTAAATATTAAGTAAA
TAGAAGTAGTGATGTGCACCTTGAGGCTTAAAAGTCTTATCCGGTCACTTCTTATAATGG
CAGAAAAACAGATGGAAGTAATACGTAAAAACTTGCTTATTTTAGGACTTTAGAGATTTA
ATCTGAAAAAGTAGTGCTATTTTTACTAGCACCAAAGCAATCCATAAATGAAATGTTGGA
AAAACTTGGAAACTAGGATTTAATAGAAGATAAGTCTTAACATGTAAATGTATACACTAG
AAAAGCTTGGGTTTTTACTGAGAAGGTATAGTACTGGGAAGAGTAGATTTCCAGTTGCAG
AGTGATTTGTTGGTGTATACAAAATTTATAAATACAAAATTTTTGGCTTAGTTTAGATAT
ATGGCTTATTTTAACGGTGTGAATTTTTTTTATTTAAGAACTAGTTAAAATGTTTTTTTG
CAGTTATGATTGATCAGACTCAGAGCAGATGGGCAGGGCAGTATTGAATAATTTTAATTA
AATTGTAGTCCCACTTGCGGAGGTGGTGGTAGGTTGTTGTCTGCCTTTCTTACATGCTGT
TTTTGTTAAGTACTCCTGGTTGTAGCTATCCCAAGACTTTCAGTGTTTAGAGAATGTGTC
GGGCAAGAGCTACCACATTGTAATGTTACTGCCCAGTTTTAATTCCTCCAGATTCTCTTT
TTCAAGCATATGATGGAGCTACCATTGTTTGAATTTAGAATATTAGCTCTATTTAAAATT
TGTCATAGTGATGCAGTTGAAATCTTCAGACTACATTTCTTCTAGTGGGAGTTATGCTAA
ACATAGGTTTTACTGCTCAGTGGCTGTAGTCCATCAGGCAGAGAATTTGTGGGGAATAAT
TTTAAAATAAAAGGTGAGAAAAAAGCTGAGCTTTTTTTTTTTCACTAGTTTCTGAAGATT
TCAGGTCCTGATACAAATTTAGTGTGAAATCAGGGGCCTTGTGAAATGCTACTTACTCTG
TGTCAGTTCTGGTAGCTAGTTCACATTCACTTACGGTTAACTGACAGGTTTCTGTACTTT
GATGAATTACTTGCTTCACTTACTTAAGCAAGACTTCTAATATTTACTGTGATCATGTCT
CATTGTCTTTATTAGCTTCTTTGGCATTTTAATGGGGGTAACTGTATGGGAAAGAATAAT
TTGATACTGTATTTGATCTCATTGTCAATTATTCCCATTATCTTTCTTAAGTATTATTAT
TTTTAATGACAAGGTTAAAGAGCTTTAATGATGTGTTGACAAAAGTCCCAAGCTGTTAAG
TATTTTCATACTGCTTCTGTGACTATGGAATTGGTAAAGTGAATTAAGGAAAGTTGTATT
TCAAAAACTGGAGTGCACGCTTTGTAATAACTACAAGTTTTATGTGACTTGAGGCTCTAA
ACAAATACTGTAGATACCTATTTTGATGACCCATGAAATGACTGTTTTAGACTAATTGTC
AACCTTTAAAATACTGGATTTTGCTTTTATTGAGGTTTTGATTTAAATAACTTTTTTAAA
TTTGGGACTTTTATTTACTAATACTTTTATTAAAAACTGGAAAACTAGGTTGGATATTCC
CAGCCTTTTTGAATTTTCTTAATTCAGAGGCGGTTTAACCTTCCACCACTACTGCTATCA
GCAAAACCCAAGATTTCATGATATTTTTTATGTTTACGTATGCTTCTGCTCACCGGTGCT
AATAGTGATACCCACCAGTTGGTAATAGCCCCAGCAATAGGGAAATAAATTTAATAAAAA
TGTGTTAGTAGACTGGTTTGAAAGTTTTTCTTAGCCTTACAGTATACAAATACAGCTTAA
TAAGTTTCACAGTCATTCAGTTGGATTCAGTGAATGATCTTTTGAAAAATTACATTACCT
ACAAGACTATTGACACTATAATTCTGGTTATTGGTAGAGCTATCAGCACTGGTTTTTTAA
GTAAGTTGAGCTTTCTAGCATCTTGATGGCCTTCAGAATAGCTGTTTTGATGCCTACTTT
TTAGATCTAGTTAAAGTAATCAGGTGCTCTGTAGCTTTGAAACCCTCTTGTCTTACAGAT
GTGGTTAGGTGTTGATGTACCAAATCAAGGTAGTAAACAGTCCAAGATGCAGTTGGAGGC
CATCCTGCCCTGCCCTATGCTCTGTGAACTGACCTAGCTAGGCCTTGTTCCTCTGTCTGT
GAATGCGTGACTCATCGATATGGGCGTTTGTGTTGGGCCCATACCAACCTTGTTTAGTCC
CACAGTGTTTTGTTCGCCCCACGGAGGCCAAGAAAGCTGCAGATGAGGCCAAGATGAGAT
TTGCCCACATAGATGGAGATCATCTGACACTGCTGAATGTATACCACGCTTTTAAACAAA
GTAAGTGTAACTTAGATTGAAGGTGCTCTTTTGTCTAGATGTCACTTGCAGCATATAAGA
TGTTTCCTCATCTCACTTTCATTTATTATCTGTGACAACTTTACATTAGAAACCCAGAGG
TATTTTAGAAAAAGCCTTGACTAGCATTTAAAATAGAAATTGCCTGTCTTGTTCAAAGTT
CTCTTTCAAGAAAGAAAAGAGTGCCCGTTTTAGAAACTTGGAAAATGACATTAAAAAGTG
GATGTATAACTTTTGTATAACTTTTTCTGTTTATTTTCCATAGAATCATTACTTGCTAGC
TGGGTTTTGTTTTGTTTTGTTTTGTTTTTTTAGTGAAACAAGATAGCTTTTATTGAACAA
AAATAGGGCGGGGGGTGAGTGAAGGGAATACATGTTAAAGAGAGAACTGGAACTTGAAAG
ACACTCATGCAAGATATGTCTTCATGGGAGAACACGAGCTTAAAGATTAAGCCTAACTAG
TATTTTTATTGATAGAGAGCCTACAGGGCTAGACAGGTGGTACAGTGCGTAGGGTGCTTA
CCCTAAACACATCCAACTGTGCTTGATCCCTTGCATCCCATATGGTCCCTGAGCACAACC
AGTAATAATTCCTGAGTGTAGATCCAGAAGTAACCCAAGTAGGTGTGGCCCAAAAGCATG
TGTGTGTCATACACAAAAATTAACAAGGTGGGCCAAGAAGATTCTAAAGGGACTGGAACC
CATGTGTTGCATGTGGGAGATCTGGTCCTGAGAAAGAGAGCAAGGAAGTAGCCACTGAAT
ATCACTGGGTGTTTCTTAGTCCGTCCCCCACCTTAAAAAAAAAATTAAAAGAGGCTCTAC
TAGAAATGTGAATGACTTTTGTTCAGTTGGATACATATAGTTTGTAAACTTGAGGAGGAA
AATCCAAGTATATTTTTAGTTTAAAAACTGCATATTGCTGAGGGGTGGGTGCTATTTTCT
CACATTGAAGATCTGTAGCACTGTCCTCCCGTTGCTCATCGATTTGCTCGAGTGGGCACC
AGTAATGTCTCCGTTGTGAGACTTGCTATTACTGTTTTTGGCATATCAAATACTCCACGG
GTAGCTTGCCAGGCTATCCGAGAAGGATGGAGGAATTGAGCCCAGGTCTGCCGCATGAAG
GCAAATATCCTCCTCACTTATGTTAGTAAGATCAAATACCATTTTAGTCTAAAATCGTGT
TCTCAGAATATTTAGTGACATGAGATGTTTTTCCACTTGAAAATGAGGAAGCATGGCAAT
AATAGTCAAGGTATTGCCTGATACTGTTGGAATGCAATGTTATTAAAAGTTGAATGAGAA
GAAATTTTCCAGCCAGACAGGTGTGTCCACCCCCCAAAAATGAGAAGTTAGATAGATGAG
AATAAAACAACTCATAACAGATCTTGGAAATGGTAACTTGTTGCACGATAGGTAACCAAA
AGCTGATAGCCCTACATTATCAGTTATCTCCCAGACTAGAGGTTCACTTATCGGTCATTC
TTTGAGTTTGTAGTTTCTGCCAATAAGTTACTTTTCTAATTTAAAACATTGACCTCTAAA
TCGGTATGTCTTGTTTTATTTGTAACTCTTTTGCATTAATTGTATTTGAAAAATAAAATT
TTTCAGATATTAGTCAAGATTGTCTTTGTTTAGGGATGGGTTGATGGGAAAGCTAAATTT
ATCTTAACATTTGTGAAATAAAATTTTTTATATTGTAGCGCCTTTATAGGTATGAGCATA
GTGATATATGTTACAATTGGTAGAATCTTAGAAGCCAGGAGAAAATAATGCCGAAGACTT
AACTTTCACAGTAGCACATTCACTGCTTAAATTTTAAATATTTCTCCCATGTTCTCTTAC
CTCCATTTCACTCAGGCTTTGTATTAGAGGATTTTTGAAGTAGAGAACAATTTTTTTAGT
ATAAATATGCTATTATAATATGTTTGTTATGCTACAGTTTTGAGTTCTTGGTTAAAGAAA
CATCAATTAGAAACATGTCATTGATCAGTGGACAAATAATTTCCTTAAGTGCTTAGTCAT
GAAGTTAAACTGTCGCTAATACTTTAGACTTTATTTGACCACTCCTTCAAGTTGTGAGTC
ATAATAATACCTTTAAACACTAAATTTTGGATGCTTTAGTCAGTTAAAATTAAAGAACAA
ATACATAGTAATTGTTTAAGGTTCCATTTTTTCCGTGCATTGATGAGCTTCTAGTGACAG
TAGGAGGAGGCTCTTTTTAGTGATTTTTTTTTCTTTTTGGGTCACACCTGGCGATGCACA
GGGGTTACTCCTGGCTCTGCACTCAGGAGTTACTCCTGGCGGTGCTCAGGGGACCATATG
GAATGCTGGGAACCGAACACGGGTCGGCCACTTGCAAGGCAAACGCCCTACCCGCTGTGC
TATCGCTCCAGCCCTCTTTTTAGTGATTTTTAAGTTTTGCTTGGTGATCCTAAGGAAAGA
CTCTTTTCTTTGAAAATAATAAAGATGCAACCTTTCATCAATTGTTTTCAATCCACTTTT
ATTAGATTATCTGTTGGAAGCAGGGTGTGATAGCATGGAGAAAGTGTGTCCTGTTTATTT
CAAGAAATTCACATCTTCCCCCCCCCCCCAATTTTATAGATCATGAATCCGTTCAGTGGT
GTTACGACAACTTCATTAATTACCGATCCCTGATGTCTGCAGACAATGTACGCCAGCAGC
TATCTCGAATTATGGATAGATTTAATTTGCCTCGTCGAAGTACTGACTTTACAAGCAGGG
ATTATTATATTAATATAAGAAAAGCTTTGGTTACTGGTTATTTTATGCAGGTATGTGGGT
GTAATGTATAGTGCTGCATAGTTAAATGTTTATATAACATTGTTTGGAATCCAAACCGTT
TGGAATCTATTTACTGGCAAAACTGAGTTCAGGAATGCCAGTTGATAAATGTTGATCTTA
AATATGACATCCATATTGCCAAATAAATGAATGTACTTAGAAATTTTAGTTCTTTGGCTA
GGAGTATAGCTTCAAAGGACTGGAGTGCATGAAAGCCCCAATTTTTTTTTCCTTTTCTTT
TTTGGGTTTACTCCTGGCTCGGTGCTCAGGGGACCATTTGGAATGCTGGGAATCAAGCCT
GGGTTGACCCGTGTGCAAGGCAGACACCCTACCCGCTGTGCTATCGCTCCAACCCCTGAA
AGCCCAACTTTATCCTCAGCACCCATAGTCCCCATAAACTGAGCAGTGGCTTGAAAGACT
CAAAATGGTTTTTTGTTTGTTTCTAATAAGTAATTTCCATTGGCAAGTTTAGCAGTCCAG
TTACAGAAGTCAATATTTTAATTACTTTTATACCAAGTGTTTTTATATTCGTATTTTTTG
ATCCCAGTTTCTGGTGGGATAGTAGATGGAAATCCTCCAGACTCTTATTTCCATTTCCCT
TAATATTTCATTTTTCTTGTGTGTACTCACTGCTTCTTGACATGTTTAAACATTTGTGAA
GATTGGCAAAATATTTCAGCCATTGTAAGTTTCAACCTTTGGCTTTCAGTAAACATGCTC
CATTTTTTGTTAATCTCAGTTGGAGAGGTTTCATCCTACAGTTCTGAAAGAATGTTTTTG
GTGCAGTTCATGTTCCAATTTATTAAGATGGAAATTCAAGATTCAGATATTTAAATTACT
ATGTGGCATGGCCTTAGGGAATGATGGTAACAATGTGGCTGCAAAAGTAAAAACATTTCT
GCAGTTTTAATTGCCATCGAGGGTAAACTGATTAAAGCTTACCAGGTGGTTATAGGAAAC
ATTAGTTTTAAGAATTTGAAGTATACAGAAGTTATGTTAAAATTCTCACTTTTTCAAGGA
TGTTCCTTCAGCCACATTCACAACATCCTCCCATGTGAGTGTCCAAAAATATAAGAATTG
GAAAGAGCAAATTTTCATTTTCTTCAGCGTTAAATAATAGACAGGTGTTACCCTTGTGAG
TTACTATAGATAACAGAGGCAAGAAACATTGTTTGTGGGTTACCTTTTGTTTCTTGCTCA
AGTTTGCTCTATTTTCCTAAAATACATCTGTGTTGTGATGTTGTCCAGTGTTGAAAAACC
CACCCTGGGCAGTTGAAGCCATAGAGGACTAGCTTGATGATAAGGCTCTGTTGGTATAAT
AGTTCTTATTTAAATTAGTCTGCCTGCCTTTATAGTGTGAATGAGATATGTCTGTGTTCA
AACAAGACTTAATTTGTAGACCCCAAATTCAATTTTCATCACCACATGGTCCACCATCCT
GGATATTAAAGATGTATGAACCATTCTTGGCCACAGCATTATAATGTAGGCAGTGAATTG
GATTTGACCTGCAGTAGTTCGTTTTTATCACAAGATAGTTATCCATAAGTTTTTAAGTGT
TAAGCCCACTGTACATAATTTTGTTGGTAGTTTTATTTAACACTTTTGTAATTGTTCCCT
CTTAAACAATGTTTTTATAAATAACTGGGTTTTGGTTTCAGGTGGCACATTTAGAACGAA
CAGGGCATTACTTAACTGTGAAGGATAACCAGGTGGTTCAGTTGCATCCCTCTACTGTTC
TTGACCATAAGCCTGAATGGGTTCTTTATAATGAGTTTGTTCTTACAACAAAGAATTACA
TACGGACATGTACAGATATCAAGCCAGAGTGGTAAGTAATGCCTTTTCTTATAGTAGTTT
TTGTTAGCATTTTACTCAAAATGGAATCTGATTATTGTAGGATTCCTGGCCTGACAATAT
GGTTGATGTCTTCGAGGGTGACAGAGTTGTTGGTTTAGATGGGATTTGGTAGTAGATGTA
AATTTACACCAGCATCAAGTGGTTTTGGTGCCATTCCCAGGCTCCTTGTTTCAGAAGCCA
GTCTGTACCATTAAAATTAGTGTCAACTATTATTTATATATCTGTCCTTTAGGAGCTAAG
CAAGCATGAAAACTGCCTTTCTGTATCCTAGCATATTAGATCTACCAAATGTTATCAGAA
CTATTATTCTAAGCAATATTCTCTGGTGGGGGGTAGGGGTACGGAGCATAATGCAGTCTA
TAACTGATAAAGAGACATGTGCAGAGAAGGGGAGGAGTGAAAGTACCTTAAAATTGATGT
CACATTTAATATGTAGTGCTTCTTTGCTAAACTGATAAGACTTTTGACACTTTAATGGCA
TAAGTCATAGCCATTTTTTATCATAAGTGCTCTTGAAAAAGTGTGACTAAATGGTAAAGA
TAAGAGTCAGGTGTATTTTTTTGAGATGGAATTCTGTTTCTACTTGCTAAAACTTTGAAA
ATGAGAAGATTCAATCATAAGAAATACTAAAATGGTTCTTACCTTGACTCATACTGCTAT
GCCTTGGAGTGGTTGGTCAAAATAGTGCCAGAGTTAAGTTCATAATCTTTTTGACATTTA
CAAAATTGAATAACTTTTATAATCAGTGTTTAAAAAAAACCTTAAAATGATTTGTCTATT
ACTGCCTATCCTTATTAGAAATTCTATTATTTGAAATGTTAATTTGGTAATTTTCCCCCT
CTCCTCCACTTCCTGGACAGGTTGGTGAAAATTGCCCCACAATATTATGACATGAGCAAT
TTCCCACAGTGTGAAGCAAAAAGACAGTTGGACCGCATCATTGCCAAACTTCAATCCAAG
GAATATTCTCAGTACTGAATTCAATGCTTAGAACTGAAGTTATTCAGAGGACAGCTTTAA
AAGATGAATGAACAAAAGTTCAAGTTGTGCTCTTCACGTTGGTTCAATAATGGCCTTTAT
TTGAAAGCTTTTTAATTTTTCTTTACAGTAAATATTCCATTCTGATTTCATAAATTAAAC
ATTTATGCCTCCCTTTTGTGTTGACACTGTAGCTTATACTGGAAAAGTCGATCAATGTTT
TGCAGTTTATTGAAAGTAGTTCTATATATAACAATGTTATAAGCATTTCTTTAGAAATGG
TTGAAAATGCTTCTAAAATGTGATTATCGACCATGGTATGCATGATCGTTGTAATTGTTG
ACATTCCTTTTAGAAGTTGTGAAATGTTACAACTTGTGCTTATGTAGACACAATCTTCTG
TCTCAGTACAGAGGCACTGACTTCAATAAAGTCTATTTATACTAATTTCGGCCAAAGCAC
TTTGATATCTTTCTTCTAGTGTTTCTTAAGTATGGCTTCTTCTCTTCCCATGTGGGCTTT
CAAAAATTATAATTATGCTGTGATTACATATTTAACATCTTTCCACAAGGACTACTCCAT
CGATAAAGTAGTCATTAAAGCAATATTTTTTAAGAGCATAGCTTAGCACTTTGTTAGGTT
AATCAGGATGTAATCTAATGGGATAGTGTGTAGCCTTTATTTGAAATTGGATTCCAAAGA
CATAATACTGAAAGGATAGCATTCTCTTTATCTTTTAAGTTCATTTCATAAGGCTGTTAA
TTTGTATTTTGTTAATTGCTTTTTGGGGCAATCTTGTTATAAAGAAACCTTTTTAACACT
CTAGCCTCTGAAATATTGATTAGTATCAAATGGAGATTAGGAGGCATGAGCAATCTCAGT
CAGTTTTTGCTAAATTCTCAGTAGAGGGTGCTTTATAAACATATGAAGTAATTATAATGT
GATGTATTAAGATTCAAAGTTGTCTTTCCATTTTTTTTTTTGTAATTGTTGACAGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1159, 2403..2621, 8212..8379, 11425..11511, 13269..13418, 13778..13886, 14669..14860, 17517..17639, 20259..20449, 22121..22290, 23180..23297
1001..1159, 2403..2621, 8212..8379, 11425..11511, 13269..13418, 13778..13886, 14669..14860, 17517..17639, 20259..20449, 22121..22290, 23180..23294
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved