Sorex_araneus Locus ENSSARG00000010880
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000010880
Sorex_araneus
ENSSARG00000010880
GeneScaffold_6870
SNORA65
10688..10816
12411
TCCTGGCTGCTCGTCTTGCTCTGCCTCGGTTTCCTCCCCTGTGCAAATGCTATACCCAC
ACCCGAGCATATAGGACTTAGAGATTCACTGGGGCACGGGGCTCAGCACATGGCAGTCAT
ATAGCACCGCACGCCTGGCAGCCGTCATTCAGGGGTCTGACAGCATCAGGTGGGTGACAC
AGACACTCGCTGCTGGGGACGGCGCGGGATCGCAGGTCTGCCCCTGCCGAGCTGTGGGTC
TGCAGCGGCGGCTGGCTCAGACCCCTCTAGTCATCCCACGTGCTGGAGGCAGGGACGGGG
ACAGGTCGCCCAGCCCTCCCTGCACCAGCTTGTGCTCTGCCAGGCTCCCCGCCCAAGGAT
CACCCTCCTTCACGCCTCAGACCGGCACATCCACCCGGGAGGGGGAGGGGAGCCACACCC
ATCCTCCCGGCCGGGAGGGGCCGCACCTGCTTTGTGGACGGGCAGCTGGACCCGCGGGCC
GGCCGCTCACCGGGGCTCGGTCATGGACGCCGGTGGCCGAGCCCGAGGCGGGTCTCCTCC
GAACGCCGGCGCCGGGCAGCCCAGGATGCCCGGGAAGCGCAGAGCCTTGGATTCGAGCTG
GGCTGGGTCCCGGCGGGAACTGTTTGAGAACTGAGCCGCTCCAGCGGGCGGGCGGGACAC
CTGCTCCCGGAGGGGCTGCGGACCCCGCAGGGGCGGGGCGGGCGCCGGGACGGGGCGCCG
GGGCGCACGGGGGACCCTCACGGTGAGGAGACTAGGAGGCAGGGCGGGAGCTTGGGAGCA
GCCCTGTCGGCTCGGCTTTCTCGGGCCGGCTGCCCCGACCCCCGCTCCCGACCCCTCAAG
GCACCGCTCACCAAGCCGGGTAGTGCAGCCTTCAGCCGCTGCAGCCTGCCAACAAGAAAC
ATGGCGGCAAGGGCGTCACTGGCAGGCTGGGGGCGGAGCCAGCCGCTCTCGCGAGACCCG
TGTCTTCCCGCCTATATCCGGCGCGGCAGGCCGCTCTTCCGGTCTTTCGGTTCGGAGGTG
GGCAAGGTGCAACTTTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAACCGCCTC
CGCCATGCCGCCGAAATTCGACCCTAACGAAGTCAAAGTCGGTGCGTGCTCTGGCAGTGG
CGGGCCCGCGGGATGGAGCGTCCCCGCAGCCCGGCGGCAGTCGCGGGGACTGCGTGGCGC
GCGGAGCCTTCGCCTCCGGGAGGCCTTCCGGGCCTGCGCGCGGGCGCCCGCGGCCCCGGC
TGAGAGTCTTACTACACTTTTTGGCCTCCGCTTTCCTCCCTGCGTGTAAATGGGGAGGGA
GGACCGGACCAGCCGGGGCGGCCTTGCCGCGGCTCTCTAGGGTAAGGCTTGTCCCCGGGC
TCTCATCCCCGCCCGGGCTGGGCCTGCGACCCCCCGGCTTCTGCCCCACCCGGCCGTCGG
AGGCCACATTTCGTGGAGCATCTGCTTCGGCTTGCTCTTATATGTCCGCTGTGCTTAGGG
CTACTCTGAGCTCAAGATTGAAGTTACACTGTCTGGTGCTCAGCTGACTCAAGCTGGCTT
GTGTGGAACTGAGATTTCATGCATCTAAGGCCTATGACCTGTATTCTATTCTCTGACTAC
TCTGAGCTTTAATCCTGATAACGAACTTAGCACTGAAAGTTATAGTTGTGAAAAGAAAGA
AAATGAATCCACAGGTTCTGGGTGACTTGGCCAAAACCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCAGGCACCTTTGGAGGGTGCCAGCGAGGAAGAGGATCCTGGTT
AAGGTGAGAGACCAGGCACAGGCCACAACTCCCACACTTGAGCCTGGAGTTGATTCTTCA
GGATGTGACTCGCATACAAAACTTTCAATCTGAGAAGCAGTTTGTAAAACTTAGGGAGAG
GGAAAAGAGCTTCCTGAAGCAGGGAGCTGCACTCCTTTCACCCACATTTGTACTCAAACT
CATGGTGAGTGTGAGCCCATCAAACTTCAGTGCCAGGAGCGGCTGACCTCCCTGCAGAGG
GAATACCCCTCCTTCCGGCCCCCCAGCCCCTGCCAAGCACTGGCATCACAAGCTACTTGG
TTGGGCCCATAATTCTCAGGGTAGTTTTGAACAGTCTGCTCACCAGGTTGAAATAAGGGA
TGGTGTATGGGCTGGAGCAACAGCACAGCGGGCAGGGCATTTGCCTTGCACAGGCCAACC
TGGGTTTGATTCCTCCACCCAGCAAGCTCCACTATGGGGTATGGTGTCACCAGGTTAACC
TGTACCTGCGGGGCCAGTGCATCAGCCTAATGGTGCCTTTGGGCATCCTCATACACTGAA
ATTGCCGCTGTGCCTTTGTACAGACCTCAACAACTTGGGACCAAATTTACCAAGAAATTA
GCCAAAAGTTAGGTATGTGGGAGCCACGCCCACAAACCACCTCTGGATCAAGACCTCTAG
ACAAGCTCATTACTTCAGAGACCCATAAATCTTGAAAGACCAAAAACTGCAATTAATCTC
GGACCTGCACATGGAACAGACCGGGATAAATTGGAAGAGGCAGGTCAGCCTGGAGCCTGC
CCAAGCACAGCCCCCGACAACTGCTTGCTCCCAAAATCCAAAATCTTTATAATTTAGGAC
TGACTCCACTATCTCAGTATGGGCCTCACTGGGACAATCTGCTGAAAATTCTGGTATGCA
AGTTTTGTGACGGAAATCTCCAGGCTGGGATACTGCCCTCCACCTCCCTGTACTTTCTGA
AAGCTTTGGCAGTCACATCCACACCCCAAAGCTGCCACCCAATTAAAAAGTTACTCCAGC
CTTAGAGTCCTGTTAAAAACACTAAATGTCATGACCTCTTAGCACCTCTATGGCAAACCA
TAATGCACAAAAGGAAAAGGGGAGAGAGAACAAGAAGGAAAGTTCCTCCCATAGAGGGAG
GCTGGGGGGAGGGGCTGTTGGGGGATGGTGGGAGGGGAAGGGGACATTGGTGTGGGAAAT
GTACACTGGTGGAGGGATGGTTGCTGCAACATTGTATGACTGAAACCCAGTTATGAACAG
CTTTGTAATGGTCTATTTCATGGATATTCAATTAAATTTGAAAACAGTAATGTGGAGCTC
ATTCCCAATTCAATCAGCTTAATCAAGGACTGAATAAATAGCAATACAACTACATCTAAA
TAAGTAAACAAACGGCTCCTCTAGACCTAAGGTGTGCTGGGCAGGATGGTCTGGGGAAGG
GAAGGGAAGCGGCCCTGAAAGGAGTAAGTCTCAGCACTGCCGGGGGTGGCCCGAAAGCCA
GATGAGCTAATGACTGAGTCACTGAAGAATCCAACACTGGCTCCTGTGTGAACACCTGGG
AGGGGGTTGCTGACGGATTTGCACGCACACCTGGGCTTGCTCCCCAGCACCACTAAACAT
AACCTGAGCGTGGGCCCCCGCCAAGACAAAACAAATATGCAAATGTAAATAACATGTAAA
CACCCGAAGGGAAACACCCCACACATCACTATGAAATCTGACGCCCATCATGAAACACGT
TCAAACAGTACAATTAAGAGGGAGCTTTCTCGGTTTGGAAAAACGCATCTACAAACGGCC
TGACTACAGGGTGCCTAGGCAAGGCCAGCCGGCCTCGGACACCAGACCCACGGGTGACAC
GCACGGGGAAGGGGCGGGAGAAGGGCCGAGGGTCCGCGGGCCCCGGGCGGGGGGCGGGGC
CGCCCCTGATCAGGGCCCGGCAGGCGGGGGCGCGCGTCTTCCCCGGGGTCAGCTGCGGGC
AAGGCCACCGCCTCGGCCGGTCCCACCCACCCTGGTCGTTCTGCGTAACTCCGTGTCTTC
ATTTTGTTTAGCAGGAGCAGATTGAAAGGATGATTTCGTGACAATGTTTTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAAAT
TCTACTGGCTCGGCTTGGGTCAAAGAACGTTCAGATCACTGAGCTGATAGGGGGCCCCAG
GCCTTTCCGGTCAGGACTTACCAGTGAAGACACACAGTAGGAAGTCTCGGGGCAGGAGGC
TCCTTGCTCTTCATCACCGTCCTGGATCAACACCCTGAGGGCTGGAGGGAAGGGGCAGGG
GTGGGGTACTTGCACCTGGCCAACCTGTTTGATCCCTGTCACTACAGATGATCCCCAAGT
ACCGCCAGGAGTGACCTGTGGACACAGAGCCAGAATAGCTCGAGCATAGCTGGGTGCGGC
CCCCCAGTAAACAATTAAAAAACATACTCCCGATGTTTTGTTGTTATTTTCTGTACATGT
GATGTATGTTCTTTGTATGTTCCTCGGTTGTGCGTGCTCACTGATCTTCATGAATGAGTT
TCCTAGAAAAAACACTAGATAAATGTAAGCCCTTATGCTGCTCTCTCTCCTGGGAATAAA
ACCAGATCTTTTACTCTCTTTGAAGTCACCTGAAGTTCTTCTCCAGCCCGTGCTGGGGGC
ACACTTCCCACCACCAGCCGTTTCACTGCCAGGAAAGCGCCTCTCCTCTACACAGTTGTC
TCTGCTTTTTCTAGAACACGTGTGTGTGTGTGGGCGGGGGGGGGGGGAACAGGACCCCCA
CCTCATGGTCCCCCAGCACCTCCACTGAGCCTTGAGCAGAGCCAGAACAACAGTAACACC
ATAGCCAAACAAGTGGCCCTTACCCATAATAGCGAAAATAGAACTGACCCCAAGGTCCAA
ACAAGCAAGTGTCGCCGGCTGCGCTGGGTGACTGTGACTGAAGCCACTAGGCTGAGTGGA
AGAAGCTTCACAGGAAAAGGAGAACTGAGAAAAGGCGCCAGAGTGGGAACAGAGCCCCTA
ACGCCGCAGTGACTGTGGGGACAGTACCCCCAACACCGCGGTCACCACGAGGACGGCACC
CCCACCGCTGTGGTGACTGTGGGCACAGACACCTTGCACTGTGGCGACTGGGGCCGCAGA
GCGGGGAGAGCGCTGCCGGGGGCGGAGCGGGCCCCTGGAGGGACACCAGAGTCCTGTCTC
CGGGCGGTGGACCTGACGCAGGTTCCTGCATGTAGCTAATGCCAGAGTAAAGCTGACCTT
TTAATGGTGAAACTTTGTAGAAGAGGCACCAAATGGGGTGAATTCCATCCAAAAGAAACA
TCATGAGGGGCTGGAGCAACAGTGCGGTGGGTCGAGTGTTTGCCTTGCATGCGGCTGACC
CAGGTTCCATCCCCAAGAGGGTTCGGGGGACCAGGCGGTGCCAAGGATCACACCTGGGCC
CACCATGTGCAAGACAGTGTCCAGTGCCGTCTCTCCGACCCGACAGAACCTACTTGTAAG
GAGGTGAATTCTGGCAGGACACGATGACAGGCTGGAGGGTGCAGCAGGAAGGTGTTGGAC
GGTCAGCAGGTGGCCGCCTGAGCACTGAGCATCACCCGGTGTGCCTCGCGCCAAAGAAAG
ACTCAACTGTGACCCACCACTTTCGTGCTTCTCCAAATACCGGGACTGATGTCTAAAGTG
CGACTGGCCTGTGCCCAGCAGGCAATTAACCACCATGGAAAATGATTATTTTAGGGGCCA
GAGCAGGGAGGGTGTTTGATTGCATGTAGCAGACCCGGGTTTGATCCTTGGCGTTTCATA
TGGTCCCCGGAGGCAGAGCCAAGAGTGAGCCCTGAACACAGAGCCAGGAGTAATCCCTGA
GTACCACTGGGTATATGGCCCAAGAAGAAAAAAAAATGCTATTTTAAATGAATCTGGGCT
TTATCCTACAATAAACATGTATTAACTATATTAGATGAAAAAAGTAATTGGATGGGGGCT
GGAGCAATAGCACAGCGGGGAGGGCGTTTGCCTTGCACACGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGGGGGGCACAGGGCTCTGC
CGACGCTTCGTTCACTGGCCCCGGCCATCTTCGCTGGAGCGTTGGATGCTTGCAGACCAC
CCCAGCCATCCGCCACTGCGCCTGCCACTGCTCTGTTGGCTGGTGCATTCCAGTGGTGAG
CTGAGACTAAACCCCAGCTTAGGAAACAGGGTTGTTCTCCATGTGGATGACTCTGTGCCG
AGAGCATGGGAACAGCCTGAGCCGGGCAGCCTGGGGTCTGTGCTGGTCGTGATGGGTTGG
ACAAACCGCTGTTTCCTTTCCCAGTTAAGCACAGTGGCAACATCACTTTTGATGAGATCG
TCAACATTGCCCGCCAGATGAGACACCGGTCGTTAGCCCGAGAGCTCTCCGGTAAGAGCC
CTGCAGGGCCCCACTCACTGATGGGGGGGGTACGCTAATCTCCCCACGTAGGGAGCTCAC
GGGATGAGCCATAATTGGGCACAGCCTGTGTTTGACCCTGGGCTGAGATGAGATGGGGAA
CACTGGACTCGCCCGGTCTGCGTTAGAGACCAAAGGAGACTTTGCGTAGAGTATTCATAA
GGAAATGGGTTGGGGGCTGGGAAGCAACACAGGGTGGGTTTGTTAGAGTTTGGTGGTCTT
TGGATTTCCTTCCTTCCTTGCCTGGGCCATCTAGAGAGATGGACAGTGCCCAGCATGTGC
TTCTTCGTTACAGGCACCATTAAGGAGATTCTGGGCACGGCCCAGTCTGTGGGCTGCAAC
GTTGATGGCCGCCACCCTCATGACATCATTGATGACATCAACAGTGGCGTGGTGGAGTGC
CCCGCGGTAAGTGGGGCGCTGCTTCTGTTGGGTGGGAAGCCTGCTTTTCCTGCAAGGGCT
AGGAGTGGCTGGTGGAGGGGTGGTCTTTGCTCTTACTGACGAGGGTTAGGTCTCTGTTTT
CCTGAGTAAGAGCTACTAAAAGTGCTTTCAATTAAAGTTTTCTAACGATGAGGGAATCAT
TGCTATGTGATTTCTTTGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1006..1120, 10041..10114, 10215..10313, 10414..10495, 10884..10970, 11293..11411
1001..1003, 1006..1120, 10041..10114, 10215..10313, 10414..10495, 10884..10970, 11293..11411
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved