Sorex_araneus Locus UMPS
snOPY snoRNA Orthological Gene Database
Sorex_araneus UMPS
Sorex_araneus
UMPS
GeneScaffold_4687
SNORA26
6356..6477
11462
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTTAGTTTAGGGACCATGTCTGGCTGTGCTTGGTGGCTCTTCCTGG
CTCTGTGTTGAGGATCAGTGCTGGTGATTGAATAGGGTGAGCAGTGTGCAGAGCAGGCAC
CTTATCACTGCCTTCCATCCATCTCCAGCACCAAACCTTTGATTTAGTCTGGCCTTGCCT
TGTGGTGGAGTGGATGGGGCTCCAGCCCCTTAATCTTGTGTGTTGAATTCTTTTGCTGGT
GTCAGAATTGCTGCTGTGAGCATGCCCCGCTGTTCACCACACTGCTTTTGAAGGGTATAA
GCATAGAATCAAATTAAAGTTTCTCAAGTATCAGTATGTATATATTGCCTTAAAATAAAA
TTCTGTGGAGACAATGAGATGAAAGATCAGTTCAAAGTTCTTTTTTCCAATTTTCGTAGT
CTGCACTAATTGTCCAACTCCTGGAGGGGCTCGGAGAGCATATGGGGTGCCATCTAGTGC
GAGACAAATGCCTTACTTGCTGTACTATTTGACTCCCATTCTTGTGTTTTTATATTGATT
GTGGTAAGTAGGATTTATAATTGGCAAAAAAGCAGGGTTACTGCTCTTTAGTGTTATGTT
ACATGATTTTACACCCTTTTAAAAATGTTCATTTCTTGCAGGTGGCACAGATTTTATTTC
AAACTGCCCAAAATGCAGGGATCAATTTTGACACTGTGTGTGGAGTACCTTATACAGCTT
TACCTCTGGCTACAGTGATTTGTTCAACCAACCAAATTCCAATGCTTATTAGAAGAAAAG
AAACGAAGGATTATGGTAAAGTAAAAGTAATATAAGAATTGGATGATCTATAGCTTGATA
TTATTAGAATTTTCCTTGTTCAACACTGATCGTTTACCTCGAATGTTCTTCAAAGATCCT
TTAAATTATGCCCTGTAAAACTTGTTAGATCGCTTTAAATCCTCACTTTTTGCTCTTTGG
GTCATAACTGCCAATGCACAAGGCTTACTCCTGGCTCATGCACTCAGGAATAACTCCTGG
TAGTGCTTGGGGGACCACATGGGATGCTAATCCAGGTTGTCCGCATGCAAGGCAGTGCCC
TACCCTGGATTATTCTATTGCTCCGGCCCCAAATCCTCACTTCTTAAACTATGGGCCTCA
CATGGGATTGCATAGCTTAATGTGGGGGTCCTGAAAAATTTAGATGATGGGTATTGTATG
AGTTCACTGGTTATACTGGGTTATTCTTTTTTTATACGTTTCCTTGATTTTTGTGATCTT
GATAAAGAATCACTAGGTTTGAAATTTTGATCATAAACACATTAATATAATTTACACTGC
AAAATAATTTTCTAGTGTTACTATAAATACTGTGTGTTTATCATATGGAGTACAGGTATA
CAACATGGTCATCAGGGCATGTTGATGAGTCATTCAAAACAAAGTAACTCCAAATTAGGT
AATCAGAACCTAAAATTTAGGATATCCACCTCTTTATCAATACAAAACAGCTTTACACTG
CAGGATGTATCTTGAATAGACTGAAATAAATACCTAATTTTGAATAGAATCCAATAGAGT
GTATTCTTTTGTAGGTACTAAGCGTCTTGTAGAAGGGGACTGTAAATCCAGGAGAAACCT
GCTTGGTCATTGAAGATGTTGTTACCAGTGGATCTAGTGTTTTGGAAACTGTTGAGGTGC
TTAAGAAGGAGGGCTTAAAGGTGACTGATGCTATCGTGCTCCTGGACAGGGAGCAAGGAG
GCAAGGACAAGTTGGAGGCGCAGGGTATCCATCTCCACTCAGTGTGTACATTGTCCAAAA
TGCTGGAGATTCTTGAGCAACAGAAAAAAATTGATACTGACATGGTTGAGAGAGTGAAGA
GATTTATTCAGGAGAATGTTTTTGTGACAGCTGATTGTAATGGTTTGCTCCCTTCAATAA
AGAAAGCCCCCAAAGAACTCAACTTTGGAGCACGAGCAGAGCTGCCCAGCATCCATCCAA
TGGCGTCGAAGCTGCTCAGGATTATGGAGAAGAAGGAGACCAATCTCTGCCTGTCTGCTG
ATATCTCAGAGTCCAGGGAGCTGTTGCATCTAGCAGATGCTCTTGGGCCCAGCATCTGCA
TGCTCAAGACTCACGTAGATATTTTGAATGATTTCACTCTCGATGTGATGGAGAAGTTAA
CAACTCTGGCACAGCGCCATGAGTTCTTAATATTTGAAGACCGAAAATTTGCAGATATAG
GAAACACAGTGAAAAAGCAGTATGAAGGTAAGTATTTAGGAATCTGCGTGAAGTGGAAAT
CCAACTGAAGGGGAAAGAAGAAATCTGTTGACTCACATCAGCTGAACATGGGTGTGCTGC
AGACATGGTTGGATCCTGTGATGTCTTTGGACTTCCTTTCTCTTCATATCAACTCTGCTT
TTCCTTCTTTTGACTTCTTAGGTATGCCCACTTCATGGTATCTGAACTAATTGCTCACGC
CTGGGTGAACCTGTCATTGTTTACCTTTATCAGTTACCCAGCCTTAGTAGGACAAAGTTA
TTAACTTGGCCTTCTTGATTAAAATTGGGGCAGGAGTAGAAGGAGTGTGGGTGCCAAAAG
ACGAATGTTTCTAGGGCCAGAATGGGTAGGGCACTTGCCTTGCACACAGCTGATCGGGAT
TTGATCCCTGACATTTCATATGGTCCCCTGAGCCTCCCAGGACTGATTCCTGAACATGGG
GCTGGGAGTAAGCCCTGAGCACTGCCCCTGTGTCCCAAATGCCCTTTCCACCACACCCCC
CTCAAAAAAGAAGACAAGTGTCCCTTGGGTAGACACAATGACAGTTGTTGGCCCTAGCAA
ATTCAGTTGCATTCTAGTTACTTTGAAGATAAAAAATACAGTGAGGAGCATTGAAAGCAT
ACAAGTTCTAAGTTGTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
CTGATTCCTGAACATGGGGCTGGGAAGTAAGCCCTGAGCACTGCCCCCTGTGTCCCCAAA
TGCCCTTTCCACCACACCCCCTCAAAAAAGAAGACACGTGTCCCTGGGTAGACACAATGA
CAGTTGTTGGCCCCTAGCAAATTCAGTGGATTCTAGTTACTTTGAAGAATAAAAAATACA
GGTGAAGGAAGCAATGAAAAGCATACAAGTTCTAAGTTTGTTTCCCACAGGAAAAAAATG
TGTTACATGTCTTTTGTTGAGTCAGGACTCAGGATGTAAATCTACCCTGTTCCTTTGGGT
TTTTGCTTTTGGTCCACACCTGTTACTGCACAGGGCTTACTCCTGGTGGGTGCAGGAGAC
CGTATGAGGGGCTGGGGATTGAACCTGGGTCGACCGCATTCATGGAAAGCACCCTACCTG
TTGTACTATCTTCCTGGCACAGTCTTCCCTGTTCTATCCATATTTCTCATAAACCTGAAG
GTTTGTTCATTTAATTTTGTTAGGCCTTTTATCTATGCTTACCATAGATCTCTTTTAAAC
TAACTTAATTTTCCCTTGATATGAGTTTAGGTATTTCTTCAAGTTATTGCTCTTTTGCAG
GGTGAGAGAATACCCAAGAAGTCTTGGTTGTCCGTCAAACTGAAGAGCTTTTATAGAGGG
CAAGGGTCTCGGCTCAACCAAGAGTCCCAAACCTAATTTTTATGCATATGGCAAAATTTT
TATACATAATATCCTGCTTGGCAACATTAATCAGCTTTTTTCTAGCTAAGCAAACAAGAA
AGCAAGCGTAATTGTAGTACAAAAGCCACATGTTTACTGTTAGCCTTGAATGGTTAAAAC
TTTTGTACTTGGAAGCCAAAAAGAGCAGTGTGCGATAGCTACTTTGTCTAAACAGGTTAT
TCCCCAGGCATTCTCGCCCTGAGTTCTCATGTCTCATTCTGCTTCTCAGTTATCAGCAGC
CTCTTACTTTTCTGCTAACTTTGTGTCATATCATCACATTAGCTTTTAAAATGTCATTTG
CTCTTGAAGCTCGTGTTCTCCCTTAATATGTACTTCGTCTTTCTCTCCCCTCAGAAAAAA
CTATCGTGCTTCACCAGTAAAATAAAATGAATACAATTGCAGGTTGGAAATGGAATAGCT
AGAGGAAACTAGGGAATGAGTAGATCTAATAGTAAAATACTGAGATCCTTAGAGAGTAAA
AATTTGTCATCTCAAGAAGAATTTATAAAATGAAGAATCTCCCTTTCCTGTACCTTTTTT
TTTTTTTGGTCTGGATCTGACATAGATTCTGGGAAAGTGGGTATCAATTATATCTTTGTG
TTCTGCTTTTGACAGTTTTATTTGGTTTCAAGAAAAAAGTTCAGAGTTTATTAATAGCAC
GTGTTCCTTCTTTATTACATGGAAGAGACCTAGCTAAGCTGAGTAAATCCAGTATGGCTC
CAGGAGCCTTGTTAAGTAATTTTTGCTAAAGCAGAGAGAGATATTGGAGAGAAGAAAGAA
ATCAAGGAAAAATACAATAAGCAATGTTCAGATTTAAGTTCAGATAAGTTCTGCTTTTGG
TATTAAAAAGTAAGGTTAGATTTTATAGGGAGAAATTTATGTGTAAGTATCATTTGCAAA
GGCCTTTTCACCCAGTCTTAATAGCTCTTTCTATTTTGCCAAATACTTTTTCAGGGTGAA
CGATATTTACCCCATTAAACTTAGGTTCTAAGTTTAAACTTCAATTTCTTTGATGTATCT
CTGTTGGCCAATTACATATTTATTATTATTATTATTATTATTGAATCACTGAGATACAGT
TACAAAGCTTTCATGTTTGAGTTTTAATCATTTAATGATCAAATACCTGTCCACAAATAC
CTCCACCAGTGCACATTTTCTACCACCAGTGTCCTCAGTATTCTTCCCTCCCCCTGCTTC
TATGGCAGTTCTGTGCCTTTTTGGGGTTGACTGACATTTAGACATCAAGTCCATTTATGA
TTGCCTAAGTTTTATTGGTTACAGCTTTGACCTGCAAAACCAGGTTTGGTGGTGTGGTCT
GAGTGATAGAGAACTTGTAAGAATATTTTTATATTTTGAACGTTCAACTAGAAATTTTTC
AGGTGGTACCAAATAGATCGGCCAATAATATTTTTCAGATGGAACCAAATAGGTCAATTG
ATAATCACAAAAATTTTTTAAGTAGTACTAGTGCATGAGTATGTGCATGAATATGTTAGA
GTATTTGTATGAAATAGTTGGTTGACTGGGTGGAGCGAGATAGCACAGTGGGTAAGGCAT
TTGCCTTGCACGCAGCCAACCTGGGTTCGATTCCTCCACCACTCTTGGAGAACCCAGCAA
GCTACCCGTGGCGTATTCAGTATACCCAAAACAGTAACAAGTCTCACAGTGGAGATGTTA
CTGGTGCCCGCTCCAGCAAATCGATGAACAGTGCCAGTTGGTTGGCTAGCCAGAAATTAA
CGGTTTTGTTTGGAAATCAATAGGTATCTTTTCCCCCCTTCTTAGGTGGTGTCTTTAAAA
TAGCTTCCTGGGCAGATCTCGTAAATGCTCATGTGGTCCCAGGCTCAGGAGTTGTGAAAG
GTCTGGAAGAAGTAGGCCTGCCCTTGCACCGGGGGTGTCTGCTCATTGCGGAAATGAGCT
CGGCAGGCTCCTTGGCCACAGGGGACTACACAAAAGCGGCGGTAAGTGACAAACCCAGAG
CTGTGATGCCACATGTTACAGAGAAAGGGACATCTTGAATTCAGGAACCTGGACTTTGTG
CTTTTGCTGCACTCCCACCGCTGTTGTCAGCGTGATTGTATGGTAATACAGTTGACTAGC
ATTCCTTGATCATAGCATTTTGTATGGCTGTTGGTGGGCATGTAAGGGTTTGATGTATAC
AAACCCTAAAGAGAACACGGGCGCGGGTCTGCTGTCAGGCATTTCCTGTGCTTCTCTGCT
CCTTCACGTAGTTGTCTTTTTAGCACACCCTAGTTGAAGTGCTCTTGCCCTTTCTTTTGC
TCTTTTAAGGCTGATGCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTGAATCTCCA
TAAAACCCAGGGAGGAGATTGTAAAACTTCTCTCTGGATCCTGTCTGGAGCCACATCTTC
CTCCCCAAAGGGAAAAGTAATTGAAGAGCTCCTTGCTGTATTGAAGATAGTTTCTCCCAG
TCCCACCGAAATACACTCTCAAGGCAGTCATCCATGAAGAGGCTTTATCTTTGTCTTAGG
GCTATTGCTTGGTACTGTATGTGGAAGTAGTAACTGGAGTTCAGACACTTGGTTTCCTCC
CTTATGTTTCACGTTACTTAGAAGTCTTTGTAATACCATACTTGTTAACGCTCACTCTAC
CCTTACGTTCCAGAATAAAATGATCTACTTAAAAAATAATAAAATCCTCTTTCCGTGAGT
CAGAGGTAGTACAGAGGTTAAGACCCTTTCCTTGTCCTTGGCATTGACAGTGGTTCGAAT
ACAGGCACAGTATAAATTTCTATCAGTTGTGGCTCCTGAGCACTACCAACTGTGCTTCCC
CCCCTCAGAAAAAAAGGTCTCTTGTCTCTGAGTTTTCTAATTGTAGTCTTATAGGTTTTT
TGGTTTTTTTAATGCCATGGAAACTAATATTTGCATATTGTGAAGGCTCCACAGAATTTG
AAGAACACATAGCTCCAGCATCAGCTTTCAACCCATCCTTAAGATAGATACCTCTGGTTT
TTCTACTCAGAAGCAGCAAGTCCATGAGTCAGTGTTAATATTTGACATTTTGGGAATCTA
GGTCTGGCTAAAGGACTTCTTTATAGGTGCTCATGTTTTATATGGCACAAATAGAGTGTG
CCAACCCTTGGGGAATACCAAATTTAAAAATCATAAAGCTTCTCGGGGAAGCTTGTGTGA
ATGTGAGGTGATATATCATAGTTGTGGGGATCAGTTAGTGCCATGTGTAAAGGAGAGAGT
AGTGGAGTTGAGATGTCTCTCCCATTATTTAATACCCTGTGTCGAGAGGCAGAAAGTCTT
GAATATGGATTCATAGTATTTTAATATATTAGAGTACTTGCCTCGAGTCCGTTTTTACTT
ATTTTTTTTTCAGGCGTGCAATGTTCCAATACCAACCCTACTTGCAGCATCAGCTTCCAC
CTTCAAAACATTTTTTTAAGGAGTTAGATATTACAGGTCACTGCCTGCATGGAAAATGCC
TTACCCACTGGATTATTTCTGGCTCCTGTGTTCAGCATTTTGATTTTAGATGCACAAAGT
ATAGAACTCATCATTTCTTGGAATGTGGATAAAGAAAAAAGGCATTATCTTAGGTCTTAA
TGGAGCAAGTCGAGATTCTTAAAGAGTTCTTGTTTTAGATGAGTATATAGTACCTATATG
AAGGGGAAGAAAGGGGATGTTTGTAGAATAGCAATTTTTGAAATTAATAGTTGACTTTTC
TGTTTCTGAAGAACTACCGTTCTGTGTGATTCTTGAAATTTAGGTCAGTATGGCTGAGGA
TCACCCTGAATTTGTGATTGGCTTCATTTCTGGCTCCCGAGTAAGCATGAAACCCGAATT
TCTTCACTTGACTCCAGGAGTTCAGTTAGATGCAGGAGGTAAGTCTCTACAATTACTATG
GTCTTGACAAAATGTATCTGTATATATGGGCCAGGAGTATTCTTCCTGAGTACAAAGCCA
GGAGTAACCCCTGTGCATCACTGGGTGTGACCCAAAAAGGAAAAAAAAAAGCCCAAGAGC
TTCAGCTGGGAAATGCTGAAATAGGCAGGAAACTCAGGCCCTGAGGCAGCTTCTAGAACC
TGAATCATGTGACAGGACCATTTTGAACGGAGCCATTACACAGCGGGTAGGGCGTAGGGC
GTTTGCCTTGCACGCAGCTGACCCGGATTCGATTCCTCTGTCCTGCTCAAGCTACTGAGA
GTATCTCGCCTGCACGGCAAAGCCTGGCAGGCTACCCGTGGTGTATTCAATATGCCAAAA
ACAGTAACAATAAGTCTCTTGATGGAGACGTTACTGGTGCCTGCTTGAGCAAATCGATGA
GCAACGGAATGACAGTGATACAGTGATATCTGGGTCAGAAAGAGCAAATAAAACATTGCG
TATTTGAGTTTAGGATAATTCCTAGATAAATGCTTATCCTTATCCATTTAGCAGGTTCTA
AATGGATCCTGCTTTTCCTCAGCTACCATGGATGTGGGGACTTGTATTTCAACCCTTCCT
TATAAATAAGATATATTTCTGCCTCTTAAAAAAGAGTCTAACAAAAAGTTGCTTGAGTGG
GTAGGACCTTGCAGTGTTGGTCAGCTTGGTTTCCATTCCCAGCATCCTTTATGGTCCCCC
AAGCACCACCATATGTAACCCAAAAACCGGAGGGGAAAAAAATATTTCTTTTGAGAGAGT
GTAAGTTGTTCAGGGGCCAAGGATTGGAGCATGTGCAGGGCCCCTGAGTTTGCTCCCAGC
ACCACATCTTCCCTGCATACACACACCCCCTACCTCCAGCACCTCAACACCACCCAGAGA
GTGTGACCTTAGGCACTGGAGGGAACTCGGCCGATTCGAGTTCGATTCCCAGCATCCCAT
ATGGTCCCCTGAGCACTGCCAGGAGTGGTTCCTGAGTGCAAAGCCAGGAGTAACCCCTGT
GCATCGCCAGGTGTGACCCAAAAAGATAAATGAATAAATAAATAAATAAATAAATAGATA
GATAGATAAATAAATACATTCTGCATTGAAGTGGGTAAAGGACCAAATGTGATGGACTGA
CAGTAGCTGTATTGCGAATTATAATGCTACGAAGCAGAAAGAGTAAGAGGAAAGGTGCCT
GCCATAGACACAGGCAGGGGGTGGGAGTAGTAGGAGGGATACTGGGGACATTAGCAGTGG
GAAATGCACACTGGTGGCAGGATGGGTATTGGAATATTGTATGACTGAAACCTGATCAGG
AAAGCTTTGTAACTGTAACGGTGATTGAATTAAAAAAAAAAAACACAACAAAAACACAAC
AGTAAGGCATGAACCCTTTGACCTGGTGATACTGACTAGACATGCAAACTAACTTGTAAT
CTATTTTAGGATATTAATTGAGAAAGTCAGCTGTAAAGATAGTACCAATGCCCAGGGTAA
GGCATTTGCCTTGCATTTCAGATCTCACAGTATGGCTTATAATCCCTGGTATACCACCAG
GCGTGATCTCTGAGTATGGACAGGTATAGCTCAAACTACCCAAAAAAATTAAAAATCATA
TCAGTTGGTCTCCATCCATTATGCCGAATCCCAAGCTACCAATCTGTTTCAGATTTAATT
TAATAATATGTGCCTAAATAGCTTTCCACTGATGAAGCATACACCAGAGTAGTGTAGGTG
TCTCATGACTGCCTGTCAGACTTGGTCATCCAGCTATAGCCAGCTTTCTCTTGATGGCCT
TCCCCAGTAACCTGAAAGCTTCCTTCAGAAATGAGACTGCATTATTTGTATTTGTATGTG
GCACTAGATTTACTTTGTCTTTCTATACTGTTTATAGGTAATGTTCTCAATTAGACTCTG
ACAAGAGGGGGTTAGCATATACTTCTCCCTGGTAGCAGTCTCTGATGTCTTTCTCCTGCT
TCTTCTCAACTTGATATATAAAAGCAAGTACATGTACTTTTTCAGAAAAGTCATGAGATA
GTTTGATTTTTGCATTCTCAGTTATTTTCTCTTTACTTTTTCTTGACTTTTCTTTCCTTC
TCATTTTGGTCTTGGACCACACCCAACAGTGCTCAGGGCTTACTCCCGGCTACGCACTCA
CTCAGGAATCACTCCTGGTGGTGCTCAGGGGGCCACATAGGATGCCAGGTATCAAACCCA
GATCCACTGCGTGCAAGGCGAGTGTCTTACACTATCCCTCCCAACTACTGTACAGTTATT
TTTATCTTTTCCTTTCTTTTTTCTTTTTTGCAGGAGATAATCTTGGCCAACAGTACAATA
GCCCACAAGAAGTTATTGGCAAACGAGGTTCTGATATCATCATTGTTGGCCGGGGCATAA
CAACAGCTGCTAACCATCTGGAAGCAGCAGAGATGTACAGGAAAGCCGCTTGGAATGCTT
ATCTCAGTAGACTTGGTGAATGAGTGTCTAAGATACTTTCCTGAAGGCTTGAAGATACTT
GGGCTTATGCAGTGCACTGGTTTGAAATAACGCAGACTTCACAATGCTTGGATTCTTCCA
CTGGTCTTGTCTTGGAAGGTATCTGAAGCTACTGTGATTTTAGGAAGTGATAGACGACTT
ATAAATCGCTGCCTTGTTACTCATTCCAAGCATTTATTATATTCAGGCTGGTGTTGATTA
TCCAGTCAAGCCTGTCAGCATTAGGGCCTTGCACAGAGAGGCCCTTTCAGCTCCAGCTTC
TAATTACCAGAGAGCAAAACCAGTCGTGTGTCCTTTATTCTGTATCTTAATAAGCCCAAA
TAACACTTAAATATTAGCTGCTCCTCTCTCTTTTGAGATTTTTATGTGAAAAACAAATGG
TCTGACTCAACTTTCTACAAAAGAATTTCCAGTAAAGTGATTCTCCTTACTAACTGCCAG
GAAAGGCATCTCAGCTGTTTGTTACAAAAAGATCCAGCACTGCAACATTTTGTTTGAAGA
TTGTCAGCCAATCCAGAATTTTAAGCACATATTCTAAACTTGATTACACCCTCCCCTGCA
TAATCCCAAATCACACCTCTGCTCTGATCCTGATAGTACTCTTGGGACCACCTTAGTTGA
AGACTCACTCATGATTCCTACTTGTGAATAAAAGCTGAATTACACCTGGAATTTGAGCTT
GTGTTGATGACTTCCTTCTCAGCGCTGTGCAGAAGTTGAATTTAGCGTGGACTCAGCCCC
AATGCTGCATTGGCAGCAATGTTCCTTTGGGGCCTCTTAAGAGGGATGCAGGGTGGGAAG
TTTGATAGGTTTGATAGGTGGGAAGTTTGATGGCCTCAGTCTCACCTTGGATGCTGCAAA
TTCTTAGGGTGGTTGCTGGGTCATGGTGGGTGTCCTCAGACTAACTCGTGCTGTATCCAG
GAATGTCAGCTCCATTATCTGTGGACACTGTGCACCCCAGCATTTCTTGCTGGACAGGCT
AGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1154, 1934..1956, 1958..2606, 5865..6040, 7843..7957, 10293..10462
1001..1154, 1934..1956, 1958..2606, 5865..6040, 7843..7957, 10293..10459
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved