Sorex_araneus Locus DYRK4
snOPY snoRNA Orthological Gene Database
Sorex_araneus DYRK4
Sorex_araneus
DYRK4
GeneScaffold_110
SNORA72
6694..6830
30828
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCAGATGAAAGATTCTGGCGTACAAAT
GATAAAAAAAACGCATCAACCCTTTGGCTTCTCTCCTGGGTTACTACTTATGCAGGGACC
TATTGAGAGAATGTGACAAAGAAACAAAGGCGTTAGATACACTCATGATTAATTGTGCCC
TCAGACCAGTGACTTCCTATCTTTCTTTCACCAATTGTTTTGGTTTTTTTTTTTTTTGCG
GTGTTAGGGCTTGAACCCAGTACCACACATATGCAAGACAAATGGAGCGACATCCCCAGC
CTGGGCAAGTCACTTTATATAGTTAAATAATTGGTCTTCACAAGGGAAGCAGTAAAAAAA
CAATATTCTATCCCTGATTTTGTACACTGTTATATCCACAGAATTGTTAATTTATTACTG
TTATGGACGTGGGTCTCTCAGGGAAGAAACCTGAGAGAAAAAGGGGAAACTACTATCTCC
TAATACAGAGGAAAGGAGAGGTGTCTGGTGAGCTGTGTGTGTGTGTCTCTGTGTGTGTGT
GTATGTGTTCAGATAAATGGTGTAGGGCACCAGGGTGAAACCTAGATAGCCCTTCATTGG
AGGACTCTTTCCCTCAACAGGATAATCAAATGCACAGCCATTCATTGTCCTCTGAACACA
CGACTTCGGAATCAACTTTCCATAGCAGCACTAAATCCCACGAATCCAAATCAGAAGAGA
AACCATCCAAGAAGCAAAAAGTCCCCCTGACAGCCTCAGGTATACCTTTAGGGTTTAAAC
CCAGGAGTCTGGGGGTGGGAGTCGGGGTGTCAACATCTGGGCTGAACTGCCAGCTCTTGG
AGGAGTGCATTGAGGCAACAAACTCAAGGGGAAAACCATAGTCAAAAGTTCAGCACTTGC
CACTGACGTCTCTTATTGGTGGGTTGTTTTGTTGTTGTTGGTTTTGGGGCCAAGCCTGGC
TGTGCTCAGGGACTGCTCCTGGTTCTACGTCCAGGAGTGACCCCCTGAAAGTGCTCGAGG
GATCATATGCAGTGCCAGGAATTGAACTGGACAAGACAAATGCCTTAACCCCTGTACTAT
CTCTCTCTGTCCTTTTTTGTGATGGTCCAAACTGGAGACAAAGGAGAAAAAGGCCCCCGT
TTCTCATCCCTGGCCCCAGCGCTTAGGCTAAGACCCTAAAAATATACCTGAGGATGTTGG
GGATACTTTGTGCTCACTTGGATGGTTTGGCCTCTGATTTGAATTCGTGGGACTTAGTGC
TCCCTTTGGTCTCCCCATGGACTGGCCTCCTGGGAGACGATCTCGTGATCTGGAAGCCCC
AAACCTCTCCACTTGAAAAGGAGGAAGGAGAAGACATGGAAGGAAGTAGGGTTAAAGGTA
GAAAGGTACTGAGTTTGAGTGGCAGAAAAAGTCTTGAAGCCGGTTCCTGACAGAGAATCC
CTGAATCCGGTGAATCTCAGAGCCTGACTGGCCAGGGAAGCTGGATCCTTGGTGCTGACT
CTCAAGGGTCTTCAGTGTTGACACCAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTCCCCCTG
CCCCCATTTATCTCTAGAGCTTTGGTCTGTCCTCTTAGGTCCACAAAAGACCCTAAGTGA
ATCCACACCTTAACCTTTCACATCTATGAAAATAGAGGTCATGAAGCCCCCAGAAGCCTA
TTTCTGACCCCTTCTCCCCTGCCACCCACAAACTAACTGCAGTTCCTTCTTCTGAAGGTC
GTGAGAGAATAGGGTGCCTCTCTCCTGGCTCCATTTCCAGTCTGTCTTCTCAGAGACTGT
TCATTGAATATGAAATCTCTCTTTCTCAAGTGTGAATCCCACCCCACTGCTGCCAGAACC
CTGATGTCCGACGGCCAGTGTAGACTAGAGATGAGCTCAACCCAAGTTTCCTTTGTAGAC
AAGAAGGGAGGGATACCCAGGCTCACCTCACCTGTGGAGTTGAGTCTCCTAGGCTGTACA
GAAACATCCAGATTACGCTTGGTCACTGAAGATCGTGTACTTTGCAAACACTCTACAGTG
ATCTATAGAATGCAGCCAAATACCAGTTTAATTTGGACTAACAGCCCCCTCAATAACCTG
TTATGGGTGACCCTAAGTTTACTGCTTGTAGTTTTTGCTCGGGCTGGATCAATAGCACAG
TGGGTAGGTGTTTGCCTCGTACACGGCCGACCCAGGTTCGATTCCTCCACCCCTCGAAGA
AGAGCCCGGCAAGCTACCGAGAGTATCTAGCCCACACGGCAGGGCCTGGCAAGCTCCCCG
TGGCATATTCGATATGCCAAAAACAAGTCTCACAATGGAGACATGACTGGTGCCCGCTCG
AGCAAATCGATGAGCAACGGGATGACAGTGACAGTGACGGTGACATTTTTTGCTCATACT
ACTGCAACCCATAGGACTTTAAAAAAAAATTAATTTTTTTTTCCTTTTTGAGTCATACCC
AGTGATGCTCAGGGGTTACTCTTGGCTCTCCACTCAGGAATTACCCCTGGAGGTGCTCGG
GGGACCATATGGGATGCTGGGAATCGAACCCTGGTCGGCCGCATGCAAGGCAAATGCCCT
ACCCACCATACTATCGCTCCAGCCCCTGCAACCCATAGAACTTCAGGAACCAAACTCTCT
CCTTTCCCACCTTTGTGTTTCCCCCCCGACTTGTTGGCGTCAGACCAAGACCTGGACATT
CGTGTCGCCTTTGCACCCATGTGACTGAAGCTGGCTGGCCCTAGGAAGCATCTCAGTTGA
GGGAAAGGTTGGCCTTGAGCTAGAATGGTTGCCTCATCTGCATGCTGAGAAAAAGTGGTG
CCCACGGGCCCTCAACTGAACACACCACTGCAGTCTTTTCCCCACAGAAGCTCTCAAGTT
CTTTAAGAACCAGTTGTCTACTTATGAGCAGAGTGAAGTTCTGGGCTACACCGAGCTGTG
GTTCCTGGGGCTCAATGCTGACAAACTCCACGTGCCCCCTCAGAAATGCAGCAGGACAAG
TTTTGATGATGAACATGGCTCCTACATGAAGGTTAGGTGGGTGGGGAAACGGGGCTACCA
CCAGAAACTCCGGTGCAGTTGGGTGGCACTTTAGGGATGGGGGGGCCCACAAAGGGGTCT
GGAAAAGCAAAAAAAAAGATGGGGTGCCATGTAGCATTTGATATTAATGCATGTAGCATT
TGATATTAATGCACCAGGCGATCTACAGGAGTCTAGTGAGAAACTGTGGAATCAAAGACA
TGCCATGTTTACATCCAGGAAAGATACTACTCATATCCAAACTTTGTATGGAGACTGCTG
ACTTTGTTCAAGAGAATTTGGGGTCCCTGGTGTGTGATGGGGTGGATTCTTAAGTGCTCT
TTACCCACCTAGCTCTGAAATGTTTTGAAGAGGCCAGACGGGCGTTTTCCAAAGTGGGTG
AGACCTGGCAGGGGTCGGGGATGAGGGTGGTGCTGGAATACCAGTGTGTGATGGTAGTAA
ACCCAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGACAGTGAATATTCTTGCTATTCTGATT
TTATAATCATCAGGGCAGGCTTGATCACTCGCTATAATAAGTCCATGCATATGTCCCCAG
ACCTAGCTCTTTACCTATGAAGGTCTGGTCTTGAAAATGATGGTGATAAATCAAGTTAAA
TATTTTCCTTCCCAATCCTCCACTTGATCCTCTTCCCTCTATTCTACCCACATTCCCAGC
CCAGGAAATTCCACAGGGATGTCTGTTACTCCTACCTTTAAGCTAATTCACTGGAACCCA
GTTATTCAGTGGTAGAGAGCTGGGTTGCAGCCCCCATCCCTTCCTTCTGTTGGTACTGTT
GTAATGACTCAGTTTTCCCACACTCTTGTTGGTGTTTTTCAAGAACTCACAGTCTTTAGT
GGTGTAGCTGAGAGTGGGAATCACATTTCTGGTTGGGAGTGCTCATATCTCGTTTCAGTG
TTGGTTCTCCCTGGGGCCACTCCCTCTACTTGTGGTCCTACACACACGCACACATATGTG
GTTGCCATATGGCATTAATCTGCTAGCAGCTTCGAGGGAATCACAGATGGCAGAGCTACC
AGGTTCACAGCTGGTGCGCGATCCTGTGAGCAATCACGCAGACACAACCACACTCACGGT
TGGCAGAAGACATGTTCAAGTGTTGGAAAATACTTCTGGGGACGTCAGTACAATGGTTGC
GGAACCTTCCCTTTGCCCTTTTACAAACAACCTTTAAAAGCATTTCAGTTCCATGTGTGG
GATTCCCAGTCTGTCTGAAAGTAGAAGATTCCTATTTGGTGATTTGATGAAGTTGTTTGG
GGGGGCTTGGGAATGCTCAAATTTTGAAGCATAAATTAATGGTCATGGTGTTCCCCAGCC
CTCCCAAAATAACATACCAAATCTTCATATAATACACATGGGGGATTAAACTCACTGAGA
CTTGTCCCCTTTGACACTTGCAAGGCAGATATTATTGCTTTTGAACCATTTCTCCCAATT
AACCCCCACCTCTATAATCTGTTTGTTTGTTTGTTTGTTGTTTTGGTGACTTTTTGGGTT
TTTTTTTTTTTTTTTTGCTTTTGGGTCATAGCCAGTGATGCACAGGGGTTACTCCTGGCT
TTGCTCTCAGGAATTACACCTGGTGATGCTCAGGGGATGCTGGGAATCGAACCTCAGTCA
GTCATGTGTAAGGCAAATGTTCTATCCGCTGTAATATAGTTCCAACCCTCTCTATAATCT
TTTTAATTGGAAGTTTCCTATAGCCTTGACTGAAAGCTTCCGCACTCATTTCTGTTACAA
TGAGGCACATAAGTGATTTTGGAAACCCTGTCCCTTCTTAGGTGAGAGAAGTTGAAATTA
TGTTTTGCTATCTCCAAAATAGAGTTAAATTTGAATAAGGGCAGAGGAAAACCAGATCTG
GCCAGGTGCAGACAGAGCAGACCAAAGCCTTCTGTGGTTCCTAGAGGAGTCAGACATGGA
AATTTCCCCACATGGAAGCTCATACTCAGCTACACTCAAGAATCATGGTGTTTCCAACTG
CAAAGGCCCTGCAGGGTCACTGTGTTCAACTCATTTTATTTTTTTTGGGGGGGGGGCATA
CCTGGCGATGCTCAGGGGTTCCTCCTGGCTCTGCAGTCCGGATTTCCTCCTGGCTGTGCT
CAGGAGACCATATGAATTTCCGGGGATCAAATCTGGGTCGGTCGCATACAAGGCAAGCAC
CCTCCCTGCTCTGTCCGTAACCCACTTACTTCACAGGTCCCACCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATTTGGAGGTGACAGCGATAGGTGTCCACTTGGAAGACG
TCAAAATCCCCAAGGTCAGGAGATCACTTGGGCAAAATACTCTAGGTCTCTGAGAATATA
ATTCAGGCAGCAAACTATACCCAAAACAGGATAGAATTAAACAGCTTAGGGTTTTTTTAG
ATGTAGAGGGCAACACAGGTTAAAAATTAGGATAAGAAAGTGTCATTGGGACTGTGTACT
TTAAGGGTGCCTGCCGATTGGCTATGTGAAATATCCTAGCCGGCTCTTAATGTACCATTG
AATTTGGGATGCTTACTAACTGTCCTTAACGTTACTGTCAACTTTTATTAATATTTTTTT
TTTTTGCTTTTTGGGTCACACCCAGCGATGTACTCCTGGCTCTGCACTCAGGAATTACTC
CTGACGGTGCTTGGGGGACCATAGGGGATGCCAGGGATCGAACCCAGGTTAGCTGCATGC
AAGGCAAACACCCTCCCCGCTGTACACCACTCCGGGCCCTGCTGTCAACTTAAACAATGG
CTCACATTGACGCGCTCGACCTGGTTGTGAAGGACAATAGTCCTTGATGGGAGTTAGTGC
CTTGGGCAGCCAAAACTGACATCCGTCCCCTTCTTCCTAGGAGAATATAGTATTATATCA
GAAGGGTCAAGTCTCAGTGAAAGTTATTGACTTTGGATCAAGCTGCTATGAGAACCAGAA
AGGTAGGCCCCCGTTCCAGTTCCTGGTTCTCGATCTTTCCACTGTGATCTCTCTCCCTTC
TAGAAGCTGGGCCGTAGGTGGGCTCAGCCAGGACAGTTCCTCTGAGGGTTTGGAGCAAGG
CATGTCTCTTCTCTGAGTCTGAGTTCCCACCACAACAAACGGAGATGTTAGGACTCAGAC
TTCGTGTAGGCCATTAGTTTGCCATGCTGCTCCTTCTCCTGTGAACTTAGAATCCCCCAC
AAACATTCGGTGGCAAAACTCACTAGACGTGCATCAGAATGCTTGAAATTAGCTGTACAA
CGTGGCTCCTAAGTCCTGGTCACTGTCTTTGTCGGGTTTTGGTTAAAAATCAAAGCGATA
GTTGTCAGTGTTTGGGGTCTACTCCTGGCTCTGTGCTCAGGCGTCACTCCTGGAAGTGCT
CGGGGGACCATAGGTGGTGCTGGGTGCCCAGGATTAAATGGGGGTTGGCGGGAAGTGGTG
CTTGCTTTGATAGCTTCCTGCAAATCCTGCAGAGAGAGAGATGTGGGGAGTTTAAACGAT
CTTCCATCGCTCCAGGCAGGAGGTACCCTAGTGAAAATCGCTTCTTGGGATTGGAGTGGA
AAGTTTTTCCCACTCATGCCTTGTCTTTCTTACTCCCTGCAGTATACAGCTATATCCAGA
GTCGGTTCTACCGATCCCCAGAAGTGATTCTCGGCCACCCCTACAACATGGCCATTGACA
TGTGGAGCCTAGGCTGCATCATGGCTGAATTGTACACGGGCTACCCTCTGTTCCCTGGGG
AGAATGAAGTGGAGCAGCTGGCCTGCATCATGGAGGTGAGGGGGCCTAGGGGCCTTGGGG
GCCTTGTGTAGGCTTCATTTTTTTCATTAGCTGGTCACCACAAGTTGCTTTGAATGAGCT
ACTCCCACACATCACGTGAGCAGCCTCCTGCCTTGTGTTTTTTTGAAGGTGCTGGGCCTG
CCACCCACCCACTTCATTCAAACGGGCCTCCAGGAGACAGACCTTCTTTGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGCATGATAGACAATTGACACACATGTGCAATGTCTCCCATTGTGAT
TCATAAATTTCCAAAGGGTGTCAACCTCCAAACCGCTTTGGTAATCCTTTCCCTGGTGTC
ATCCTGAAGGGCAAAGAGGAATAAGGGGCTTCATCTGAGAAAGGGGGAAAGATGCCCCAG
ACTGGTACCAGTTGGCATGAGGGAGAGGAAATTGGGCATCGCTTCTGGGAACGTAGTCTT
GGCATTGAAAATGTGCAGGAGGAGAATGATTTGATTCCTGCTCAGATCTTGAACCCTCAA
GAGGATGGGGCCGGAGTGATACAGGTGGAGCATTTGTCTTGAATCAGGCCAACCCAGGTT
CAATCCCTGGTATCCCGTATGGTCCCCCTGAGCACCTCCCAGAGTGACGCCTGAGTTCAG
AGCCAGGAGTAACCCTTCAACATTTCCCAGCATGACCCCCAAACAGAACCAAACAGAAAC
CCCCCCAAAACAAAGATTATGATTGAATTCTGGCCCGTAAATTTTCCTGCCTCTCCCCTG
CCCCAACACACACACACACACACACACACACAAATCCAAGAGCAGATTTTTCTTTTTAAG
AATAGTGGGGACTCAGGGCTGGAGCAATAGCACAGCGGGTAGGGCGTTTGCCTTGCATGC
AGCCGGCCCAGGTTCGATTCCCAGCATCCCATATGGTCCTCTGAGCACTATCAGGGGTGA
TTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATTGCCAGGTGTGACCCAAAAAGAAA
AAAAAGAATAATAGGGACTAGCTGGAGTGATAGTTCAGTGGGTAGGGTGTTTGCCTTGCT
GACCCAGGTTTGAACCCTGGCATCCTATGTGGTCCCCTGGGCACTACCAGGAGTGATCAC
TGAATGCAGATCCAGGTGTAAACCCTGAGCACATCTGGGCATTCCTTCTCCTACCCCCTC
TAAAAAAATCTAATAATGGGGAACTCCATTACTATGGACTGGAGAGATAGCACAGCGAGT
AGGGTGTTTGTCTCCCACGCGGCCAACCCGGGTTCGACTCCTTTGTCCCTCTCAGAAAGC
CCGGCAAGCTACCAAGAGGATCCTGCCCACATGGCAGAGCCTGGAAAACTCCCTGTGGCA
TATTCGATATGCCAGAAACAGTAACAACAAGTCTCACGATGGAGACGTTACTGGTGCCCG
CTCGAGCAAATCGATGAACAGTGCTACTGAAGACAGTGCTACAATGAGACATTATTTCTT
CCTGATGATGAAATTCTCCTCACAGCTTCAAACCCCATGCCTATGCCAGACCCAGTGCAA
TTTTTATACCAAAGCCAGGGAAGTTTGCACAGTTTTGCCATGAAGATGTGGTAGCTTGCC
ACTGGAGTACTGAACATCCATTTACACGTGATGTTCACCACACCTGCATGCAGCCCCCTC
CTCAAAGTTTCTAGAATTTTCATGATCTTCTACCTTTCTGTTCGGTGGTTCTATATAAAA
GGACCAGGCAGAAGCAAGACTGAAATAAGGTTTTTCAGGGCACCTCGAATAAAACAAGAT
AGTCCCAGATTTAAAAATCTCCTTAAAGAGTCACGCCAGAGATTCTCCTATAAAAGGGGA
ATCTAACACCACGTGGAAGAAAAATAGAGAGGGAGGATCAGGGGAATTAATTCTTCGACA
AGGGGTTGATGCCATATGGAATGACATTTCTGTTTTGGTTTTGTTTGGGGACCACACCTG
GCGGTGCTCTGGCCTTCTTCCTGACTCTGCACTCAGATCGCTCCTGGCTAGGCTCTGGGG
ACCCTATGTGATGTCAGGGAATAGAACGGGGGTCATCTGCATGCCAAGCAAATGCCCTAC
CTATTGCAGCTCCGGCCTTAGCATGAAACTTATGACCTGCTTTGTGGTTACAGTCAGGTT
CATCCATCCGCGCACAACAGGCTATGGAATCCTGGCCCTTCCTAGTCTTCCTCATGAACC
TAGAGTGACTTCAGGATCACAGTTTCTCCCCACCTCTTGCCCGATCAATCCAGATCAATC
AAAGGGCCAAAATGCACCCCTTCTGGGGGAATCTTCCCAGACCAAAGGATATGAATGACA
CTGGCGTTCAGTCATTCTATACTGGCTCAACCCTGTGGAGGTTCAAAATGAAATCTCTTC
CTCTGTATGGCTTTATTAAAATCCACATCTCTGAGTCCTCACCAGAGCCAGTTTCCTTGG
CCCACCTCCCTCAGGACTCCTTGAACTCCCGTGATCTGTCATCTGAAATTTTAACAACCA
GCAAGCAGACCGTTGCCATGGTTATGTACTGCCCCCCCCCCCCCCTTTCCCAGGGGGGGG
GGGGGGGGACAATTTTTTTTTTTTTGACAACACACACACAAATTTTTTTTGTCTGCCCCG
CTGACACATGAAGACTGGGGAATTTGTTGCTGGGTTTAACTTTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTATTTTATTATTTATTATATCATCACACTGACTTGCCCACTTAA
CCATGATAGTTTGGTAGAGTGTGCTGGAAGAGGTTGGAGAGATACTGAATATCAAGAGAC
CGTGAGGTTCTTATTTTTAAATTTTATAAGGTATAAAATTCTTTATACTGGATAAAGGCA
TATGGTTATTTCAAATTGGTTGGAACTGTCGGGTATGTTGGGGTGGGGGTGTGTGGGGAG
GGAGTTGGTGTAGACGAAGAGTGAGAAAATTGCAAAACTCACTCTAAGACGTGTGGTTGA
GTGTGGAAGAGCTGTGATGTGACCAGTGAGTATTTCACCTGGAACTAAACCCAGAATGTT
GTATCTCTAAAGATTCCAAAGGTTTTCCTAAAAATATAACCAACAACAGGGGGAAAAAAA
GATACCCAGATTCCAAGGACCTGACGGTGGTGCTGAAGACCTATGACACCAGCTTCCTGG
ACTTCCTCAGAAGGTGTTTGGTGTGAGTTTGTTGGGGCGTCTTTGCCTGTGGTTTTCTTC
ATTAAATAGATACTTTCCCACTTGAAAAAAAAACACACTTGCTTATGAAAAAGCATGGGG
CTGGGAGACAGTTATAACAACAGCACTAAGAAACACTAACCATTGAGCTTGAGAGTCCAC
AAAAGGCTTTCCCTTCCTTCCATTGCTTCAGCAAACTGCTCCCTGTTGATAGACAGGGAA
ATAAATGACTTGTGCTGCTTTGCAAAAATGGTGCACTCCGTGTGAGGAGCTTTAATGACT
TGCCTGCGATGCCAGTGCTTGGAGGTGAACTTGCCACCTCCCTGGCCTCAAACTGCTTGA
CCATGAGGTTGGTTGGGCAAGTCTTCAATGCCTTCTGTCTCTGCACTGAAGCCAACTGCT
TCCCGGTGCCTGTTGAGACTGCTGTTGCGTGCTTTGCCACGTAAGATGGGGATAAGACCT
AACCTCCTCTGTCACTGTCACTGTCATCCCGTTGTTCATCGATTGGCTCGAGCAGGCACC
AGTAACATCTCCATTGTGAGTCTTGTTGTTACTGTTTTTGGCATATCCAATACGCCATGG
GTAGCTTGCCAGGCTCTGCCGTGTGGGCGGGATACTCTCGGTAGCTTGCTGGGCTCTCCG
AGAGGGGTGGAGGAATCGAACCCGGGTCGGCCACATGCAAGGCCAATGCCCTACCGCTGT
GGTATCGCTCCAGCCCCTAACCTCCTTTAGGCTTTAGAACCTAACTCCTCTTGTATTACG
GAATTGGGGGAAAGGGGGAATCTCAGAATCATTATGAACAGATTTTTGTGCTGATTTTGA
ATCTTAGAAACTAGGTTCTATACTTCCACCACGTCAGGAAAGGAGGAACAGCCACCGGGG
ACTGTCTCGATGTTTAGACCATGTTAGCTGGGATCAGGCTTTGAACAAAGGTGGTGTAAG
TCTGTGTTCCATGAGTGACAGATCGCTGATATTTGTGATATTTGGAAAGTCTTTGCTCCC
CCCTGTGACCCAGTTTTCTTTTCTATGAAAATGGGATACTCCTAAGACCCCTCTAGGATG
ATCAGTCCTATGGTTATTTGTGGATGGCTGTATCCGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCTCCTTAAGAGTCACGCCAGAGATTCTCCTATAAAGG
GGAATCTAACACCACGTGGAAGAAAAATAGAGAGGGAGGATCAGGGGAATTAATTCTTCG
ACAAGGGGTTGATGCCATATGGAATGACATTTCTGTTTTGGTTTTGTTTGGGGACCACAC
CTGGCGGTGCTCTGGCCTTCTTCCTGACTCTGCACTCAGATCGCTCCTGGCTAGGCTCTG
GGGACCCTATGTGATGTCAGGGAATAGAACGGGGGTCATCTGCATGCCAAGCAAATGCCC
TACCTATTGCAGCTCCGGCCTTAGCATGAAACTTATGACCTGCTTTGTGGTTACAGTCAG
GTTCATCCATCCGCGCACAACAGGCTATGGAATCCTGGCCCTTCCTAGTCTTCCTCATGA
ACCTAGAGTGACTTCAGGATCACAGTTTCTCCCCACCTCTTGCCCGATCAATCCAGATCA
ATCAAAGGGCCAAAATGCACCCCTTCTGGGGGAATCTTCCCAGACCAAAGGATATGAATG
ACACTGGCGTTCAGTCATTCTATACTGGCTCAACCCTGTGGAGGTTCAAAATGAAATCTC
TTCCTCTGTATGGCTTTATTAAAATCCACATCTCTGAGTCCTCACCAGAGCCAGTTTCCT
TGGCCCACCTCCCTCAGGACTCCTTGAACTCCCGTGATCTGTCATCTGAAATTTTAACAA
CCAGCAAGCAGACCGTTGCCATGGTTATGAACAATGATTGTCACCAATGATTATAATCAA
TGAAATCTGATTGTCTTAAGACCCCCCACTTTCCCTCACCTCCCTCTTCCACAGAAGCCC
CCGTGGAACATGAAGATCTGGGTGATTTGTTGCTGGGTTTAACTTTTGTGTGAAGCAAGG
GAATTTTGCTCCATAGAAACTATTATCCCCAAATACACTTTTTCAGTCATCACTTCTAAT
GCAATTTGGGGTTTTGAAGGATTGTGGAGAGAAGAGCTGGGAATTAGCTCTTTTGTCATT
GTGGGGAGAGTGACACTGTGTGTAGAGTCACAGTCTGCATCATAATCTGTTACTCTGAAC
TCAGTAGTGTATGACTGGAGAGTAAGAAAGAAGGGAATGTAAGAATGTATTTGGTACAAG
GGTCACAAGGACACATTTGTCGCCATGTCCCAGAATACCCTGTTGTTACCACCACCATGG
GCTGTAGAACACAGATGTGGTTTCAGAGACAATGATTTCATGTCTTGTCTTTCTGCATAA
AAAGGACTTAATTGGTAGTTGCATCCTTTAGTGGTTTCCAAAATTGGTCTGATTATAAAA
AAATCATGGGAGTACTCAGCAAAATCCCCACATAACCTAAGATACAGTAGGTCAGAAGTG
AGACTCAGAAACTTACACTTTTTATAGTATTTCCTTGTGATTTTTTTCTGATCCAGGAGA
GTTTGTGTGTATGTCTCTGATTACAAAAGCATTAGAAGCACTTCCTTTGGCTTCTTCTAG
AATGTCCTTTACATGGAACCCACTGAAGTTATCAAAATAATTCAGCTTAATATATAAATT
GTGTGTGTACACATCTGTCCATCTGCTGCAGAGTTTGAGGTATGGGTGTGTTTTCTAAAT
GTGCACACCAGAATTCTGATGTCTGAATGAGTGGTCTCACCCACCAGGAATTACATAAGA
GAGTCTTAGGGAACCCTTAAAGCTCTATTCTGAGCCACTCATGTACATCCATGGAAATGA
TTGAAGAAAGTCATTCTAAGTTGTGTCCTGAACAACCAATGATGATCATTTTAATGGTTA
AAAAAAAGTAAGGCTATTTATTTGCTTGAGTAGCTTAAAGAGGTGTTCTGAAAGTAAGTC
CTTCTCCCAAAATGACTATCTTGTTACATCCGAGGGGTAGGTACTTCCGTGTCTTACTTT
ATTAGTATCTGGAAAAGGAGAAGCAACCACAGATCTCCCGGGGCAATTATCTGTGCTTGC
TTTGACATTCTTTGTCAGAGCTGAGTGGTTTTGTCACTTTGGACTTATTTTTATTTATTT
TATTTATTATCATCACACTTGACTTTGCACCACTTAAACCATGATAGGTTTGGGTAGAGG
TGTGCTGGGAAGGAGGTTTGGAGGAGGATACTGAATATCAAGAAGAACCGTGAGGTTCTT
ATTTTTTAAATTTTTATAAGGTATAAAAATTCTTTATACTGGATAAAGGCATAGGGTTAT
TTCAAATTGGTTGGAACTGTCGGGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCAGTACCGTCTCCAGGG
TGAGACTTGCTGTTACTGTTTTTGGCATATCAAATACACCACAGGGAGCTTGCCAGGCTC
TGCCATGCGGGCGGGATACTCTCGGTAGCTTGCCGGGCTCTCTGAGAGGGATGGAGGAAT
CAAACCCGGGTGGGCCGCGTGGGAGACAAACGCCCTACCCACTGTGCTATCACTCCAGTC
CGGTTGTACCCGTATGGTCTTCATTTTCCTAGAAGTGTTTCTCACAATTTCTCTGACCTT
GACCTTCTTTTCCAACCTCGCTTCCATCCTGGAGCCCCCCTGTCCTACCAGCTGCCCCCT
AGTCTTGTGCGGTGGCCCTCCTGTTGACACAATTTTCACGTGTGACCCCCTTGAGTTGTC
CTGAGAGCCCACAGAGGGCCTTATGATCCCGAGTTGAGAAACGCTGTTCGAGTGGGTGGA
GCCCTTTTAGCAGAACACTTTTCTGGTATTTGCACATTGTGGCATTTAAAATACCAGCTT
AGAGGATAAGTCATTGTGTGCTCCTGAAAGTTTTCCCACCTTGAGAAGGCTGTGTCATGT
GACTCAACTGAAAAATGGGGCCGAGAAGAAAGAACCCGGGGCCCATCATTGCGTATACCC
CATCCCAAACTCTGGATGAAATTTTTTTGTTTGTTTGTTTTGCTTTTTGGGTCACACCCA
GCAATGCACAGGGGTTACTCCTGGCTTTGTACTCAGAAATCACCCCTGGCGGTGCTCGGG
GGACCATATGGGATGCTGGGAATTGAACGTGGGTCGGCCACATGCAAGGCGAATGCCCTA
CCCGCTGTGCTATCACTCTAGCCCCCTGGATGAAGTTTTAGAATGTGTATTAACCAACAC
CAGAAACTCACTTCTGAGGCCAAGGTGAATCGTCCAGAAATGCCAATCATCCAAAGCACA
ACACACAACCAAGTCTCTCTCTGGCCTCCTCCCTCATCCAGCTCCCCTCCTCACCTCTGC
AAAGAGTTGGTTGCTCACAGTTTTCCAGAGGCAGTGAAGTTGCAAAGTCCTATTAGCCCA
TCCGCTCAGATTTTTCTAATTTCGCTAATCAACTCGCTGCGCTGTCCCTTTCATCCCAAG
GCATCTCTTTTTTGATCTTAGTAAACGGAACTACATTCCACTGGTCACAGTTTTCTTTAT
TTCTCATATGGGACTTTCTAGGAGAGAATTGGGAAGACTTAAATGTTCATGTGTCCCCTG
GCTTGTCACATCCTTTTTCTAATTGTTTATAGTAGTTGTTTATAGGTAATTGAAGCGAGA
CACTATAAACTTTTTTTTTCAGCTTTTTGGGTCACACCCAGCGATGCTCAGGGGCTACTC
CTGACTTTGCACTCAGGAATCACTCCTGGCAGTGTTCAGGGGACCATGTGGGATGCTGGG
AATCAAACCCAGATCGGCCACGTGCAAAGCAAATGCCCTACCCGCTGTGCTATTGCTCCA
GCACCTTTTTAAAAATTTATTTTTATTTATTTTATTAATTTTTAATTTTTAAATTTTTTA
ACTATAAATTTTTATCGTCAGATGTAATCAGTGAGTGTGAAGTCTATATCTACATGTTCT
AGGCTAACTTTAGGCAGGACAGAGATGTGGCTCAACCATGCTCCGTTGGACAAAAATCCT
GGGAACTTCAGTTATTCTGGTTCCTTGACGAGTCTAAAGTGTTCATACCACATAAATGCA
GCTATGGGCTATTCCCAGGATGTCTGACACTAGTTACACAACAACAGAAATTATTTATCT
TGGAAGGTGCCAACCTTCTCAGGGGGTCAACAGTCAATGGAACTTTGTTGTCTCATTCTG
TATAGTACTAAAGGATAGAATTAGGGTGTGGGCTGAGTAGGATAAAAGTTCCAGGGTAAA
AATTCTCAGAAAGTGAATTTTGGATTACAAAAGTGAGCATGTTGGGGCTGGAGCATAGTA
CAGCGGTAGGGCGTTTGCCTTGCACGCGCCACAGGATCAATTCCCAGCATCCCANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTGGTCACGGTTTTCTTTATTTCTCGTATGGGACTTTCCAGGAGAGAA
TTGGGAAGACTTAAATGCTCATGTGTTCCCTGGCTTGTCACATCCTTTTTCTAATTGTTT
CTAGTAGTTGTTTCTAGGTGGTTGAAAATGGAAGAGTCCTTAATTTCTCTTCTATGATGA
TATATTTGATTTTTTTTTTAAAAAAACCATAGCTTCAATAGGATCTTTAAGAAAGAAGCA
AGTTAAGTGCTATATCTCAGTTTATAGTCTCTGTGGGACAAAAATTGTTTCATTTTATAT
AACAAGGGAAACAAAATAATAATCCATCCTGGGTTTTGTTGGTGTCTAGGTGGGAACCTT
CTCTTCGCATGACCCCTGACCAGGCCCTCAAGCATGCTTGGATCCATGAATCGCGCAGTA
TCAAACCCCGGAACAGGGTCCAGAACCTGAAGAAATCCAGTCTCTATCTCCCCTGTGAGA
CAAAGAAAGATAAGGTTCCAGGGCTTCGTCACCCTGGAAAAAAAGGTACAGAGACGCCAC
TACCCTGCTCTGCTTCCATAGTCTGTGAGCCAGACACCACTGGAGTATTTACACATTGAT
TTTTCCAAACTAGAAATCTCACTATCACTTTCTCTCTCTCTCTCTCTCTTTTTTTTTTGC
TTTTGGGGTCACACCCGGCAATGCTCAGGGGTTACTCCTGGCTCTGCACTCAGGAATTAC
TCCTGGCGGTGCTCGGGTGACCCTATGGGATGCTGGGAATTGAACCCGGGTCGGCCGCGT
GCAAGGCAAACGCCCTACCCACTGTGCTATTGCTCCAGCCCCCTATCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGCTGAATGGATTAA
ATGAACTAGTACATGTAATGTGTCCAGAGTATTACTTGCACATGGAAGGGAATTACTTTA
TATATTATTTTATTATATTATATTATATTATATTATTATTATTATAACCCAGGATTTCCC
TAAAGTAGTTTGTAGCCTCAAGGACAATGAAGACTAACTAGCATCTGAACACTCTTTTTC
CTGTGTCTTGGCATTCTTTTGGCAGAGGCGATCACAACAAAAGTTTTGGGCAAAATCAAA
GACGGAACATCTAAGCACATTCAGAATTCAGGTGATCCGCAGTGCTCTCTCCCACACACC
ACTGAAGTGGCCCCGCTGCCTCAACTCATTGAAACATCCATGAAGTCAGAGGCCACCAAG
TCTGATGAGTCTAGGACCTCCAAGGAAGCAAGTAAAAACTCAACACCCAAGATCAAGAAC
ATCTTGCCACCTATTGTATGACCTTTGATAAGGGTGGGCGCCCTATTCCTATCCACCCAC
AGTGATTTATACCGGAGACAGCACTTATATTGTACTATACACCAGATTGTTGTTTTTTAA
TGCATAAAGCTCTGTTTAAAAAAAGCAGCAACTCGATTCAAATGGCCAGCTGGCATGATT
CCTCTTATAGGAGGAATGGAGTATAGGTCCTTACACCTACACTTTCTCCTGATGCCACCC
TCTCCCCTGACAAACCAGATAAAATACCGGAGGTGCGTGTGACATAGGGGGTGTAAGAGC
ATCACTAGTAGAACGATGAATAAAACATTTTTTTCTTACCCAACAAATAGCTGTGGTTAT
GTTATTCAGGATTCTTGATTGGAAATGACCGAAGTCAAATGTAAACTCATGATGAGCACC
AAGCATATGGGGTTATGCCATCTGGGAGAATTGGTGCAGTAAGTGTAGTTTCACACAGAA
CAAGAGCTAGTCACTCACTGTCACTGTCATCCCGTTGCTAATCGATTTGCTCAATCGGGC
ACCAATAACATCTTTCATTGTGAGACTTATTGTTACTGGTTTTTTTTTTTTTTGGCATAT
CCAATATGCCACGGGTAGCTTGCCAGGCTCTGCCGTGCGGGCGCGATACTCTGTGCTGGG
CTCTCTGAGAGGGGCGGAGGAATCGAACACAGGTCGGCCACATGAAAGGCGAACGCCCTA
CCGCTGTGCTATTACTCCAGCCCTAACAAGATCTAGTAAAAATTAAAAAAAAATATATGT
CCCTGGAACTCAGAATCCCTCTCTCCCACCTCCTAGCTTCACATCTTTGCATGATTATTC
AACTTGGATGCTGGAAATGAAGATGACCATTATAGCATTCGGTCAACAAATAGCTTTTCC
TCGCCTGCAGGCAAGTCTCAGAAATAACTGAACTTGAACCCATCACTGTGTCCGAGATAC
TGGGTGGTATTCTCTGATTGATCAGCCCGCCCCGCCTTTGATGATGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1118, 4187..4350, 8544..8680, 8781..8921, 9022..9160, 9880..9961, 10602..10774, 10908..10942, 10944..10969, 16032..16161, 27949..28124, 29602..29840
1001..1118, 4187..4350, 8544..8680, 8781..8921, 9022..9160, 9880..9961, 10602..10774, 10908..10942, 10944..10969, 16032..16161, 27949..28124, 29602..29837
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved