Sorex_araneus Locus ENSSARG00000006697
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000006697
Sorex_araneus
ENSSARG00000006697
GeneScaffold_7366
SNORD48, SNORD52
1390..1451, 1958..2024
3237
GGATCGCTCCTGGCAGGACAATGTATGGTGCCAGTGATCGAACCTGGTTGGCATGTGCT
AGGCAACGTCCTACCCGCTGTACAATCACTCTGGCCCCTAAAGCTGATTTTTAAAAATCC
TCGTACAGGCCGCAGCTGACTTGGGTTCGATCTCTGGCACCCCGTATGGTTCCCCGTCTG
CCAGGAGTGATACCTGGGCACAGAACCAGGACTAAATACTGTGCCCAGCCAGTGTGACCC
CATAACAAAAATATAAAACATTGCCAAATTATATATTTAAAACATATTATTTGTTGCATG
TCAATTATACCTCAATAAAACTATTTAAAAGGCTGGGGGCGGGGCGAGACAGCTCAAAGG
ACTGAGAGCACGCTTTGGGAGCAAGTTTTGGGAGCAGGAAGCTAGGAACTAGGCACTCCA
GGTTCCCTAAGCACTACGGGCAGCGTTACCAAGGGGTAAGCCCCTGAGCCCCGCGAAACC
GAAAAAGAAAAAAAAAAAAGGCATGATGCATAATATGCTTGACGCGTATGCGGGCTGGAG
TGGGATAGTGGATTCAGATTTTGACGAAGTACAGTCCTAACTATTCCTTTCTGTGACCCC
AAAGACGCCAAACTAGTCCCGGAAGACGCGACAGAAGCGCAGTGGTTGCTAAAGGGCTCT
AGAGGGCGCACGCGTGGAAGTTGCTAAGAAGAGCCCTTTGCGCGACCTCTGGCCAGCGGC
GGGGTCTTTCTTCTGGTCTGACTAATCAAGTTACCTGTTTTTCAGTTTTTTAAAAATAAA
TTACAAGACACACCCGAACATTCGTATGATCTAAGAGTATGAGAAATTCGTTTATGACCT
ATATTTCACTTTGTTGTTTTCTTGTTTAGCCCAACAAAGGGGGCAATGCTGCGGGACGAG
ACAGGCATAGAAAAAGACAGCTATGCGCGTCAGGACCCCCGACCCCAGACCGCCATAAAT
AGCCCTCACCGCGCCATTGGCGTTCTCTTTGTGCAGAAAGCATGGCGGTTACGGTGGCTT
TTCCTAGGCTGCGGGCAACCCGCACACGGGGGGACGACCGCGACGTCCCGGGAGCTCTAC
GTTTCCCTTCCTTGACTGTTGGTTGTCAGGTAGTTTGGGTCCCTGCCGTGTGGAGGGCAC
TTTAGTCTTGGGCCGAGCAGGATGAACTACCTTTACAGACTAGAGTTTCTGATGTCTCCG
TGACGCCGCTCTTTGAACTGACCCGGCCCGGGGCAGAGGGGGGACTCAGCTAGCGTCACC
CCGACCTCTACTGACTCAGTGATTTTTCTTCCCAGGTCCCAGATCCGTGCCCGTGGACCG
CGGCGCCACGGAGGCAAGTACAGTGCGGAATCGGGTGGCTGGTGGTCGCCTCGGGGACGG
ATGGGGGGGTGGTGATGATGACCCAGGTGACTCTGAGTGTCTCGCTGACGCCATCACCGC
AGCGCGCTGACCACCCCCAGCCGTTTGGGATGCTGGTACCTGGGGCGTGGGAAAAAGAGC
TAGCGTTCTTAAATTTACTTATTTGTGATTTCCCTATAGGTATTCATGGGGCCCTCCTGG
TTGTGACTGAGTACAGGTGAGTGTTGTTACAGGTGAACGCTGCGGAGCCTACGCCAACGA
ACGCGTGCGCCAGCGCACCCTTTGCTTGATTTTTCCAGCTTCTTTTACCTTTTTAAAACT
ACGGTGAAAGCCTGGCTAAATCTGCTTCTCCCTTGCCCCCTTTGTTAACACCCGGGACCC
TGAACCGTTTGTGTTCCATACACCCGGGTCTTATACAGGGGAGCACTTTTTCTACCTAAC
CATTCTTGGGTCAGCTCTGCTGTGTGCTGGGTGCCCTCGCGGAGCCCTTCTATGGTTCTA
CATTTATCCACTCCACCTATTCCTGAACTTTCTTTGAAACTGTTGGATGCACTGTCAGTT
TCCAGGATGTCTGCCCTTGATCCAGATTTCTCTAAATTGGGAATGATGATTTCACAGACT
AGAGTCTCTGACACTAGGCCTGATGTCAAATTTACATTCTGACTCATTTGAGGAACTGGA
TGCTTGGTCTCTGAGGGGAGTCGGCAGAAACTTGGTCTGCGGGTCCTTCGTGACTGTCTT
GCTTTCATCTTTTTAGCATGAAAGCTTTGGCTTGGAGGGCTAGCCAGGGATGCGTCCCTT
CAGATCAGTACTAACCTGGTGGCGGCGGTTTGGGACCTGCTCTCTGAGAAATGCCTTGGA
GGTTGCTGCGAATCCTAGGTCACAGTTCGTGAGTTCACCAGCTGCTTCTGGCAAGTGAAG
AGGACTCCCTGACTACAATGGTGAGTGTCTACCAAATTTTTTATTTTTTAAATTGGGGAA
TGTTTTTGGGCCAGAATGTTCAGCAGGCATCTGTCTTGACCAGGGTTGATTGATCATTAG
TCCCCAAGAACACGGGAAAAATTAGGGTTGTGCACTTTTTTGTTCGGGTTTTGGACCACA
CCCAGTGATGCTCAAGGGTTTCTCCTGGCTCTTCCCCAGGAATNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 1077..1091, 1095..1106, 1109..1127, 1129..1199, 1210..1212, 1216..1233, 1236..1277, 2117..2124, 2132..2177, 2180..2185, 2188..2221, 2224..2237
1001..1075, 1077..1091, 1095..1106, 1109..1127, 1129..1199, 1210..1212, 1216..1233, 1236..1277, 2117..2124, 2132..2177, 2180..2185, 2188..2221, 2224..2234
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved