Sorex_araneus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Sorex_araneus GNB2L1
Sorex_araneus
GNB2L1
GeneScaffold_3936
SNORD95, SNORD96
1250..1316, 2720..2798
6765
CCCGAGTGCAGAACCCGGAGCAAGCCGTGGGCATCGCCCGGTGCGCCCCCCTCCGCCCA
CCAAGACGAAGACTGGGCCTTCTCTCACTCCTGGAAGGGAGACGGCCACAGGCGGGTTGT
GCCCTGCCCCGCCGTCAGCCCCTCAGCACGCGGGCCCCATCTCTCCTCTGCACCCTTCAC
CCCTGTGGGGACCTGAGTACCCCGCAGTCCGGGCGCTCTACACTGTCTGCGCCACTCGGC
TCCTCCTGACAGACGACGGCGGGGCTCTGCCGCCCGCCCCCGCCGCGCCGACTCTCGGCC
CCGCGGGCCAATCCGCGCCGCGCGACCCCCCACCCCTGCTCCCTGCAGCCCGGCCAGAGC
CTCCCGACTCCAACGCACCGGCCACACCACGTGACCGGCCGGACTGGCCGGTGTCGTGCG
CAAAAAATAAATGTTGGAGTTTGAGAGCTGACCTCAGCGCAGTTTTATTTAAAAAAATTT
AATGATCGCATTCCCCCGGTGGCCCGCGACCACTCACAGTTGCGACCTCCCAGCGCAGGC
CCGCGATCCACGTCACCCCGGCCACCGAATGGAAGAGGCGGAGCCCGCACGGTTCACGTA
AGGAGAATCCTCCGGGACTCGGGGGTGCCCGTCACTTCCCGTCTTCCGCTCCAATCAGCG
TCCAAGGTGTTTTTTTTTTTTTAATCCCATTAGTTTCCGTAAATCTGTGCGCTAGTTTCC
GTACGTCTGTGCGGTGCTGCTGAATTTTATCTCAAGACGTAGTTTCCGTACGTCTGTGCG
GTGCTGCTGAATTTTATCTCAACGGGGGCCGCCATCTTCGGGCGGAAGTGAGTTAGGGAG
CCGCCATCTTGCTCGAGCACACGGCTATTTCCGGTTCCGGCGCGGGCCCGTTCGCTCTTT
TCCTCCGCGGAGCCGCAGCGGGAGCGGCTGCTGGGCCTGTTCCTCGAGGACGATCTAGTG
CCATCCTCGTCGCTCCGGCGACTCCCGCACCCGGCGTCACCATGACTGAGCAGATGACCC
TTCGCGGCACCCTCAAGGGCCATAATGGCTGGGTAACTCAGATCGCTACCACCCCGCAGT
TTCCCGACATGATTCTGTCAGCTTCGCGAGGTACGGGCCGGGCGGCGGCGGGGGTGGCGG
CGCGGAGGGCTCGGCCGCGTCACCGGGGCCGTGCGGGCTGCGAGGTGTGCTGCCGCGTGA
GCCCGCGGAGCCGGGCGGGCAGGTCCGCGCCCTGGAGCACGAGGCCGGCGGCGCCGTGAT
GAGCCCAACATGCCATCTGAGCGCCCGTGCAGAGACCCAGAGGCTGTTTCTGAGCCGCCG
CCGGCTCGGCTCCAGGGACGGGAGGGTCGGGGCCCTGCACGCGGCCCTGCTCCTGTCCCG
GCACCCGGGCTGCTGCGGGGAGCTGGGACCCAGGTCGTACCCGCGTAAAGAGAGGGAAGG
AGAATCGGCCAGACTTGGGTCGACTGGCTTCGATTCCCGGCATCCCATAGGGCCACCGAG
TGCAGAGCCAGGAGAAACCCCTGCGCATCGCCGGTTGTGAAACAAAAAGCAAAAACAAAA
AAATGGGGCGGCTCGACGAGGTTGGGAAACAGGCTTCTGCGGCAGGAACTCAGGCTCCGG
CGCGCGTGGCGGTCTCAGCGACCCAAGGGCCTTGCGCGCTCACCGAGACTCTGTTTCTGA
TGAAGAGTTGAGGAAGCACTCGAGTTGGTGAAAAATGGGTTTGAATTGCTGCCAGGAGAA
CCCCCGAGTCGCTGGTCAAGTGCTGCATACAAGTTTATTTCGATCCAGTTTCCGGGCTTG
GACCACACCCGGCAGTGCTCAGGGGTCACTCCTGACGGCTTGAGACGTGCAGTATCAGGG
ATCTGGCTTGGCATGCCTCCCCTGCTGGATCGTCTACACTGCCAGCTCCTCCTTTTCCTG
GGAGCTTTTTGCTCTCCCATTTAGCTCTGTGTAGGGGGTGGGGAGACACACTCAACCACG
TCAGGTGTAACTCTGTTCTGCTCAGAAAATACTCCGTGGGCACTGGGATCAAACTGGGGT
GCACTGTCTGCAGGGCAAATGCTCTCTCCACTGGACTATTGCTCGGTCCCTCACATAAGG
CTTTAACGACCTCTGCAAACAGTAGTGACTTATGTCTTGGCTAGTTGCTTGTTTAGCCTG
TGTTGACTGTTAGGCCACTTTTTGCTTTTTGAGTCTCACCCAGTGATGCTTAGGAATTAC
TCCTGGCAGTGCGGGATCAAACCGCCATCAGCCTCGTGAAAGGCGAAGTGCCCTCCCCGC
TGTGCTATTGCTCCAGCCCCTGTTTGGCTTCTTGTGTCCCAGCCTTGAATGGGTGGCCGT
GTGCAGAGCTCTCAACAGGTGTTCTTCTCTCTTCTCTTAGATAAGACCATTATCATGTGG
AAGTTGACCCGGGATGAGACTAACTACGGCATCCCCCAGCGGGCCCTGCGGGGCCACTCA
CACTTTGTGAGCGATGTGGTCATCTCCTCCGACGGCCAGTTCGCCCTTTCAGGCTCCTGG
GACGGAACCCTGCGTCTCTGGGATCTCACAACGCAAGTAGCTGCTCTTTCAGCTCTGGGG
CCCGGGGTAGGGGGTGGAGCTTGTTTTGAATTTCTGTGGAATTGCTGAGAAAGTCTGGAG
GAACAGCTGTGGAGACTAATCAATCAGGTGTCCTGATTGTTTGCCAGGAGGTGGTCTGTG
CTTGAGGGTCAGCGAGTGAGGATCCTGGTGATGATCAGTGACATGATCAGCCAATCCCCA
TGTGGGAATGAGGACATGTCCTGCAATTCTGAAGGGATTCTCAGCTAGGCTATGGCCTTG
ATTGGATGGGTTCTGTCTATCCCCAGGGTCACACACAGTCCCCCATGCCCTGCCATGCAT
GATGCCTGGCCACAGTCAGGAGTGAGTCCCTAATATCTCTGAAAGAGTATTTGCAAAGAT
CTGTCTGGAGAGGGGGGCTGGAGTGATAGCACGGTGGGTAGGGCGTTTGCCTTGCACGTG
GTCGACCCGGGTTTGATTCCCAGCGTCCCATATGGTCCCCTGAGCACCGCCAGGAGTGAT
TCCTGAGTGCAGAGCCAGGTGTGACCCAAAAAGCAAAAAATATATATATATATATCTGTC
TGGAGAGGCTGGAGACATAGCTGGCACACGGCTGACCTGGGTTCAGTACCCATGGGGTCC
CCTAGCCTTACCAGGAGTGCATCCAAATATGCAAATCTTAAAAAATAAAATGGGGCCAGG
GAGCTAGCTAGTACCATCATTGCATACAGCATGCCTGAGCATCCTGGGAATTTAAAACTG
AAAAATCAGGAACCTACTTGGAGAGAGTGACCGAGTCCTTCCTCGTAGGGGCACCACCAC
ACGGCGATTCGTGGGCCACACCAAGGACGTGCTGAGCGTGGCCTTTTCTTCTGACAACCG
GCAGATTGTGTCTGGCTCCCGAGATAAGACCATCAAGCTCTGGAATACTCTGGGGGTTTG
CAAGTACACTGTGCAGGTGAGGCTGCACTTGGGACAAGGGCCTCTCTCTCTTTATCCCCA
TTGGCTGACGTGGTGCTTAAAAGCCTCATCTGGAACCCAGGGCTCTGGTGTTCTCAGAGG
TTTGGGTTCTTTTGTCAAGGCCTTTGACATCACTCCTGAGTCCTGTGGGAGGTAGGGACC
TATCGCTCTTGGGCCAAGGGGGCACCCACACTTTTCTCTGTTCTTTAGGACGAAAGCCAC
TCGGAGTGGGTGTCCTGCGTCCGCTTCTCACCCAACAGCAGCAACCCCATCATCGTCTCC
TGTGGCTGGGACAAGCTGGTCAAGGTGAGCTTGGGGCCAGAACAGGCCGTGAGCCCTCCC
ACAGCCCTCCCGGGCAGACAGGCTGCAATTTGGACAAACGTTTTCCTCGGTGCCCTTTTT
TCTCTTATTTTCTCAACAAGTTTGAGGCTTTGGTTTTTGTTACGTTTTGTTTTCCCCAAC
TGACAGTGCTCAGGGGTTACTTCTGGCGTGGTGCTCAGTGACTATTCCTGACGGACTTGG
GGGACCCTACAAGATGCCAAGGATCAAACCTGGGTTAGCCATATGCACAGCAATGTCCTC
GCTGTACTCTCTAGCCCCCAGTATGTTTGGTCTAAAGTAGCCAGACTGGGGCGGGAGCAA
ACAGCAGGTCATTCTTGCTCCACCCCAGAGGTCAGCCTGGTGGTTTCTGGGACAAACCTA
CACACCAAGAAGCTCTCTAGACCCAGCTTTTCCCCCTTTTAAAAAAAAAAATTGTAATTG
TCCTCTGGTCACCCGCAGAATCTTCGACTTTTTGTTACAGAATTGGAAAATGGTGGCTAT
CACCAGAACTGCTCTTGCCCATTTTGTTTTTGCCCCACACCCAGCTGTGCTCAGGGTTTC
TGGCTTGGTGCTTGGGAAACCCTATGAGGTGCTGGGTATCAAACCCAGGTCAGCTGCATG
CCAGGCAAAGCCTTAGCTGCTGTCCTGTGAAGAAAATAAACAAGGCCCCTTTCATTTTTG
TGCGGAGTCCTGAGCCTGTCAGGTCCCAATCCAGTGTCTTTATTTAAGATCCTCCCCCTT
TCCCTCTGCCCAAATCCAGGTGTGGAACTTGGCGAACTGCAAGCTGAAGACCAATCACAT
TGGCCATACGGGCTACCTGAACACAGTCACTGTCTCTCCCGACGGCTCCCTCTGTGCCTC
TGGGGGCAAGGTGAAGTGTGGGAAGCGGCCAGGCTCTGGGCAGTGCTGGGGAGGTTCCGT
CCTGTAAAGAAAGATCCCCAGAAATAACCCTGATGCTTCGGAGGAGTTCAGTCATATGTG
ACAGGCCTAGGGGTGAGTGGATTGTCACATGGCAGAGGTTCTGCAGTCTGACTTGAGTTT
TCACTGTTTACAGGATGGCCAGGCAATGCTGTGGGACCTCAATGAGGGCAAGCACCTGTA
CACACTGGATGGGGGTGACATCATCAACGCCCTGTGCTTCAGCCCCAATCGCTACTGGCT
CTGTGCCGCCACTGGCCCCAGCATCAAGATCTGGGTGAGTTTGGCCACCTTGGGCGGAAC
CAGGCTGGCTGCTGCTGGCCCAGGGCTCTATCATCTCTACCTCTCCTGCACTGGGCTCTA
GGAGAGTGCTAAAAGTTCTCCAAGTAGGGAAGGTGGTGGCTGCAAGCCTTGTCCCTTGGA
TTGGGTCACAGCAGTTTGGCCACAGTAGGATTGACATCTGGGTTTGAACAGTTCTTTGAT
GAGGGTGGTTCTGTGTATTCTCAAATGCTTCCGACTTCCCCAGCTACTGCTACCTGTTAA
GACTCTAGGACTTAAGTCTCCTGCCTTGGCAAGATGGCTGAGACCCCTCTTTCCCCCGTA
CTACCCATGTCTTGACATTCAATATGGCATTGCTGCCATCCCCTCTCCCCCCTCCACACA
CTCACACACACATCCCTTTTTTGTCCCTAGGACCTGGAGGGCAAGATCATCGTGGATGAG
CTGAAGCAGGAAGTGATCAGCACCAGCAGCAAGGCTGAACCACCCCAGTGCACATCCCTG
GCCTGGTCTGCTGATGGCCAGGTAAGGGCTTACCTCCTTCCCCTGGTCTATTTTTGTAGT
GATGCCATGGGTTGCTGCCATTTCCCAGAGAAGTGTTTGGGGTGGGAGGGGCACTGCGTC
GTTCAGCTCTCTTATCGCGTGGCCCCCATGGCTCTGACAATGCCCTTTTCTTCTCCCCAG
ACACTGTTCGCTGGCTACACAGACAACCTGGTACGAGTGTGGCAGGTGACCATTGGCACC
CGCTAGACCTCAGCGGAGAGTTAAAAATAAAGCCCTGACTTTTCTGACTAAGTGGTTTTT
CTGTCACTGTTGCTGGAGGGTTAAAGATTTTTAGCCACTCTTAAATAGCTGTAGCAGGAG
GAAAAGGGCAAGCCTTCCCAGGTGGTGGGCCTCTCCCTTGTGGCATGGGTTCAAGCAGAT
AGAAAGTCTGCTAATTGGTTCATCACAGTGCTGTTTGCTGGTCAAGCACAAAGAATCAGA
CACCACATCCTACAAAAGTCCTAGGTAACTGGGGGCTGGAGCGATAGCACGGTGGGTAGG
GCGTTTGCCTTGCACGCGGCCAACCTGGGTTCAATCCCTGGCATCCCATATGGTCTCCCA
AGCACTGCCAGGAGTAACCCCTGTGCACAGCTGGGTGTGACCCAAAAAAAAGTCTTAGGT
AACTCGGCAATCTGAAGTGATGGTGTTAAATGATGTTAAACAGGCAATATATTAAAATGG
TTCCCAGAATGTAGCCTTGTGTTGGATGTGGCTCACACAAGGATTCAAGCATGAGCACCT
AAGGTGACAGAGACTACCCAGCCAGCTCCCCCGCCTAAAGGAATGGACTCAGGAAAGAAG
CAAATAAATCTTTATTTCCACAACACAACCCATCTTCCCTTTTTCCTCAAACATAAAACT
GGGCCTTGCTGCCAAAGCTCGCAGGTGACAGAAAGGCAAGGGGTTTCCTAGAAAAATAGA
TTATACCCAAGGTTCTCCCCGGGTCCCAAGCTCCAGTCAGGGGTAAAGCAGATAAGAGGA
CTAGGGACCTGCAGAGAGGTGGCACAAGGGAAGGAGCCTGGCAGAGGCCTGGGGCAGGCA
TGAGCTTAGCTCTTAGGAGTACTGGAAAAGAGGAGGGGGAGAAAATAACTTATTGGGCGA
TGACACAGGGTATAGTTTCAATCGTGCTGACCCTTCCAGATCTCTCCCGGAAACCAAGTC
CTGGCCGGTCTATGGAGGTAGAAATTGGGGGATGGAAGGCAAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 2380..2551, 3348..3495, 3708..3803, 4579..4689, 4873..5013, 5430..5540, 5700..5765
1001..1109, 2380..2551, 3348..3495, 3708..3803, 4579..4689, 4873..5013, 5430..5540, 5700..5762
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved