Sorex_araneus Locus ENSSARG00000000161
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000000161
Sorex_araneus
ENSSARG00000000161
GeneScaffold_1714
SNORD14, SNORD14, SNORD14
2110..2196, 2518..2603, 3585..3669
4948
TTTCTTGTCTTGGGAGTCGCCCAGGCAATGCTTTAGGGAACCTCCAGGCCTCTCCTGGC
AATGCTCAGGCCGACTTGATAAACGTTTCCATGAGAAGAAACAAAGCGTGTTGCTTCCTA
GACCCCTGTATTGTTGATGCCCACAAGTCCTCCTTCTGGAAGTACCTTGGGGTCTGAGGG
GCTTGTGACCCGTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGGCAGACCTAAGGTCC
AGGTAGAATACAAGGGAGAAACCAAGAGCTTCTATCCAGAAGAGGTGTCCTCCATGGTTC
TGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGGTAAGGGATGCAGTTTTGC
AGAGTTAGCCACAGGGGCCTGAACGGGGATTGGTGCAGAGCCCTTACCTAATGCATAAGG
CACAGTAGGTGAAGTCCTGTAACTGAGAACTATTTTTTTTTTATTCCAGACTGTCACCAA
TGCTGTTGTTACAGTTCCTGCTTACTTCAATGACTCTCAACGTCAGGCTACCAAAGATGC
TGGAACCATTGCTGGTCTCAATGTACTTCGGATCATCAATGAGCCAACTGCTGCTGCTAT
TGCCTATGGCTTGGGACAAGAAGGTAGGTTCTCTCAATACAGAACTAGATCCAGGGTGGG
CCGTTCAAAATGGAGGAGACATTTAAACTTACACTTGTATTCTAATGCAGGTTGGTGCAG
AAAGGAACGTGCTAATCTTTGACCTGGGAGGTGGCACTTTTGATGTGTCAATCCTCACTA
TTGAAGATGGAATCTTTGAGGTCAAATCAACAGCTGGAGATACCCACTTAGGCGGAGAAG
ATTTTGACAACCGAATGGTCAACCATTTTATCGCAGAATTCAAGAGAAAGCATAAGAAGG
ACATCAGTGAGAACAAGCGGGCTGTCCGTCGTCTGCGCACTGCTTGTGAGCGTGCGAAGC
GTACCCTCTCTTCCAGCACCCAGGCCAGTATTGAGATTGATTCCCTGTATGAAGGCATCG
ACTTCTATACCTCCATTACCCGGGCTCGGTTTGAAGAGTTGAATGCTGATCTGTTCCGAG
GCACTCTGGACCCAGTAGAGAAGGCCCTTCGCGATGCCAAGTTGGACAAATCCCAGATCC
ACGATATTGTCCTGGTGGGTGGCTCTACCCGTATTCCCAAGATTCAGAAACTTCTTCAGG
ATTTCTTCAATGGAAAAGAACTCAACAAGAGCATCAACCCTGATGAGGCTGTAGCATATG
GTGCAGGTAACTTTGGGAACACTTCATACTAATAGGCAACTCCTTAGGGGGGTGTACAGA
TTTATTTTTTTCGCTGTGATGAATGATTATTAAACATTCGTAGTTTCCACCAAAAGTTTA
GCTAATGATGGCCTAACTTCCTTGGATGTCTGAGCGAGAGATGACTTGAAAGAACATTCC
AATTTATCTTTACTATTTTTTAAAAACTGCTTTTTTCTTTTTCAGCTGTGCAGGCAGCCA
TCCTTTCTGGAGACAAGTCTGAAAATGTTCAGGATCTGCTTCTGTTGGATGTCACTCCTC
TCTCCCTTGGCATTGAAACTGCTGGTGGTGTGATGACCGTCCTCATCAAGCGCAATACCA
CCATTCCTACCAAGCAGACACAGACCTTCACCACCTACTCCGACAACCAGCCTGGTGTGC
TCATTCAGGTACGCGCTCTACGTCCAGTCAAGTTTAGATTTTTTTATAAGGCATGATCTC
GCTGTGATGACTGATTCCACAACCATTCGTAGTTTCCACCAGAAATCTTTGTGTTGGCAA
CTCCTTCCTTGGATGTCTGAGCGACCAGTTCTGATGGGGTTGGCTCAATGTGGCACAAAG
ACCTTTCTAATAGTAATTTATTTCTTACCAAGGTTTATGAAGGTGAGCGTGCTATGACCA
AGGATAACAACCTGCTTGGCAAGTTTGGACTCACAGGCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGAGCTG
TGTTAACAAATGATTAAGATTGTCCTTAATTGGAAGGCTATTGTAGGACTGTAAGTCATA
GTATTTATTACTTACCTGCCTGAAAGATGTGTTTGTCTGCACACAGGCCGGTTGAGCAAG
GAGGACATTGAGCGTATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAACAG
CGAGACAAGGTGTCTTCCAAGAATTCCCTTGAATCCTATGCCTTCAACATGAAGGCAACT
GTTGAAGATGAAAAACTTCAAGGCAAGATTAATGATGACGACAAACAGAAGATTCTTGAC
AAGTGTAATGAAATCATCAACTGGCTTGATAAGAACCAGGTTTGTTCCTTCCTTATAAAT
TTTGAATCTTCAAGTAGCTTAGTAAAATTCACAAGGACACTAGAGTCACAGTGATGAATG
GTCCAAAACATTCGCGGTTTCCACCAGAATTCCAGGTGTTGGCAACTACCTTCCTTGGAT
GTCTGAGTGACTCAGTATATATAAACTTGGCTAGCTTTACTTTAATGATACACCTGCTCT
TGGTTACCATGGAAATTAAATACAAATTTGCTTTTTTTTCCAGACTGCTGAGAAGGAAGA
GTTCGAACATCAGCAGAAAGAGCTGGAGAAAGTCTGCAACCCCATCATCACCAAGCTGTA
CCAGAGTGCAGGTGGCATGCCAGGAGGAATGCCCGGTGGCTTCCCTGGTGGTGGTGCTCC
TCCCTCTGGTGGTGCCTCCTCTGGGCCAACCATTGAAGAGGTTGATTAATCCAGCCTGAG
CATATATATGCATATATATATAGCATTGTTCCACACAACATTGAAGGACCCAAATTTGTA
GCAAATTCCACGCAATTAAGTTGTTATAGTAATAAGTAACCGGGCATTCTTGATACTTGA
ATACGGAACATGTGCACAGGGAAAACAAACATTGCACTTTATAAGCGTTGTATCATGAGT
GGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCACACCACACGTTTCTGGACT
TGATTAAGGGGCAGTAGGTGGGTGAGATTCTCCAGTACTCAGTAGTAGGACAGCTGCTGG
TTCATCCCTTTAGATGCAGCTAGGTGTGTAGTCTAGTCCTAGCAACTTGGCATTCCCAGT
ATTCAGAACTGTTGTGAATGGGGTAATAAAGTAGCTTGGAAACTGAAATGATTAGAAAGT
TAAGTTTTCAACAAAATAATCAACATGAGTAATAGAAAAATCTATACAAAGGCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCAACAA
AATTTCTTAATTTGGAGACAAAGCAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1120, 1249..1393, 1395..1402, 1490..2045, 2265..2467, 2672..2737, 2888..3020, 3286..3518, 3763..3948
1001..1120, 1249..1393, 1395..1402, 1490..2045, 2265..2467, 2672..2737, 2888..3020, 3286..3518, 3763..3945
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved