Sorex_araneus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Sorex_araneus CWF19L1
Sorex_araneus
CWF19L1
GeneScaffold_1570
SNORA12
37621..37765
39621
ACGTTAATTTTCTCTCCATTGGAGGCTGGAGCGATAGCACAGCGGGTAGGGAGTTTGCC
TTGCACGTGGCCAACCTGGGTTCGATTTCCAGCATCCCATATGGTCCCCTGAGCACTGCC
AGGAGTAATTCCTGAGTGCAGAGCCAGGAATAACCCCTGTGCATCGCTGGGTATGACCCC
AAAATAATTTGGGATTTCTTTCAAACCGATGGAAGCTATTGAGAGCGGGGCCGGGACGAC
TGTACAACGGGTAGGGTGCCAGCCTTGCACGCATCGGATCTGGATTTGATCCCCAGCATC
CAGTAAGGTCCACCAAACTCTCCCAGGACTGAGCCCGGAGCAGAGAGCCAGGAATACGGT
CTAAGCACTGCTGGATGTGGCGAAAAATTTATTTTAATGATGAAAAACGTTTCTATTAAA
ATCAAGCCCACCACCTTGATTATGTCTTTTCATTGAGTCTCATAACTTACAGACATCGCA
GAATTTTCTTGTGTGTTTGGGTTTTTGGTTTTGTTGTTGTTATTTTTGCTTTCCGGGTCA
CACCTGGAGATGCACAAGGGTTACTCCTGGCTCTGCACTCAGGAATTACTCCTGGCAGTG
CTGGGGGACCATATGGGATGCTGGGAATCGAACCCGGGTCGGCCGCGTGCAAGGCAAACG
CCCTACCCGCTGTACTATCGCTCCAGCCCCTCGATTTGAGATTTACTCACTTATTTTTGC
TATCCCCGTTCCCCTCTCTCTCTTACCATTCTTCCTCCTTCACGTCTGCCCCGGGGGTGG
GGTGGGGGCTGAGGGGATTGGAGGAATTGGGGGGGGGGGAGAAGGGGGCGGTGGTTGTGC
TTGAACGAGTTTTGTCCCTCGGCGCTCCCCGTAGGCGGCCCGCCCCTCCTTGACTGCGAC
GCGCTGACGTCTTATTTCCGCGCCTCAGTTCTGCCGGGAGCCGGCTGCGGAGTGTCGGGG
TGCCGGGTGGTCGTCCAGGCTGGGCTATTGCCATCGGTACGATGGCTCAGCAGCCGCTGC
GCCTGTGAGTGACCGTGAGCCGGACGCCCGGGGTGCACGCGCGTGTGCGTGCGCGTGCAC
ATGCCCCTGCGCGCGCCCCGTGCGCCTGCACGCGGGGTGTCTCGGGGCGGGAAAAGGGAG
CATGCTCGCGGGCCAGGGGTGGCTGGACCCGGATCGCGTCTCTTCGTGGGTGCAGGGGCC
GGCCTCGTTCCCGTTTTCGCTTCCGAAAAAAGAAGGGACGCTGCGCCGTTCGTTGGAGAA
GCGGAAGCTTCCCGCGCCGAACCTCCTTCCTCGCTTTCCTCTCCGTTAAGGAAGCTCCCG
TGCTCAACGGAAGTTTCCAGCCTTGGAGCAAACCGGACAGATAAAGCTCCTGCTTTGGTG
CACCGTTTTGGAAGGAGGGGACTTTGGAATAGCGAAGAGAGCTCACATTCACTTAAATAT
TTCCTGAGCGGTCGAGGTGGGCCAGGCACTGTGTTAGGTGTTTGGATGGTGGAGTTTCGA
CTTTCATAGGGACTGTCGTCCGGTAAAAGTTATTTACCAAATAGCTCCGGCAAATGGAAA
ATTTATTTTTGCAAGTGAGTTGGGTGAAGTGGGGAGAGAGGGAAGTAGCCTCCAGAAAAG
AGCTTTTCCTTCTCTCCGTCGGACCCGCTTTGCTTCCTGTGGGAAGTCCTTGGCTGGCGT
TGTACCTTCTTTGGAGGCGGCTGCCAAGCCGCACTTGAAGTCTTGTTCAGCTCTCCTTGG
GGGACTGGTCCTCACCGCCAGTTCTCTGGGAGCATGGACTCAGGCTGGAATGAGCAATTG
TTCTTTGCAAGAAAGAGAAGAAATTTCTTTTTAGAAAATTAAAAAAAAAGGGGGGGCACA
CCTGGCGATGCTCAGGGAACCACAGGGAATGCTGGGCATTGAACCCAGGTGTGCCACACA
CAGGGCAAGCACTTTTACCCACTGTACTATTGCTCCAGTCACGTGGCTGTGCTCAGGGCT
TACACCTTTTTCAGGAGACCATATGTGGTGCTAGGAATAGTAAGTACTGTTGAACTGCAG
TCTGCCATGTGCAAGGCAAACTCACCTTAACCCCTGTACTTACTTTCTGGCCCCTGGAAT
TCTTTATGCAGTAGGACTTTCTTGGATTTTTTTCATTGGGAAAAGCAATTAATTTTGGGG
GTCCATTCTGAGGTCCTGGTTAGACTTTATCCCTGCAGTCATGGATCCAACCTTGCTCCA
GTCCTGATTTCTATGTCACAGAAGCTTTCCAGGCTGCTCAGATGGATCCTGTATTTCAGA
GGTCTTCCATGTGTTTGGGCTGGTTTAAGTTCAGGCAGTTTTCCCCAGTACACTTTACCA
GGACGCTCTTAGTTCTCTGCCTGAAATATTTTGACAGTGATAAATGATAGAAAGGGTTCA
CAGTTAGGAGAAAGGGTGTAAGAGGGGTATTTGGCTTAAAATGAGTAATTAGGAGAGGAT
TTAGTCTTGATTAGCATTATTATATTTATCGCTTAAAAACCATAGGCATGTTTGGGACCC
CTGTTTCCTGTTGGTGGGAATGTTGGCTGATACAGCCTTTTTTGAAGTCAATATGGTCTT
GATTCAAAAAAGTAGCAATTGAGCTTCCATACTCAATCCCACTCCTCGAAATATACCCTG
AAGATCCAAAATCCCAATCCAGAAAAGACATTTTTCACTTTTTTGTTCATTGCAGCGCTG
TTCACAATAGCTCAGATCTGGAAACAACCAGTACCCAAGAACAGATGACTGGATAAAGAA
ACCATGGTACATCTATACAATGGAATAGTACTCGGTAGTAAGAAAAGATAAAGTCATGCA
ATTTGCTGCTAGATGGAGGGACCTGAAGAGTATCATGTTGAGTGAAGTTTATTAGAGAGA
GAGGAACATGCACAGAATGATCTTTCTCGTATGTGGGATATAAAGAAGCTTTGTGAAGGA
ATAATAAAGCCCCAAAGGCAGTAAAAATGGAGAGCAAACGACCTGGGTTCTTCAATAGGA
AGCTTACCACTGGATTGGAGGTGGGGAAGATATATTAGGGAAGAAACACTAGGACAATGA
GGGAGGGAAAAGTGCCTGCTCTCGAGGAAGGCTGGAAACAGGAGGGAAACTCCAGACATT
GGTGGAGGGAAGTGGACACTGGTAAAGTGATTGGTGTTGGAACATCAGTTATCTTAATAA
TGAATAACTTTGTAACACTGTGATTCATGGTGATTAAAAATTTAACAAAATATAAAAAGA
AAGAAAGTAGCATGTTTAAGAATGCATAGTAAAATTTTTATTCCAGAAACTTTTGGCAGC
TTCATGGAGACTAAATTAGAGTCAGAGTAGATGACAGCAACTAGGAATAGGTAGAGTACA
AGAAAAATGTGGGTATTCTATGCAGGAGATGTAATCAGTAGAACTTGGACACGGTTTGGT
TATATTGCAGGCGGAGAGCTAAGAAAGGGGAGGGGGGCACTGGAAATGTATGTTGGAGAA
AGCAGTCTGGAACCTAAACCAGCCCAAAGACAGAAGACCCATCTCAGGAGCCCAGAAAAA
AGCGTTTGTGATACAGAATTTTAGGTCCTTTGCCAGGCTGGATCTCTGGGAGGGGCGGCA
TCAACAATACAGGGACAAAGACTACAACAGAAACTCAAGAATGGGGGCCAGAGCCATAGT
ACAGTAGATAGACATTTACCTTGCATGCAGCTGACCTGGGTTTGATCCCTGGCACTACAT
ATGATCTCCTGAGGAGTAACCCCTGAGCACCAACCAAAAATAAAAATAAACTCAAAAACG
GACCACCAAGGAGTGATAGTACAGTATGTAGGGAATTTGCCTTGCACATGGCTGACCCGA
GTTTGATCCCTGGCATCCCATACAGTTCCCCAAGCCCCATCAGAAGTGATCCCGGAGTGC
AGAGCCAGGAGTAAGACCTGAGCACCAATGGGTGTGGCCCGAAACCAAAAAAATAACAAG
AAAAAGGAAGAATGGATCACCCAAAGCTCAGTGCTTTGCCCCAGGGAAAGCTTTCGCATG
TAAAGAATTTGGGACAAAAGTGGTTATGGAAAACATCTGTATGTAACTTCCCTCCGGCTG
GTTACTCAGGGCTTTTCGATTCCGAGAAGCCAGTCTTCTCACTTAAGCATGTAGCTTTCT
CTCTCTTCCTTTATTTCCCAGATAATAAGCTCCATATGTTGAGGTGAAGTTGTTGGTAAG
ACCTTTAGGAGGAGCTGCCCAGTGCCCCGTGAAAGTTTGCGCTGACCCTCCAGGAGACTG
GATCCCCTGCACTGGACCTGATCCCAAACTCACAGGCCCAAGCCTTAACTTTTCTCTGTT
GTTTGCAGGTTGGCTTGTGGAGATGTTGAAGGAAAGTTTGATGTTTTATTCAATAGAGTT
CGAGCAATTCAAAAGAAAAGCGGAGACTTTGATGTAAGATGTTTCTTTTTTACTGAATTT
GGTTTTAAGGTTGTAGTGAAATATGCTGAAGTTTGGGCTCTTTGATTCATTTCTCTGTGG
AACACGCACTCTTGTCTGAGTTTGTTTTCTTGTCTGAGTTTCTGAGCATAGGAACTTAGT
AGCTATAGAGTGTTGGGTTAGGGAGACCCAACATTTTATCCTTTCTTAATTTGAATCTTG
TTACTGTAGTACCTTACACAATACTGAAAGTAGACAGTGAAACCTCCCTAAGTGATGAGA
TTTGGGAAAGCACTGATCTACTTCTTGTTCTGGATTAAGTCAGATAAGAGAAATAGAAAG
AACCATGTGAAAATATTTTGTGTGGTTGTTTATTAGACTGAACTATTGAAGTACAGGAAA
ATACTCTAAGGGCTGTAGAGGTGGTTCAGCAGAGAATAGTTGCCTTGCACGCCTGAGGCC
CTGGATTCTGTCCCCAACATCACCCCAGGTCCCCCTGCCCCCCCCAAAGTAACAGAAATA
TTCTAGGAATTAATTTGTTCATTGTGCTAAAGGTTGGGTAAAGACAGCAGACAGCAGTCT
TTTTGTTTTGTTTTGGTCAACACCCAGCTGTGCTTAGAGCTTACTCCTGGCTCTGCTCAG
GGATCACTCCTGCCAGAGTTTGGCAGACCATAGGGGATGCCAGGGTTCCAACCTAGGTTG
GTCATGTGCACGGCAAGCTCCTTACCTGCTGTATTATCTCTCTTGCGCAGGAAGATTATG
CCTTAATCTCTCAAGATATCTAATGTCTAAATCTTTTCCGGAGGGGGGTGGCCACACTTG
TCAGGGCTCAGAGGTTACTTCTGCTTCTGCACTGAGGAATCACTCCTGACGGTGTTCCCT
GGAACCATATGGGATGCCGGGGCTTGAACCCAACTCAGCCACGTGCAAGGCCAGCACCTT
ACCCAGTATGCTAGCGCTCCGGCCTCTATTGTCTAAAGGTTTTGTATTTCCCAGAAGGAT
TCTTTTGCCTCTCTCTGACTTATGCTTCCTCATCAATCAGAATTTGACTCACTGAGCAAT
TATTTAGTTTAAAGATATTGTCTGGGAGGGACACAGCTGGCAGTGCTCAGGGCTTCCTGA
CTGCTCTGCAGTGACTCCTGGGGGTGTCCAGGGACTGTATTCTGTACTGGGGATTGGAGG
GAGGGGCTTGGTTCTGTGCAAGGGAAGCACTTAAACCTTGTACTATCTCTCTGGCCCAGT
AAAGCTTAGTAATTTATAGAGTCAGACTTCTTACTGTTGTTAAAGACTTAGACATTGACA
TACTGCAAATTACTGGGTTTGAGACCATTAACTAGTATGAATAACTAGTGTTACTGTCAA
TTTTTTTGTGTGTTGTTTAAAAAAAAAACTTACACATGTTTAAAAAACTCATTTTAGCTG
CTGTTGTGTGTAGGAAATTTCTTTGGCTCCACCTCAGAGGCTGAATGGGAGGATTATAAA
ACTGGCATCAAGAAAGGTACAGAAATGATCTTATGAATGGTTTCTTTGATTTATTTTGTT
TTTGAGCCATGCCCGGTGGTCCACAGGGGTTACTCAAGGTTCTGTACTCAAGGATCACTC
CTGGCAGGGTTCGGGGGATCATATGCGGTACTGGGGATTGAACCGGTGCAAGGCAAGTGC
CTGCTCTCTCTCCAGCCCCAACAAGTGATTTTTCTAACAAAAGTTTAAAGGCCACCCACT
GCTTTGTGGGTGTTTCACACGAGTCATTTATTAAGAATTTTCCCTTTGAGCTCTGTGTTA
TACTGGCAGGAATGTGTATGTACATAAATGTTTGCATATTGAATTGAATTCAGTTGAATT
TAATTCCAGAAAAATATTTTTCTTCTCAGTAGGAAGACATTTAACAGTGTAACTATGCAT
TCTTTCCTTTTTCACTTTCAGATTTTTGGGTTTTGTTTTTGTTTTTTTTGGTGTGGAGTT
GGAAGAGGTAGGGCCATACCCACAGTGCTCAGGGCTTAGTCCTGGCTCTGTGCTCAGGGA
TCATTCCTGGTCGGCTTGGCAGACCATATCAGGTGCTGGGGATCGAGCTGGGGTCGGTCC
TGTGCAAGGCAAGCACCCTAGCTGCTGTACTATCTCTGTAGCCCCCTCACTTTCATTGTC
TTTAATTAAACTCTATATGGTCTACTATATTTTTCCTAATGTGATATATTAACCTCTCTT
TAAGATGACACTCATCAGTTGGGGGCGTGGATGTGCGGTACCCTAAATGGAGAGCAGATT
CCACATTCAGGATTCCATTCTTGGCTTTTGCTAGGAATATATTTCATGGGGTGGGGGGCA
TGGGGAGGATTTCTCAATTCCCAGTGCAGATCTTGTAATCACGCGGTGTCCTGTTTGTTT
CCCCTTACCAGCCCCCATTCAGACGTATGTGTTGGGTGCCAATAACCAGGAAACAGTAAA
ATATTTCAAGGATCCCAATGGGTGTGAATTAGCCGAGAACATTACTTACCTGGGTAAGTT
CATCTTTTGTGTGTTTGTCATGAACATAATAAGGTGTCCCCAGGAACTAGTCATCCAGAA
GATTGGTGACTAGATTCTTCCACAGCTTCTGAGAAAATGGGGGAAGGTTCTTTGCCAATG
TCTGTATCTGTATCCTTATGGTCACGTTTTGTCCTTTGTGCTCTCACCCTTTTGCTCAGT
TTGCACAACCCGGTATATTCTCTCCAGGTGTATATATATATATATAACCAGGTATATGCT
CTCCCGGTGCTATCTCCTGGGCCCTAGAAGGGTGTTTGGAGAGGTAAAGCTATTGTCAAT
TTTATAGAATCTGAGTGAAGAGAGAATAGTTTTGGTAATTACAGGGCTGTTAGTGACTTT
CAAGAGACTGCTGAGAAACTAGATTGTGGTGGGTTAATGACCCAATTCAGAGGTCAAACT
AAACATTCTGGTGAGAAATTCAGAACTGAAGAGAACACTTCATTTATTTGTTACTGTTTT
CCCAGTATGAGTGCTTAAGTGCATGTGGTAGTGTATCTGTTTCTTTTTTTTTTATATCTG
TTTCTTTTAAGAAGAGAATATGATATTCGCCCATTCAACTCCCAATTCTTAGATTCAGTG
CTATATTCTCAGTCACTCTCGCCGTTTTCAAATGAGAAAACAGTGGGTGTAAAGGAGGCA
GCAGTTGATGGATCTGAGTCTTGGAGGTAACAGGAAGGTCTGGGATCAAGGTCACAAGCC
AGGAGTAAATTTAGAAGAGGGGACCCTCAATTGTTCCCAAACAGTTGCCCTTCCTTCCTT
CCTTCCTTCCTTCCTTCCATCCTTCCTTCCTTCCTTCCCTCCGTCATTCCTTCCATAGAT
TAATCTGTACTGAGCTCTGTAGTTTTGAGATCTATAGTGAGATGTCCCCAGGATAGTAAT
CTTATAAGCTTATTGGACCTCTTAGTGCGTGCTTGGAAATAACTAATTATTAAAAAACTA
AAATTTAAAATGTTTATTAAGTTTATTGGATTAAGGATAAGAAAAAAGACCATAAATGGA
AATTTTTTCCCCTTAATGTAGAATAGAGAACATCAGTTAGAGTGATGAGGAGTATAGGGT
ATGGTGGTTACCCCCCACGATGAAATTTAAAAAGGCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGATACTGGACAGTTGGGTGCAAGGCAATATTACAGTGGGCCAAC
CCACTGTAATATTGCTCCAGCTCCCCAGTCAGTTGCTCTTTCCACATGTTTTCCTTCTGT
TGAAAGTCCCACCTGCATGAGGAATGCATCTGTTCTGGAAGCCAGCTTCCTTAGGAGAGT
AAAGAAATAATCAGGACATTCATAAACCCGATTTATGGATGGTCTGCAAAGCTTCTCATT
GCTTTGCCCTGCACACAGGTGTCTGGGTCTCTTTCATCTATATAGTGTCTCCTTGATAGC
AGAAAGCTTTATTTTGAGCCATACCTGGCAATGCTTAGAGCTTATGCCTGGCTGGGATGG
GGGGGACCCATGGGGTACCAGGAACCGAGTCTGGGTCAGCGCGTGCAAGGCAAGTACCCT
CCCTGCTGTACTGTAGCTCCTACCCCAATGGCAGAAAGCTCTTTCTTGAGGCAGGCCTGC
CCTCTTCCTCCCTCTGGAAGGCAGTTGAGGCTCCGACCCCTGGGCTCCCACAGCCTGCCT
GTCCCCAAGCCTGTGCACCATTGTGGGTCCCAGGTCCTGAGGCCCATGGCCCGGAAGGGA
GCATCATTCAGGCCCAGAGAGGGTCAGGGAACCAGAGACTCTGACCTGGTTTGAGGGAGA
TTTGTCTTCCTCACAACCATTTCTCTCTGCAGGTCTGAGAGACTAAACCCTTGTCTGTTT
TCCTGTGACCCCAGGGCGTAAGGGCGTCTTCACCGGGAGCTCGGGACTGCAGATTGTGTA
CCTCAGTGGGCTGGAGGCCCTGAGCGAGCCGGCACCGGCATATAGCTTCACTGCCAACGA
CATGGCGACTCTGAGAGACACGCTGTGCTCAGCACCTGGCTTCAAGGGAGTTGATATCTT
GCTTACATCCCCATGGCCCAAGTACGTGGGAAACTTTGGGAATTCTTCTGTGAGTAGTGC
TTGTTTGGTTGGAATTTCTAAAAGTAAACTACGTGGGGCTGTTTCGCTCTTTAGATCGTG
TCTTTTGCTCTTCGTACCTTTTAGTGGGGTGCTTGATATTTTTTTAGGGAACTTAAAGTT
ATGTGAACTGACTAAAACCCAACATTAAAGTTAATTAAAAAAAATGAACAAATTGAGAGA
AATTCTAGAAAATTAAATGAAACTAAATTTGATCGTAGGAAAAGCATAGTGCACAGATGA
GATTGCTCCTATCTTGGAGAGCTAGTATAGTGGGTAAGGCTTTTGCTTTGCACACTGCCC
ACCTGAATTTTATCCCCAGCACCCCAGGAGTGATTCCTGAGTGCAGAGCCAGGAGTAACC
CCTGAGCATCACCGGGTGTGACTGAAAACCAAAACAAAAAATGTCTGGTTCTGTAAATGT
TCTCTGCTTCAAGTGCCTTCTCTTGGTCTTCCTCTTTTTTTTTTGTTTTTTGGTTTTTGG
GTCACCCCCAGCAATGATCAGGGGTTACTCCTGGGTCTACACTCAGGAATTATTACCACC
ACCAGGAGGTGGTGCTTGGGGGGACCATATGGGAAGCCAGGAAATGAACCCCCGTCGGCA
GCGTGCAAGGCAAATGCCCTCCCCTCTGTACTATTGCTCTGGCCCCTCTTGTCTTTTTCT
TCTTCATAAGTTTTGACAGTTCACCAATTTTCAGTGAATGGTTTTTCATCCAGTGGCAGT
ACTAGTCCCTGCTTCCATTCAGTATTATATAAGTTTTGGCTACTAAAACTTAAAAAACAA
TCCCTTCCCCTTCTCCACTTTTTGCTGCTCTGCTGTGGGGTGATGCAGGATCAGTTGCAT
GCAAGGCAAGTGCTTTAACTCCTGCACTCTCTCTTCAGTGTAGGGTCATATTTATTTTAT
CGTTCACGACTGAAAGTACAGCTTCACCTTCACCTCAAAGCCAGTGCCAAGCCCTTTAGC
AGAGACCCTGAGCACACCAGCCTCCGACAAAAGGAAGCTCTTGCTTTACTTAGTGGAAAA
TTTGCTTTGGAAACTTCTTTATCTTCAGTGTGCACCTTCTGTTAGATTTCATAAATAATG
TTACAGACGAGATAGATGAGAGAGCACACAATTTATTGTTAATAGAAACCAGGGATATTT
TAGGAACAAGCCTAATTTATTTTTTTCTTAGTTTTTGGTTTTTGGACCAGACCGACCCGG
GTTCGATTCCTCTGCTCGTCTCGGAGAGCCCGGCAAGCTACCGAGAGTATCTCGTCCGCA
CGGCAGAGCCTGGCAAGCTCCCCGTGGCGTATTCGATATGCCAAAAACAGTAACAACAAG
TCTCACAATGGAGATGTTACTGGTGCCCGCTTGAGCAAATCAGTGTGCAATGGGATGACA
GTGATGACACTGATGACCTGTTAGTGCTCAGGGACAGTTCGTCTGAGTGCATATGGGAAC
TGTGCTGTGTCAGGGATTGAACCCCTGCTGCTACAGCACTTTGAGCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
AGAAATGGCTCTCTGCCCTGAAAGGCCATGATCCCAGGGCACACAAAACAATCTCGGAAC
GCAGCAGCTGCTGGCAGATATACTTACTCCTGGACTGTGAACTAAGCTACAGCCCTGTGC
AGCCCCAGCAGGGGAAGGGTTTTGTCCCTTGGCCTTTTTCCCTTTGTGGCAGCATGGTGA
CTGCCACCTGTCAGAGCCAAGTGGACAGAGAGGTAGGAGCTTGCAGTGATTGGGCACTCG
GGAAATCTCGCAATGAGGAGGGTAGAACTGGCCCTGCTCCCTGCCCAAATGAGACCCTGA
GTGGCCCACGAACAGCTCCTCCACTCCTAACAGCCATGATCTCAGAGGCACACAAACCAA
TCTTGGAACACATGCGATATCATATACTCATCATTATCAGCAATAGAAAACAAATCATCT
AATGATGCCTTTTCGTCAGGTCCGATTGTGGGGGAAAATCCCAAATAATAATAGTGGGTT
TTCTGTCGAAAATTGAATGTAATCAAAGTAAAGAGAAAGTAAAGTGAAAATCATCTGCCA
CACAGGCAGGGTGGTGGGGGGGTATACTGGGTTCTTGGTGGTAGAACATGTGCACTGGTG
AAGGGACGGGTGTTTGATCATTGTATGACTGAGACCTAATCCTGAAAGCTTTGTAACTAT
TCTCACGATGATTCAAATTTCTCTTCAGATTGCATAAAAACAAACAAATAAATAAATAAA
TAAATAAAACAAGATGAATATATAACAAAAAGTTCTGAGAACAAAAAAAGGGTGATTGGG
GGGGCTGGAGAGATAGCACAGCGGGTAGGGCATTTGCCTTGCATGCGGCAGACCCGGGTT
CGATTCCCAGCATCTCATATGGTCCCCTGAGCACCGCCAGGAGTAATTCCTGAGTGCAGA
GCCAGGAGTAACCCCTGTGCATCGCTGGGTGTGACCCCCCCCAAAAAAAAAGGTGATTGA
AATTGAAATTGGCTGATTTTTCTAAATTTTCACTTCTTTGACTTTTTTGTTTTGTTTTGT
TTTGTTTTGGGGGCCATTCCTGGCTGTGTTCAGGGCTTTCTTCTGCCCCAGAGCTCAGAA
ATCACTCCTGGTGAGACTCAGGGGACCATACGAGGGATGCCAGGGAGCCAACCTGGCCTG
GCCACATGCATGGCAAGTGCCTGACCAACTGTACCATCTCACCAGCCCCCTCTCAGGTAT
TTTTAAAAATTGAGTCCACACCCTGGGTTGTTCTGAGGTGCCTAGGGCTTCTTTCTGTGA
CCCTGGGGCCATGAGGATTTCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTACTCCTGG
GTCTACACTCAGGAATTATTACCACCACCAGGAGGTGGTGCTTGGGGGGACCATATGGGA
AGCCAGGAAATGAACCCCCGTCGGCAGCGTGCAAGGCAAATGCCCTCCCCTCTGTACTAT
TGCTCTGGCCCCTCTTGTCTTTTTCTTCTTCATAAGTTTTGACAGTTCACCAATTTTCAG
TGAATGGTTTTTCATCCAGTGGCAGTACTAGTCCCTGCTTCCATTCAGTATTATATAAGT
TTTGGCTACTAAAACTTAAAAAACAATCCCTTCCCCTTCTCCACTTTTTGCTGCTCTGCT
GTGGGGTGATGCAGGATCAGTTGCATGCAAGGCAAGTGCTTTAACTCCTGCACTCTCTCT
TCAGTGTAGGGTCATATTTATTTTATCGTTCACGACTGAAAGTACAGCTTCACCTTCACC
TCAAAGCCAGTGCCAAGCCCTTTAGCAGAGACCCTGAGCACACCAGCCTCCGACAAAAGG
AAGCTCTTGCTTTACTTAGTGGAAAATTTGCTTTGGAAACTTCTTTATCTTCAGTGTGCA
CCTTCTGTTAGATTTCATAAATAATGTTACAGACGAGATAGATGAGAGAGCACACAATTT
ATTGTTAATAGAAACCAGGGATATTTTAGGAACAAGCCTAATTTATTTTTTTCTTAGTTT
TTGGTTTTTGGACCAGACCGACCCGGGTTCGATTCCTCTGCTCGTCTCGGAGAGCCCGGC
AAGCTACCGAGAGTATCTCGTCCGCACGGCAGAGCCTGGCAAGCTCCCCGTGGCGTATTC
GATATGCCAAAAACAGTAACAACAAGTCTCACAATGGAGATGTTACTGGTGCCCGCTTGA
GCAAATCAGTGTGCAATGGGATGACAGTGATGACACTGATGACCTGTTAGTGCTCAGGGA
CAGTTCGTCTGAGTGCATATGGGAACTGTGCTGTGTCAGGGATTGAACCCCTGCTGCTAC
AGCACTTTGAGCCATCTCCCCCCGCCCCGCAAGCCTCATTTTGTACAAACTGTATTTTGA
ATTTCATAACAAGGATATTGTTGTCCTTCCACACACCATACCTTTCTTGACTTAAAGGAT
TGCATGTTTAAGGGGAAGTTCTTGGCTGTTCCATCCCATGACTAATCCCTCCTCTAACTC
TAGGGGCCCTGGAAACTAACTTTTTGTTTTCATTATCTGTATTATCTGTATTGTCACACC
TCCGGGAGCACAGTATAGAAGTTAGAGAGTCTTAGTGTAAGGGCATCAGAGACAAAGCTT
ACTTTCCCAAACATAAGCACTGTTTTGACTGTTAAGATGGAGGCTTCCCTTCCTTTCCAG
TAAATTATTCCTAGTTTATCCTACATTGGAATATTCTCCCTTCCCCATTAAGTATTTGAG
ATTCCTCTTTTGCCTTAGGGTAAAGGGATTCCACTGGTGCCAATACTATGGGACCACATT
TGGTTCTCATAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGGG
ATCATTGCGAGGGGAGCCCAGGGAGCCATCCTAGCCCTGACAACATGCATGGCAAGTGCC
TGACCACCTGTACCATCTCACCAGCCCCCTCTCAAGTATTTTTAAAAAGTTGAGTCCACA
CCGTGGGTTGTTCTGAGGTGCCTAGGGCTTCTTTCTGTGACCATGGGGCCATGAGGATTT
CGCTTGGTGGCATATTTGGGAGGCCCATGCTAGGGATCAGATTCAAGACCTTGTATATGT
TTGGCAAGTACTCTATCACTTGAGCTATTTCCTTTTCCTAATACTCAGTATTTTGATATT
TTTCCTAGAAAAATGAGATAATTATATATTTGACACATTTTTTTCATGTAAAACTTATTT
CCTTCTCATTTTTATTTTCTTTTTGGGTCACACCTGGTGATGCACAGAGGTTATTCCTGG
CTTTGCACTCAGGAATCCTGGTGGTGCTCAGGGGACCATATGGGATGCTGGGAATTGAAC
CTGGATCAGCTGCGTGCAAGGCAAACGCCCTACTCGCTGTGCTGTCACTCCAACCCCTCA
TTCTGACTTTATTTAGCTTTTTATACATGAGGGAGTAATGTAATAAATTCTCTTGTATCC
ATCAGCTAATATTACCAACCCATATTATCAACATTTGTCAGCTTCCAACACTTGAACCAA
AAGTTGGAGGTTTTGTACTTTTGATCATGTTTTTTTTTCTGTGAGGATTAACTTACCAGA
GATAGGAAACAATTGAGATTTTGTTTCTGGTGGAAATAGATTGAGGGGCTGGACTCTCCC
TGGAGCTTAGATAATTCATAATTGTAAAGCAGGGTGCAGTTTGCTGCTAACTCTTTTCTT
TCACCTGTGTTCTAGAAATCACATCGTTCTGCAGGAAAGTACACAGCATGCCACCAGGTA
CATAGCTCTGGCAAATGTTGGAAATCCAGAAAAGAAAAAGGTACTTGCATATTTGGTGAT
ATTTGGAAATTTCATCTTCATTGTCTACCTGAGAACTGTCTTCTCTTGCCCAGTCAAGCA
TTTGAATCTTCCCTTTCACCATCTCCAGCATCCTGTGGGGCACCTGAGTGACTCCTTTGT
GAAGGTGTAATGATGTCATATTTCCTTGTGTCCTTTTTTATAGAAATTATAGAAAAGGCT
TGGGGAAAATAGGTCCAGTGGTACAAAAGCATTTTCTTCTTTCCTTTTTCTTTTTGGGCC
ACACCTGACTGTGCTCAGGGCTTACCCCTGGCCCAGTGCTAGGGATTGCTCCTGGAGGGG
GAACCATATGGGCTACTGGGGATCGAACTGGTCAGAAATGTGCATGGCAAATGCCTTACC
TGTCATTCAGGCTCCAAAGGCAAATTTTCAAATGAACGAATTTCCTTTCTTCCAACCTTT
GTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTGTGCCATTTTTTCTTCACAGTATC
TTTATGCGTTCAGTATTGTTCCTATGAAACTAATGGATGCAACAGAACTGGTCAAACAAC
CTCCAGATGTCACTGAAAACCCTTACAGGAAATCTGGGAAGGAAGCATCCGTCGGAAAGC
AAACTCCTGCCCCAGAGGTATGTCCTGTTTGAGAAGTGGCATTTTCTGGGCAGGATTATC
CATTACAGGTATCCTAGTTTAGAGTTTAGATCATAAGGTAAGTTTAATTCTTGGAATTTT
AATTATTCTTATCCTTGGAAAATCCTAATAATGTATAAAAAAAGCCTTAGTAGGTTCTAA
GTAAGCTCAGTGATTTTTTAAAAAATTGTGATGATTATGATTTAGGGATAATATTTTTAT
GTGTTAAAAAACTTTATCTAAACTTGAGTCACATGTTGGGGTTGTTTCCTATGTTCTGTC
TTTATATAAAGTTGATTATTCACTTTTAAGGCAAGAATCCAATTGCTTAAGCAATGCAAT
TTATGATGTTATATAATGAGTTCTAGTCAGTAAGATTTACTCTTGAGGAATTTCTTTATA
GCAGGCTTTTCTAAAACTAATATTTCCCCTTAGCAAGAACATCAGCATCCACCTCTCCTA
GCATGCATCATTTGCTTCTGAGATTTTGCTTTTTCCTTTTTAAGCAGCCATCTCATCTTT
TCAAAAAAAGCTCCTAAAGTTGGATTTTTTTGACCTGTTAAGACTGTGACTGCCTATTAC
CCTTTTGAGAGAGGTAGGAAGAAAAATATGGATGGGTCCATATTATTCTGTTTCAGGCAG
GAATTGCCTTACTGGAGCAAAGAAATTGCTCAAGGACCTAACATGCATGCTTTGCATGTG
GGAGCCCTTGGTTCAATTCCTGGCATTGGATGGTCTCCTGAGGACTGAGCCAAGTGTGGA
ACAAAAACATCCCTCACCAAAAAAAAAAAAAAAAAGGCTTTATTCTTTTTTTTTTCCCCC
TTCTTTTTGGGTCACACCTAGCGATGCACAGAGGTTACTCCTGGCTCTGCACTCTGGAAT
CTCTCCTGGCAGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCTGAATAGGCCA
CATGCAAGGCAAATGCCCTACCCACTGTGCTATCGCTTCAGCCCCTTTATTCTATTTTTT
AACCTGCATTTGCAAAGAGATGATTTGGTAACTTGTATCTGTGCATCAAGATTAGGAGGG
ATCTTTTCTTTCCTTGAACAGACAGGAAGGACTGGGAGGGATAGGGACGTGGCAGGAATG
CTCCTCGTCTGTGAATGGCTAATTAGGCCAAAGGTTAGCCTAATCACAGTTTCCCTTCTG
CTTTCCACCATTACAGGAAGAATCAGCCTGTCAATTTCTCTTTGATTTGAATGAAAAGCA
GGGAAGGAAACGTTCCTCGACGGGCAGGGACAGCAAGTCTCCTCACCCGAAGCAGCCTCG
CAAGCCACGTAAGTCCCCCTGATTCCACAGTCTCCGTTGTCAGTCATGTTGGCTACTTTG
GGGCTCGTGGATGCAGCGTTGCTAGGAGAACCTCTTCTGTCAGGAGATTTTTACAGTCTG
TCATTGGGACCCAGAGTAAAGAGACTGCACAGATCACTTTGAGACTGTCTGAGACTGTGT
TTGTAACAGCGATGGGAAAAGCTCCTTTCCTCCTTCCTACCTTTTGCCTCCTGGGGTAGG
TTCATACGTCAGCATCAGAGCCCAACTGGTTGGAAGAACTTCAGGCTGTTTCATTCAGAT
CCTTTCTCCATCCTCATGGTTTGAAGATGCAGATGCTGATTTGGGGAGGGAAGATGGTTA
CACGGGGTCGTACATCGCTAAATCGTGCCGAGTGCTGTATGTCTGGGGCTCCTGACACCT
GGTTTAGTGTTCTTTCATTGCAGCCTTTTCCATGCTACTTTAGTCAGTGCAAGGTTATCC
TCTATCGACACCCCGCCCCCTGCCCCCCATCTGCCTGTTGGTCACAAATTCAGAGCTTTC
CTAATGGAGTGTTAGTTCATTGACAGTGGTGGTAGGAGCGGGTCACAGTGGAAAGCGCCA
TTGGCTCTGTTGTGGTGGTGGTGCTGCAGGTCATAGGGCTCAGTCGGATCAGAGAGACAG
ACAGGAGGGAAGGCACTTATGTGGCTTGTAGCTGTGGTGGCTGTGACCCTGGTTCGAAAC
CCTGGTTCCCCAAGCCCCACCAGGGGTCCTTCCTGAGCCTTGAGCCAGGGGTGGCCACTG
AGACCACAGGCTGTGACTCCCCCCCCCCCCCAAATCAAGCCTCGGTTATGCAGGATGATG
GAATGGAGGAAGGCTTGGCTCGTAGCGTAGTAACACTTGGCTTTCTTTTCACGTGAAGCT
CAGCCTCCAGGACCCTGCTGGTTTTGTCTTGCCAGCCCCGAAGTGGAGAAGCATTTGGTG
GTCAACATTGGCACACACGTGAGTTACTTCCATAGACCATTTACAGAGGCAGGAGATCCT
ATTGTTTTTGTCATCTTCATAATTCAGTCATAAAATTTACCTGTAAGTGTCCAGTTGCTG
GTTTTAGTTTTCACTTCTTTTAGCGTAATATTCTCGAGGCTCCTCTAGACTATCTCAGTA
TTTCATTCCAGTTTGATGTCAAATAGTGATCTGTTGTACAGACTGCATCACATTGAATAG
ACATTCATCAGTTGATGGCCGTTTGGACTCTCACTGGCTATTAGGGATAATGCTGCCATG
AACAATTTTTATGCCAGTCTTCGGACATTGTTTCAATTCGGATAGACTTCCAGGAGGGAA
TTGCAGGTAGCTGTAAGGTTGACTTTTTTAAGAAACTGCCAAACTATTTCCCAGTAGCTC
AGCCATCAGCCAGAGTTTGATGACTCCTGTTTGTATGATGATGTACAGCCATGTATGAGG
ATTCCCATTTATCCATGTTTTTGCCAGTGCTTATTAGGGTCTGTCTTTTTTTTGGATTAT
AATGATTTCGCTGAGGTTGTACAGGGCCACAAGATGGGTCCCTTCATTTCTTTCTCCCTA
AAAAATAGGTATGGATTTCCTAGAGTGATGCTTTATAGACATTTGCATTGTTATGTTTTA
GTTCATACAAGTGGGGGATGATAAATTGCTGTTATTACTATTTCAAACAGATTTTCTTTC
TAAAATGGGAGTCTTCTGTTGCTTATTAGGTTAAGAAATGTTTCTGTTCTTAAGGCTTAG
AGAGGGAGGGCAGTGGGTAAGGGACTTGCTTTGTATGCAGCCTACTTGGTTCTGTCCCTG
GCACTCCATATGGTCCCCTGGGCACTGCCAGAAGTTACCGCTAAGCACAGAGCCAGGTGT
AAGCCCTGAGCACTGGGTATGGCTCATAAAAAAAACAAAAAATTTCTGTTGTTGGAGCCA
GAGGGATAATGCAGGGGTGAAGGTGCTTGCCTTGTACCAGANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTCGAGGAAACGTTGTATTCTCT
TTGAGCGGAATTATAAGAAGCCATCATCTTCCAGCTGCAGGTTGATGATCTCTTCCTGGG
CACACCCGGGAGAGTCTTGTAGGGACTTGGATCTTTTCTTCTGGGTGGGGTGGGCATCAG
TGGAGCACTCCTGGCTGTGCTCAGGGGTTTTTTTTTTTTTTTTTTTGGTTTGTTTTTGGG
TCATACCCAGGGATGCTCAGGGATTAATTCTGGCTCTGCACTCAGGAATGATTCCTGGTG
GGGCTCGGGGGACCATGCAGGGTGTTGGGGATCGAACTGGGCGGGCTGTGTACAAGGCAA
ACGCCATACCCACTGTACTGTCTCTCTGGCCCCTGATAATGCCTTTTTGAAGGAAAAGGA
ATGGGTAGCTGAGAAAGGCTCCAGGGAAGATTTGGGCCTTGGCAGGGTCTAGAGGAGCAG
GCCTGCTGTGAGGAGGCACAGCGTGAGCGTAGCTCGGAGGCAGGAAATGGCACCAGGGCC
TGTGAGGGGTTGGCAGCTCAGAGGAGTAGGGGGTGGAAGGTGCTTATGGGCACTTCCATG
CAGTTGTGGTGGTTTTCATCTGGCGCATTTGTTAAGTTTTCAAATGGGCCTGACTCTGCC
ACATACATTATAGAGGAGCTGGCAAGGGCTGGAGGACAGAGAGCTCTCTCGAGCCGTTCC
CGTGTCCCCGCTTTGCTCTGACAGACGCTTCTCATAAGTTTAAGTCCTACCGGACAGGCT
ACCCTCAGCCTGTCTGGCTTGAGGAGAATCTGTGCTGAGGGGTGCTTCTTCACCCCTATG
ATGGATTCGATTCCCCTCGGGGGCTCTGTCTCCACCTGACCTCTCTCGACGGTGCACAGT
GAATTCCTCCTTTCTCTAACCGCCCCCCTCCACCCCGAACCAGGTCATCCCAGTACCACT
CAGTTGCTGCAGTACCGATGACATTAAAGATGCCTTCATTACCCAGGCACAGGAGCAGCA
GATGGAGCTGTTGGAGATCCCAGAGCATTCTGACATCAAGCAGGTGAGGCGGAAGTGGGG
GATGAAGTTCCTTCAGATCACACTGAAAAGGGGGCTTCTGGTGTGCAGGGTCTGAGGTCC
TTGACTTCAAGGTCTCCCCAATCTCCAGGTGTTAACACAAGCAGGAGACAGTTTGGAATG
AGAGTATGGGGTATCGGTTAGAAGGAAGATGGCATTAGAGCAGTGCCTTCGTGCTTTCCT
GGGGAAAGTGCTACATTGCCTAAGAAGGAACTAAGAAGGATGGGGTAGGGGTAGGGGGGT
CCTTGTAAGATTTGCCAGTTTTGCTTTTCCACGCTCCATGCGGTTTGGGATCTACTGCTG
TACGCATCCTCTTTTGTTTGTATAGATCCACTTCTAGACGAAGTTAAAGCTTGTGGTGAT
GAACTTGGAGTTTAGATTTCAAGGACTAGTGTATGTTGTCATGTAACTAACTCTGTTTAC
CTCTAGATTGCACAGCCAGGAGCTGCATATTTTTATGTTGAGCTTGACACGGGAGAAAAG
CTTTTCCACAGAATCAAGAAGAACTTTCCTTTGCAATTTGGAAGGTTTGTATTTTATTTT
CAATTTTTGTTACAAAAATTGTTGTTGTTTTGAGTTTTGGAGCCACACCCAGTGGTGCTC
AGAAATGACTCCTGACTGCACTCGGGGATCACTCCTGGTGGTGCTTGGGGGAACATATGG
AGTGCCAAGGATTGAACTTTGAACTTGGGTTCGCCACATGCAAAGCAAGTTCCTTACACA
CTGTATTGTCTTTCAGACCCAAGGATTGTATTTTAAATGTAGTTTTAAATGAAGTTTCTG
AACATGGTTGTGTGTTTCATAGACACATTTGAATAAAAAGCCACATACAACACATTTCTC
CTCAGGGAAAATTACTGGTGTAAGGTTTGAGTGGAGTAAAGGAAAGGGGTTCCAGGAGGA
ATGGAATAGAGGGGTGTCAGGAGTAAGTCCTGAGTACTGCCGGGTTTGGCCAGAAACAAA
GGAAAATCTAGGATACAGCATACAACATGACTGTAGTTTGGTTTTGGTTCATTAATTGGC
CCTTGGTCACACAGTCATCGGTTAAAACCCAGTGCTCTTGGATCCCAAATGTAAGTTTCA
ACTTCATCATTCTGCAGTGTCTGTAGGTTTGGCTTCATTTTCCCGTACCTCTTATAAAAA
AGAATGTGACCACAACATAGAGGGACGGACTGCTGTAGTTAGGCAAACCAAAGACCCAGA
GTTGCTAGCAAGAAAAAAATTGAGTAAATGTTCGGAATTGGGGCTGTAGATGCAGCTCAT
TGGTAGGGAAGATGCCTTCCAAGTGTGAGGCCCTGGGTCAGATCACAGTGAAAGGAAATA
GGAGACAGATGGTCCGAAGCTGGTATCTGATTTTCGGATTTTCAACTATTAGTATAGTGT
TTCCCCCCCACACACCTCACCCCTGGCCCTCTGTTTAAAATGAGCTTTGTGTCAACTTTA
TACCCTCCTTGAACTAATTTGTGATGCCTCCAAGACACCATCACCATTGGTTGTTTGCTG
AGTGAAGCTGCCTACATTTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 4328..4412, 5817..5895, 6791..6892, 8834..9048, 24488..24606, 29475..29559, 32576..32716, 33916..34027, 34918..34997, 36414..36623, 37963..38082, 38526..38621
1001..1023, 4328..4412, 5817..5895, 6791..6892, 8834..9048, 24488..24606, 29475..29559, 32576..32716, 33916..34027, 34918..34997, 36414..36623, 37963..38082, 38526..38621
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved