Sorex_araneus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Sorex_araneus PABPC4
Sorex_araneus
PABPC4
GeneScaffold_919
SNORA55
10689..10821
18114
GCCCATGTGAGTAATAAAGGTGGAAGTATCCACACCTGATTAGTGGAGAGACTTGCATG
TATAGGCAAGTGCTCATCTTGTTCTTACCTTTGTTCTCTAAGCATTTTGGTTCTTTGAGA
GACTTTTTATTTGTACTTCCTTCAATTAAACCCAGGATCTCATATATACAAGACAAGTGT
TCTGTCACTGAAACACATTCCCAGCCCCTTTTATGAAACTTTTGTCTGTGATTTTGCCAC
TTGAAACAAGCATTCCCACTTCTCTCCTTCAGAGACAACTCTGGCTAGCTGAATTTGTAG
TCTGCGATGAACATATAAGTGAAGATGTCATTTCGACTATACTTTTTTGTTTCTCCGGGA
TATATTACCAGACGTGATATTGCTGGATCAAATGGAAGCTCAATTTCTAATTTTTTGTGA
GGTTTCCATATTGTTTTCCAAAGGGGTTGGACCACACTTCTGAGGCCTCTATTTGTCTTG
TGTGATCCCTATAAATCCTCCTTACAGGGCTTGGATGGAGGAAGTGTGGAAGTTTGGAAG
ATGAGTACTGCAACTAGTAGTTTCTTCACAGCGTCAGTGTATGTGGGTGACCTGCACTCA
GATGTTAGCAAGTCCCCTGAAGGTCCAGTGCTATCCATGTGGCTTTACTGTGATTTTACA
TGCTATTGATCCATGTTATTTTTTTATTGGATGTTTGGTCTTAGAGAGGCTATTGGAATA
AAGAATACTCAAACAAATACCCAAATAACACAGGCATTACCCTGGCAGTCCTGCAATGGA
AGCCATCAGGTTGTATTCAAGACTGTTTATTCTACATAGTATAGAAGCTTGTTACCAGGA
ACCTAAGACTCAGAGAAGCAAAAGTACTTGAGACAGGCCTAGATTTTACTATTTTATGTC
AGAGTAGATCCAATCCAAATACCAGATTCCTGTTTTCATTGTGAGAAGTAATTCAAGGAT
AAAACAGTGTATATATGAGAAAAGGACTTTTATTAAGTTTGGGGGCAACATCAGGAAAGC
TCACGGTACTTCTGGCTCTGCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGCAGATAACCGGAGTTTCAATCTTGCTTTCGCCACTTGCTCCTCGGTGACCTTGG
GCTAATCAGTGGTGGCAGTGTCGTTGGAACCCAAGGAGACTGTAAAAGGAGATGAGCGGA
AGTCTCTGTCATTGCACTGTGTGGTCCTGTGCCAGGCGATGTGGCCTCTTGGAGACCCCC
TAACCTGATCAGCTGGGCATGCCTCCAAGGGCTTGAGGGGGTTTTTCCAGCCTATCCAAA
CAGATGGGGCCATAGGAACACAGTTCTGTAGGATTTTCACCGACTACCTGGCAGTCTCTT
TCCAGCCAGCCTTGGACTGAGTTGGTTTAGTTGTGGATTGATCGGGAAGCACCGACTTTG
AGGGTGGGTAGGAAACAGAGGGGACTATCTGCATTAAACTGCCATGGGGACCTGTGTTGG
CACCTCCCACATGGCATGTGCCCAGCCAGCTCCCTGTGCTGCTTGGCCTTGGTGTTCTTT
GCTGGCTCTGAGGAAGCCCAGGGAGAAGGGATCCAGGCCTCATGGGAATTTTCTCCTCCC
TGAGAAGAATGCTTCCCATGTGTCAGAATCTTTTTTGCTTCCATCCGCTGAAGACTCCAG
GACCCGCTGAAGGAAAGGAATTGCTGGCGGGTGGCGGCTGAGCGGGAGCCTGGGCGGCCC
AAGCTTAGAGCCTGGAGAGAGGTATGCTGCAAGAGCAAGGCCAGCAGAAACCTAATCAGC
CATGGCACGTGACTCCAGATTAAAAGGAACAACTGTAGAGATCCTTCCTGGGAGAAGCAA
GCCATTCTGTGGCAAAGGCTCTCTGGGCCCCTATTTTTGTCCCGACTTTGTTCACTGTGA
AGCAGAAGAGTGTCAACTGCTCAGGATGCAGCTGAGAGCAGAGGGTTGGACTTGTTGAGA
GACATGAGGCACTGCAAGAGTTTACTGCTCAGAACTCACCGTGGAGGGCGCAAAGAAGGG
CACCCGGCAAACTTTCCTTAGTGGGGTGAACATCGTCGGTGCTTTGCCTCTTCCCTGCCT
TCCTGGCTCTTGGGAACAAAGATCCTGTCCCTTAGAGACAGGAGCAGAAGCTGTTGGTCA
GTGTGTGCCAGCGCATACCTCTGCAGGACCTCTCCCGGCTATAAATAAGTATGGCCAGAT
TTGTCCCACTTGCCTTCAGCACCATGGTCTGGAAATAGATGGGTGCCGTATGGAAATGGG
CTCCTTTGCTCCACTTTATTGAAGGTTGGGGGTCCCAGAGGCTGTAGGTAGCCCTCCCTG
AAGTCAACTGGCTGGCCTTCGCTTTTGCACCTGTTGTCTTCCCAAGCACCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCCA
CTAGCCCTTCTCACTTTGGTGACGTGTTCTTGCAGCAGGTGGCAGGTGAGGGAACAGTGC
AGATGGAGGCATTCTGCGGTATCACTTCTGAAGTCCTGGAACTTCCTTTTTTTTTTTTTT
TTTGCCATACCTGGTGGTGCTTAGGTGTTCCAGCTCTGGCTTGGTGTTCAGAGGTGCTCC
TGGTAAAACCCTGGCCGCCTGTGGACAAGCACGTGCTCAGCCATTTGAGCTTTCTCAGGC
ACTAAAGTTCTGAAATTTCCTAGGACTTGGGTTCAGCATTCCAGAGGACTCAAAAGAGCT
GGAACCCCCCCAAGTGTAAAGAGGTCTGTGACCTGAGGTGCTTTGACCTTTTTGGTTTGG
TTTGGGGCTGCAGCTGGCTGTGCTCAGGGCTTACTCCTGGCTCTGCACTCAGGCATCACT
CTTGGAAGACTTAGAGGACCATACTGGGTGCCAAGGATCAAACCTGGGGTCAGACACATG
CCAGGGCAAGTGTCCTACCTGCTGTACTATTGCTCCAGTTTCTGGCTTTTATTTCTTTTT
TGTCCTGATAATACCTAGAATATTTCCATGTGACCATTTTGGTAGGACTGGAGCGATAGC
ACAGCGGGTAGGGTGTTCAATCTGGGTTTGATTCCTCCGTCCCTCTCAGAGAGCCTAGCA
AGCTACCAAGAGTATCCCGCCCGCACGGCAGAGCCCGGCAAGCTACCTGTGGCGTATTCA
ATATGGCAGAAACAGTAATAACAAGTCTCACAATGGAGATGTTACTGGTGCCCACTCGAG
CAAATCGATGAACAGTGGGATGACAGTGCTTCGGCAGTGCTACCATTTTGGTAGTCATAC
TTTTTTGTGAGTCTATTTCTGTTTTCAGAAATTGAAACTACAGGTAACTGGAGATAATAC
GCATGTACCAATAAGTTTGCTTATAGGTGCTGGAGTGACAGTACAGTAGGGAAAATGCTT
GTCTAATACACTGCTGACTCAGGTTCAAGCCCCAGGACACCATGTGTTGTCCCGAGCCCT
GCCAGGAGTAATCCTTGAGCACTTCCAGGTCTGGCCCCAAGACCTCCCCAAAAAGTTGCT
TGCAGGTTTCATTTGTCTCCTGGATCTGGAGACTGACTGCTTGGGGTACAACTCCGGGCT
GCAGGGCTGCTCTGCCTGCAGACAGCTGGGGTTCCTTGTTTTTTTCCCTTGGTTTGCTTG
TTTTTGTTTTTGGCCAAACCTAATAGGTGTTCAGGGGTGGCTTTGTGCAGGAGGTCAGGG
TTCGTGGCTTTTTCTTTAGTTTTTTTTTTTTTTTTTTTTTGGCAACACTTAGCAGTGCTC
AGGGCTGTTTCTAGGTCTGCTCAGGAGTGATCCCTTTCCGTGCTCAGGGACCATGTGTGG
TGCCTGTGATTTGACCCAAGGTCAGCTGTATGCAGGTACATACAAGACATGCAGTTTTAA
CTCCTACAGGTTCTGTTCTCCTTATTCCATAGTCCTGCCAGCACTACCAGCACTTAACCC
CACTCTAGAGCTCTAAGCTGGGTGTGATCCAAACAAACCCCTGGCCTTCCCTCAATAGAG
CAAAAAGACAGCTAATTGACCAGCTTTGCAAGATCTGAGAGAAAATTTGTCAGTAGTTTC
TTAGCAGTAACATCAGTTCACGTAAAATGGGTAGTTTCAGCTCTCCCTGAATTGCAGTAG
GTGATGGATTGCAGTCTTGTCAGTAGATCATCCTTCTATCTTTGTACCATGAGACCTTTT
AGATGATAGCTCCTTAACTCCCTCTCCAGGGACCCAGCAGGAAGTAGTAAGTTGGCTGAA
GAATCAGATGCCTTTTTATTTTAGGGTTTTTGGTGGTGTGGTTTTGTTGTTGTTGTTTTT
TAAATCATTGTGAAATTATTGCTTGAAAAGTCCTAGGGTTGGTTCCAGGAGAGTAGCAGT
TTCAAACTAGCTGATGTTTCCTATCTCTGACTGAAATGCTTATTTCTCTCTTGCAGCTGA
GCGGGCCTTGGACACCATGAACTTCGATGTGATTAAAGGAAAACCAATTCGTATCATGTG
GTCTCAGAGGGATCCCTCTTTGAGGAAGTCTGGTGTGGGGAATGTCTTCATTAAGAACCT
GGATAAATCTATAGATAACAAGGCACTTTATGACACTTTTTCTGCTTTTGGAAACATTCT
GTCCTGTAAGGTAAATGTTGAACTAAGTGATTTCAGCATAATATTGGAATCCTGAAATCA
GGATAAATAGCAAATATGAAAGTTGTGGAATTGGGCAGGAGGGTAATTATTGAAGCCCCA
GGGTGACTCTGAAATCTAAAAGTTTGCTATAGATAATCTTGGCTCAACTTAGCAGAACCA
GTGAGGTGTTTTGTTCTTCCCTTTGCCTGAAATATCCTTCCTGTTTCTTGCTGAGGCTTC
TGGAGGTTGGAGTCCGTCTGATCTCCAGGCATTGACATATGTAATTTGATGCTAGAATGA
AGTCCTGTTGCCTTTGGGAGTTCTGTTGGGTTCTTTTTTGTGGCGCTGGTTTTGCACTCA
AGTCTGTAAATGCTTGTTGCTTTAAAAAAAAAAAAAGTGCTGCTGGGGATTGAACCAGGG
CCTAACTTACAAGGCAAGTGCTCTCCCACTGAGCTATATTACTGGCCCTAGATTTGTTTT
CCTCCTGGTTTGGGGTGTTACCTGATAGAGCTGTGGGGTTGCTCCTGGTAGGACTTAGGG
GACATGCACTACCAGGGGTCCCACATGCAAAACATCTTCCTAGTCCTCCAAATAAATGTG
CTGTTTTTTGTCTGGGGGCGGGCCTCCCAAGCAGTGCTCAGAGAGGCCCAGGGGCCATTC
CCAGGCCAATGAGGCCACATGGTTCAGTGCTAGAGCCTGAACTGCTCAGGCAGTGCTGGA
TGCACAGCATTGCGCCCTGACCACTGAGCTCTCCCTGTTCTCCCTCAAAGTGTCTTGGTG
AGAGGAAACATTCAGAATAGACAGGGGCTGTCATTTGTAAATGGGACATATCTGGGGGCC
AGGTGCTGGTCCTTGAGTGGGTGGTACTGATGCAGTGGCCTGTCTTGCTTTTGACAGGTG
GTGTGTGATGAGAACGGATCTAAGGGATATGCCTTTGTTCACTTCGAGACCCAAGAGGCT
GCCGACAAGGCTATCGAGAAGATGAATGGCATGCTTCTCAATGACCGCAAAGTGTGAGTG
TCCCAGTCCGGAGCGACAGCCATCGCATGAGCCAGCTGTGGCCCCACCTCGGTATTAACT
GGCACACACAAGGCGGCTACTGGTTCTCTCGGCCCAAGTGTGGCCTGCTCCTACCTCTCC
ACTCCAGGGCTGGTGAGTCTCCCTGCCTGAGCCACGGCAGCCCTTTAGACTCGCCAAGGT
GGGCTTTCTGCCCAGGCCATGGCCTGCCTGCCGCCTCTCCTTTAAAAGCCTTCATCTGTG
GGTTTGAGCATGACACTGGGGCTGGCTGCAAGGCAGCTCCCGCCCACTCTGAGCAGGGAT
CTGGCCAGCGGCAGAGTGGAGAGGGACCTGGACTGACCAGGAGCAAGCTAGCTGTGTGAC
CGTGGCTTCCCTGGGATTCTAGGGTCTAGGGGCCACTTGGTAATGGATGACACCAAATTG
TCCCCAAATCTCCACTAATTCACTCAGCGGTCTTCTAATAAAGGCTGGCTCCAGAGTTTG
GTTACAGTGAAGTGCCTGTGTCACAGGTACTTGAGGTTCAGGATTGACTTGTTGCTTTGG
TGTGGTTCTCTGGTGTGTGCAGGACACAGAGGGGGACCATAGTGGTGCTGTTCAGGAAGA
GGGAAAAGGAGTAAATCTTAGCTACAGGGCAGAAGCCATAGTACAGCAGGTAGGGCGCTT
GCCTTGCATGCGCTGACCTGGCTTCTATCCCCGACATCCCATACAGTCCCCTGAGCACCC
CCTTAAAAAAGGTCTTAACTATAGGTCACTGACCAGATGATGGGGTGTGTTGGCACCCAT
GACTTGTGCATCATGCTCTGTGGTCGGCTCCCTCAGGGTTTGCGAGAACGGAATGAGGAA
CTTTCTAGTATGCCAGTGTGCACAATGAGCAGAGGGGAGAAGACGCAGGCACCTCCTGGT
CGACTCCAACTGTTGCTGCTGGGGCTAACTACTGTTAACAGTGTGGTTTGTGTCCTTCCA
GACCTTTTCTGTGCGTTTACATAGATGCACAGAACTGGACGTTTTAGCGCACGGTCACCA
GGCTTCTCCCAGAGGCAGTGTGATGTGGTAGGAGGAGCCCCGGGCCGACATCTCAGTCCT
TCTCTCTGCTCGGGAGTCTCTGAACTTGCTTTGTGGGGGACAGAGTGGGACTCCTTGGAG
CATACCCTCTCCTGACACCCTTTAACCTGCGTACCCTTGGGCCTCAGGCATACTGTTTCT
TCCTCTAAGTGATTCTGGGTATTTGGGGTCTTTTTGTTTTTTGTTTTATTTTTTTGGTTT
CCTTTTAGGTTTGTAGGCAGATTCAAATCTCGAAAAGAGCGCGAAGCTAAAACTTGGAGC
CAAGGGCAAGGAATTCACCAATGTTTATCTGCCTAACTTTGGGGAAGAGACCCGTTATGA
GAGACTGAAAGAGCGATTTAGCCAGTTTGGTGAGCTGACTTCATTTGCCAGAATTTCTTC
TGCCGAGCCTCTTCCCCTCCCCCCCTCAGACTAAACATGCTTCAAGTTCCCCAGGTTAAC
AGTCTTGTTTATAAAACTGATCCCATTTGCCTTTGAAGGCCCATTTTCTATCAACTTTCC
TGTCCTTCAACTCTCCTTTAGATCCACTGGACGCGATGCAATGCCTTTGCTTAAAGTAGC
ATTATAAACACATATGAATAAGTCTCTGAAGGAAACTCTGTGGTGACTCCGCTATTTCTT
GAGAGGCTGTATGGGTCGCCTTTTATACCCTGCTCTTCTCAGAAGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGGATATTGGGGTCTTTTGTTTTTGTTTTATTTT
TTGGTTTCCTTTAAGTTGGTAGGCAGATCCAAATCTCGAAAAGAGCGCGAAGCAAGAACT
GGCGCCAAGGCCCAAGGAATTCACCAATGTTTATATCAAAAACTTTGGGGAAGAGGTGGA
TGATGAGAGTCTGAAAGAGCTATTTAGCCCAGTTTGGTAAGTTGGGGTCCTTTTCCCCAA
ATATTCATTCCCCTCCTCTTCCCCCCCCCCCCCACATATACCAGTTCTGCAACTGATCGA
GGCTGACCTGTTAGAGAGACAGAAGTAAATTAGTTGGTGTGGTCAAGGGCACAGGGCAGA
TAGGAATAGACTCCAGTCTTAGGGCGTGGCTTCACCTGCCTTGTCCCATGCCCACAGCCA
TCATGCGGCAGTGTGGTCAGAATTAGAAAGCCCAGAAGCCCAGACCTGTGGTACCCCCTT
TCTTAAGAGAGAGTCCATATGGGTCCACAAGTAAGGGATTTTCTTCCAGTAAGCCTCTTG
AGGCAGTCTCCCTCCTGAGCTGTGGTGGAGATGGTGTTACTAATAGTTCTGTCCTTTGGT
AATAGGTAAGACCCTAAGTGTCAAGGTGATGAGAGATCCCAGTGGGAAATCCAAAGGCTT
TGGCTTTGTGAGTTACGAAAAACACGAGGATGCCAATAAGGTGAGAGTACCACGAGGGTC
GGGGACCATTGGTAGGCAGTGGCCCCCGAGCGTGGGCAGGGCCTTGCCGGTCAGAGTGGA
GCAGACCTGGAGCTGTGGGCCGTGCACACTTCTGCACTCTGCACGCGTTCCCTTGGTTGT
TCATAACACGGCACATACCTGCCACCTCTGCTTGCTCAGCTCTGTAGGTTGAAAGAGCAA
GGCAGATGTTCACATTCAGAAATGATGAAGGCCCGAGGGTTGCTGATGGAACAGCGAAGC
AGCTCCCCAACGTCTGCGACTTTAATTACCCACAGGAACCTGGGGGAGTTAGTGACAGCC
GAGTACGAACCTAGGTTCACACCCAGCTTGCTTGAAAATCACCCCACTCTACTTCCGCCT
GACCCCTGTGTTATCTGGATCAATAACCCATTGAAATACTGTCCCTATTTTACAGATGAT
TGCTTAGTAGACGCAGGATGAAATTAGTCTTGACCCTGTGTAGGACAGTTCTGTTCAGAC
TATTTGGTGGGACTTAGAGATTTCCAGAGCAAGGCCCCTGCTTGGCATCTTGGTTTCAAG
ACATGTGTTTTCCTCTTTAGGCTGTGGAAGAGATGAATGGAAAAGAAATCAGTGGCAAAG
CCATATTTGTAGGCCGTGCACAAAAGAAAGTGGAACGGCAGGCTGAGTTAAAACGGAAAT
TTGAACAGCTGAAACAAGAGAGAATTAGTCGGTATCAGGTGAGAAGTGGTTTTTAACAGG
CCTCTCCAGCAGGGTTTCGTAGATAAGTGTATGGTCCCGGAAGTTCAGCAGGCTCAGGCC
AGATGTTGGCACAAAGGCCTCAGGTATAGCTGCATGCAGATGCTCCAGTTTCCACCCCTG
GCGCTAACTCAGTGGTACCCCAGCCCTGCTCGAGCATCTCACTGGGTGGAGTCCAAAAAG
AACAAAAAGTTCATTGGGCCTCGGAGGCAGCTGCTTGGTCATTTCTTCTTGAAGGTCAGA
TCACAGCAGTCATAGGGCCAGAGAAGTACTGCGAAAGTTATGATGCTTACCTAGCGTATG
ATATGGCCATGGTGGCGTGACCCTGGTTCAAATCCCAATGCTGTAGAAGGTCCCTCCTCC
CCATTCCTCCCCCAGCACCTCAAGGTGTGGCCCAGAAACATGAAATTAGCATGGGAGAGG
TTTAGAGACTTTTCTGGAAGCCTCTGCTGGTTCTCTGCGTTCCTTTGTCTTATGTGTTAC
TGGTAACCTTGAGCTTGGAACAGGACAAAAAATGTGCTGCTGGTCCAGCGGTTCTGCCCA
GGTGGCTGATGGCGGGAGAGCAGAGACCTATGTCGATGCTGTTCTCTCGGAGCCAGGGCT
ATTACTTCCCACCTTGGAGCCTGTGCCAGGAATGTCTACTGGGCTGGTTCCCACAGATTG
CTGAGCTTTTCTGACCCGTTAGATCTAGGGTTAGGCCTAAGGATGTACATTTCTGACAAA
TAGAGATACTGAGTCCGCCAGTCTACATCCACACTTTGAGAATCCCTGTCTTTAAGGAAT
CGATGAGGCATGGACGTGTAATTAATACCCTTGTATTTCAGGGGGTCAATCTGTACATTA
AGAACTTGGATGACACCATTGATGATGAAAAGTTACGGAAAGAGTTTTCTCCCTTTGGAT
CCATCACCAGTGCAAAGGTACTACCTGCTGAGATGTGGGGGGTTGAAAGCGGTAGTGGTG
TCCTCCTGAGGAGTGTTAGCCTTTGTTGTGTTGGAATGGAATCTGTGTGGTTTGTCTTGG
CCCTTTCTGAGAGGTCACCCTTACTCCTGGCCCCTGGTTAATTAGCCTCAGGCACATCTT
GCTGCCTGTGACCCAGCCACTTCCCAAAGCACCTGAATCTTTCCCATTCCTGCTGCTTCA
TGCTGGCGTGGGGACAGATGGTGCAACAGTACAAGCAGAGTAAATCCAGACGGGTCGTTT
CCATTTTTCTTGGGGCTTGTCTCTACAGCTCTGCCATACTTTGTCCTTGAAGAGAAATGT
TTTGAGGATTTTAGAAGGGTCGGGGGCCACTGGTCTTGGAAGAAAGAACAGGGGCTGGAG
CTATAGTACAGCGGGTAGGGCGTTTGCCTTGCACATGGTCCACCCAGGTTCAGTCCCTGG
CGTCCCATATGGTCCCCTGAGCATCACAGGTTGTGACCCAAAAAGCCCAAAAAAAAAAAA
AAAAAGGAAAGGAAAGAACAGAAAGTTTGTTTTTCCATGTATGCAGTGTGCGTCATTTGA
TTGATTTCTTTTGCTAATCATATCAATGGAATTAGGGTACGTTTGAACCCCATTTTCAAG
ATAAAGAATTTGAGTCCTTGAACAAAAGAACACTGCTTACGTGGGAAGGGGGAGGGGGAG
CTGTGTCTGTCCTTGGCACTTAACATTATGATGGTCATTGATGGCATCTGATGTGAGCCT
GGGTGCCATCCCGCTTGCACATACTGTTCCTGAGACCGCCCTTCCTTCCGGGGGACGGGA
TCCAGCGTCACCCTGGGGTGGTAGAGAAGTGCCCTTAGGCCTTCCTGTGAGGTTAACATG
CCTCACTCCCTTCCCCTTTCTGTTAGCTCCCCTGACTGGCAGCCGTCATGTGTGCAGGGA
TGTGCCTCACAGCTTTATAGTAGGCTGACACTTGAAAGAAGAACCCAAGAGTCTTAAGTT
TTGTAGATACCAATTCCAGGTCACAGGGTCACATTCTTTTGTCACCCTTAACCTTATTGG
CCCCCACTGCATCTGTGAGAACTGTGGGTTTGAAATAGCTTCACTGCACCTTCTCTGCTT
CGGGAGGAAGCTCTCAAGGCAGTGAGCAAGGCAGCACAGTGCCACCTGGTCCCAGCCCCA
GAGCCGCTAGGCGGGCTGGGGAGCAGTGATGGACCTTTGCAGGTGAAGCCAAAAGCCATC
GAGTGTTTTTTAATTTCAGGCTCCTAGAACATGAGACATTCTCCTGAGATGCCTCTAATA
ATTTTTTTTTAATTTATTTTGGGTAACCTGGTTTACAATATTATTAATGACATTGTTTTG
TTGCATAGCATGATCCCTTACATACCCACAGCCCAGAGTGACCAGTTCCCTCAGCCATTA
CCCTAGTGTCTTGCACCCCCACCGCTCACTGCTTTCTGCCCCTCATGTGAGAAAGCTCAC
TCTGTGTCTCTCTCTGTCCTTCACTTAGCCTGATGCCCTCTGCTTCCATCCATGTAGCAG
CAAATTTTATAAACCCATCTTTTTTTAAAAAATTATTTATTTTATAAGTTATTTCACAAT
ATTTGATTACAATTAATACTCACACCAATCCCACCACTAAATTTGGATGTTTCCATCCCA
AGCCCCAAGCCCTATCCCAAAGCACAACCAAAAGAATGTATTTTGTATTGTTTGTTATGA
AGAGCTGCTGAACATGCTTACAAAAGAGTGTTCATATAGAAAACAGTGTGAAGATTGTTC
TATTTCGGCGGGAACCATTAAGACATTCTATAGGATATCACTAACATGTTAAATTTTGGG
TGATGTGAGCTTTGGTATATATGTATGAAAATATGTATAGGCATATATATATATACACAT
ATATGTTTCCCTCTATAACTTGTTGCCTACTATATGAGCCCCATCAAATATGGTGTGGTA
ATTATGGAAAATGAGTAGGGAGTGTCTTATGATGTGTCGCACGGCCGCGAAGGTCAGGAA
TATGTTCACTCATAATTTGAAGCTCCGCCCAAGCGTGTGGAAAGTGGCCTGGAGCGTGGC
GCCAGTGGGTTGTGGGGGTCGGCTGGCGGGGCTGGGTCCTTTGGGGCGGGGAGGGCTCTC
ACCTGCCCCCCTCTGGGGCGCCCTGAGTGAAAACAGCCTGGTGCAGAGTCCGGTGGCATG
GTTATGGGGGCCTCATTTTATGCTCCCTTCCAGGAGAAGCAGCCGTGAGTTCTGGACGGT
GGCCAATGACGAGACTATCTGGCACTGGCAGGAGGTGGCTTTAAGCCCATCTTTTCTTGT
AGCTCAGTAGTATTCCATTGAACATATGTGTCATGGTTTCTTTATCTGGTCATGGACAGT
TGGGTTATTTCCAGATTGTTGGCTGTTGTGAGCAGTGCTGCTGGGTGCAATGGGCATAGG
AGTGCAGTTGTGTGGGTTTTTATTGTATTTTTTTATTAATTCACCCATGAGATACAGTAG
TACAAATTTCATGTTTGAACTTCAATCATACGGTCATCCAACACCCATCCCTTTTCCAGT
GCACATTTTCCACCACCAAAATCCCCAGTATTCCCCCACCCCCACTTTCCATACCTCCCC
CTGCTTGTGTTACCTTCAATATTTCGAGACCACTCCTGCCTCCCCTTATATCTGCTGAAA
ATACAATTGCTAGGCAATGTGTTTCGTATTGCCTGTTATGGATATAATATAATGTCGCTT
TAGGAATTCTAAGATTTTAATAATTAGGGTCTGAAGAAATTGCTGCCGCAGGTTGCTCGT
GTCCGAGATTCCTGTGTGTGTCTCTGGATTGTGGCCATGTGGGAGCTGGTGCTTCTTGCT
GGCTTCTAGAAATTGGTGACTGCTGGAGGTCTTAGAGTGCAGCGGTGGGACGGCACCTAC
CCCCGTCTGGAGCGGCCCAGCGGAGAAGGCCTATTGCAAAGCCCTGGGCCATCTCTGCTG
CAAGAAGTTGTTCGGGTCGGAGATTTCTGTGTGTTCTGCAGTTGAGTAGGGGCTGTTGAG
ACTTGGCAGGCGCGCGTGCGCATGTGTGCGTGCATACGTGGGTGTGTGTGTGTTGGTTCA
GGTCATCCAGCCCAGATACAGCTGGGCTGGGCTGCTGCTGCTCTCCCAGCTGGTTGTCTG
TTGTCAGTGAATGAATGATGGAACTATTGGGAGTTTGTAACTCCTTATTTCAAAAGCATG
TTCTGCCAGACCAGTTTTGTTTGCCAAGTTCTTAGGTAGATGAATTCCACAAATACATTG
CCTTTCGCTCTTAGCTATTTCTTTCCGGGACCTTCTGGCTATCCTCCTTAAGGTCCTGGT
TGAACCTTTAGCAGTGTCTGCAAGCTAGGATCACTGGGTTCTGATCACAGGTAAACATCC
AGCTCTGCCCCCAGGTGGTAAGTTAATTGGTCTGGAAGATCCATCTAGGACAGGGCTGAG
AACCCTTGACTTGGCTTTCCATAGCAGATAGAACCTACGGTTCGAGTCATAGCAGTTGCC
CCTCCCCACACAAGCACCTTGTTCTGAACTAGCTGCATTTGTTTCCCAGGTAATGCTGGA
GGATGGGAGAAGCAAAGGGTTTGGCTTTGTCTGCTTCTCCTCTCCTGAAGAGGCAACCAA
AGCAGTCACTGAGATGAACGGCCGCATCGTGGGCTCTAAGCCCCTGTATGTGGCGCTGGC
CCAGAGGAAGGAGGAGAGGAAGGCTCACTTGACCAACCAGTACATGCAGCGGGTGGCTGG
CATGAGGGCGCTTCCTGCCAATGCCATCTTGAACCAGTTCCAGCCTGCAGCTGGGGGCTA
CTTTGTGCCAGCTGTTCCACAGGTGGGTCTGCCCTTTGGAACTTACCCACTAGCAGCCGG
TCTGGGGAGGGGAACTTCGTTGGACATTGGAGGGCTAGGGCTAGGGTGATGCCGAGAATA
GTTGAGGAGGCATGAGGATGGGCCGGCTCTTGTTCTCAAGTGCAGCGACAGGGGTAGAGT
CCCCAGCAGAGGCTGCAGAGAGAGTCCAGTACAGCCGGTGAGGTGCTGGCCTTGCCCGCG
CTGTCCCAGGTTCCATCCCTGGGAAACAATCCTTAGTGGGGCTGGAAAGACAGCACGGTG
GTTGACATACTTGCCTTGCATGTAGTGCACTGGGGTTTGACCTGGAAGTATAAATGTCCC
ACTGTGTGGTCCCAAACTCCACCATTGAAGGGTGGAGGTGCTAGAGACATGGTTTAGGAA
GTAAGCCACTTGTTTTTCATGTGGCTGCGACCGTAATTCAGTCTCTGACACCACACGTGG
TCCCCTGAGCACAGCAAGGAACAGGCCCTGACGCACGACCCTTCCCTTCACCTTCTGAGC
CAAGTGACCCTCCAGCCCAGCCGGGAGACAGGCTGCTTTCCTAGTGTGGCGCAGGTCCTT
CAATGCTGAAAGGGCTTGGGTGTTCTTCCGGCAGGCTCAGGGGAGACCTCCGTATTACAC
GCCTAACCAGCTGGCACAGATGAGGCCTAACCCACGCTGGCAGCAAGGTGGGCGACCTCA
AGGTAGGTGGTGGGGAGCGACGGCCTGTGCAGGCCAGGGTTGAGGGACCCGCCCGCTCTC
CCCTGCCTTCCCTGCTTGGCGCGCAGCCCCGGTGCCAGTCCTCGTCCCTCACCACTGACG
TTTGATCTCTGTCTCGTCACCAGGCTTCCAGGGCATGCCAAGCGCTATACGCCAGTCTGG
GCCTCGTCCAACTCTTCGCCACCTGGCTCCAACTGGTAATGCTCCGGCCTCTCGTGGCCT
CCCTACTACCGCTCAGAGAGTCGGTGAGCAAACTGGCCTTGAGAACCGTGACTCAGGGAA
GCGAGGGCTCAGGATGCTGTCTAGGCCCGCCCAGGGCTGACCCGCTTGCTGTGCGCTTGT
TCTTCAGTCTTGGCGCTCCAGTCTTAGCTGTGCATGTAGAGAGGTACCGAAGGTGCAGAG
GCGCAGCAGTGAGGCCTGAGAGTGCTGGTGACTCCCTAAGGTGCTTTGCTCATCCGTGAC
TCGTGAGACTGTTCACTAATAGGAGTTTGTTAGCTGACTGACCACACAGGCATCTCCTGG
GTATGCTTAGAGATCCACGGGAGCTTTCTTAAGAGCGTGTCCTCTATCCTGAGAGGCGGG
AAGGAGTTGTATCTTCTTCGTTGGCACTTTCTGGAAAGTAATTCTAGTGGCCCCATGTAT
TATGTCTTGTGTTAACATGCTTTGGAATTCCTCCTTTCCGTGGGGACGTGGCCCAGTCGG
ACCTCTGCTGCCCAACACTGATGTGCATTTCTGGTCTGTTGTAGGGTCTGAGTGCCCCGG
ACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCGCCCAGCAAGGGCTGACTGACAGCT
GCCAGTCTGGAGGTGGTATTGGATGCACAGAATGGGGAAAGAGGGAATTAACGGGCCTTT
GCCCAGACTGACGGGCTTTAATTCTGCTCTTCTTCTCCCAAGGCGTTCCCACGGCTGTGC
AGAACTTAGCGCCCCGTGCTGCCGTCGCTGCCTCTGCCCCTCGAGCCGTCACACCCTACA
AATACGCTTCCAGCGTCCGCAGTCCCCACCCTGCCCTACAGCCCTTGCAGGTGAGCATCA
GGAGATGCCTTGCATGGATTCCTTGGACCGCTGCTAGGGGCCTGCTGTGAGAGTGTGTTG
TCTTGTGGGACAGTGCCTGAGAGGAGTCTGGGAGCTGCCCAGCACACGGTTGCAGCCAGC
CCGCGTTCTCCCATCCGCTACTCACATGGCTCACTTTCTAGCTGCTCTGCTCCACCATCA
GTGAAAGCGGGAAAGAGCATTTTGCCGAGAACTGCAGCTTTAATATGAAGTTGGAGAGAA
TTTCCTCATTTTTTAGGCTGGCACTTGCTGTCTTTGGAGTGCATGACCCTGGTGCCTCAG
GCCATCTGAGGGACAGCTAGCTTGTTCCTGCTCTCAGCCACGGGCTGCAGAGGAGCCACA
CTGTGCCCAGGGGCCTTGAGCTGCTGGACATTTCTCAGACCTTCTGCTCTGTGTAGTGTT
TACCTGCAGAAGCCTTGCCGAGGCTGGCCTTGATGTTGCTCCTTCACAATCCCTGAGCTT
TCGGTACAAGATAACTGTGTAACATAATGAGAGCAAGTTTGATAGCCGCAGCCTGTGACC
TGTTCTCTGCTGGAGCTCATCTGAAAGGAGCGCATTTCAGGAAGAGGCTCGGCAGGCTGG
TGTTCCCTCCTGCACTGGGTTAGAGAGGCGCCGGGTTCCTGCCTAACCCTGTGTGGGTTT
CCATGATTACCCCAAGCAGTTGTGCCTCGCCTGGTATCTGGCAGCCCAGCATCAGACGTT
TGTTTCCTTACATTCCTGTCTCCTTCCCCAGGCGCCCCAGCCTGCTGTGCACGTGCAGGG
CCAGGAGCCGCTCACGGCCTCCATGCTGGCTGCAGCTCCTCCCCAGGAGCAGAAACAGAT
GCTGGGTGAGTTGACCTGCTCGCTCATCAAGAAGCGGCTGGAGCCCGGTATTTATTGGGA
CCCATCAGTCCATTCTCACGGCTCCGTTTGGAATGTTTTCTGGGTCTTTATATTTTGTTT
TCTGGTCATTCCTGGTGGGGACCGTGTGCTGCTGGGGCTAGAGCCAGCTGGGTTCAGCCC
ATTGAGCTCTCAGCACTCGCTGGGTTCTGCAGGAGAACGTCTGTTCCGCTCATCCAGACG
ATGCACTCAAACCTGGCGGGCAAGATCACGGGCATGCTGCTGGAGATCGACAACTCGGAA
CTGCTGCATATGCTGGAGTCGCCCGAGTCCCTCCGCTCCAAGGTGAGCTGCTTCCGGGCA
CCTCCAGTGTCTTCAGGCCTCACCTGGGACTTGACCCCAGGGATGCCTGTGTTTGGGGAA
ACAATAGCGGGACCCTCCATCCCTTTCTGGGCTGGGCTGGGCTGGGCAGCAGGGGTCGGG
AGTTGGGGGCGGTCTCCTCAGGTCACTGACTCTCACGCCCCACAGGTGGATGAAGCTGTG
GCAGTTCTCCAGGCCCATCATGCCAAGAAAGAAGCTGCCCAGAAGGTGGGCGCTGTGGCT
GCTGCTACCTCCTAGGCCAAGAAACACCGTAGGTGACATTTCCGCTCTCCTGCTGTGGTT
TGGACGGGGGGGGGAGGGGGGACTTTTCCTAAAAGATTAGGGGTTGCCAGTTGGGTTTTT
GTCAGCTGGATGAGTTCATGTGGAGAAAAACAGGGAATGAGTTTTCAGGAGCAAACGATA
ATTTTCTGCAGAGCACCTGGTTAGCTCTTGTCTCAAGAGTCACCATGTTGGCCTGGTCTG
ACGACCAAGGACATGCATGGCCTCTCAGATTCCTCAGCGTCCTATGGTTGGGCCTGAGGC
TAAGGCTGTGCTCTGTGGCAGCTCCCTAGTTCAGGACCCAGTAGGTCCCAGATTCATGTC
CACGTGGAAGGCAATGACACGCCTGACTAGTGACATGGATTATTTCAGTAGACGCAGAGA
CCTTTGTGGGTCAGTCTTCGAGGACAGGCCCCAGTGCCCAGACCAGAAATAATCCTGCCC
GCCAGTGTCTGCTCTCCAGCACCCACCGTGCCAGGGCTTGCAGTGACTCGGAAGGTTTTT
CCACTTACGTGTTTGTGTTGGTGTTTTTCAGGATTCAAAAGCCAAATAACCCCTCACGGA
ATTCAGCTTAAGTTTTGAAGACTTCCTAAGCTCGTCCTATGGACCTCAATGCCGAGAACC
ACAGTTACCAATTTCATAGGTCATTTTGTATCAAAAGGTCAAATATGAAGCGCCTAGAAT
TTTTCAATTAAAGAATATATTTTCTGGGTTCCGTTCTGACCCAGATAGTGTTAGTTTTTT
TTTTTCTATTGTGGGTTTTGATTTCTTCCCCAGAAATTGGTTTTATTTGATGTAACCAAG
TCTTAAGTTTCTCAATAAAGAAAAAAAAAAACCTCCATAAAACTGCCTCTGTTTAAACTC
TGTATTTTTGTTTGTTTTTGCTTTTGCTTTTGGGGTCATGTTCAGTGTTACTTCTGATTT
ACTACCAGGGATTACTACTGGTATTGCTGAGGTGACCATATGGGGTGCCAGAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1114, 5139..5330, 6218..6333, 8215..8272, 8274..8349, 8351..8356, 8746..8840, 9421..9558, 10402..10497, 14070..14342, 14955..15042, 15184..15303, 15805..15814, 15816..15892, 15983..16110, 16872..16965, 17173..17183, 17186..17302, 17486..17575
1001..1114, 5139..5330, 6218..6333, 8215..8272, 8274..8349, 8351..8356, 8746..8840, 9421..9558, 10402..10497, 14070..14342, 14955..15042, 15184..15303, 15805..15814, 15816..15892, 15983..16110, 16872..16965, 17173..17183, 17186..17302, 17486..17572
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved