Sorex_araneus Locus EP400
snOPY snoRNA Orthological Gene Database
Sorex_araneus EP400
Sorex_araneus
EP400
GeneScaffold_6015
SNORA49
44403..44530
68631
GTGTTTTGGGAACACTCCCGATGATGCTCAGGGCTTACTCTTGACTCTGTCCTCAGGGA
TCAACCATTTGGGGGTGACGTGGAAAGACCCCAGGTCAGTGATATGCAGGGCTTTTTGTC
TTTCTCTCCCACTGTCCTTTTCTCTTGGACCCCACTGTCTTTCTGGCTTTGCCTTCCTCC
ACATTCTCTAGTCCTGGGGCTCTTGCAGTTTGGGGTAGGAGCTCCTTTGTTTGAAGCAGT
GGTGACTCTCCAGGGACCCTCTGAGGGTTTGTTTCTGGCTGTTTCTCTTCTTTCCCCATG
AGATCTTGAGATCCCTGGATACATACAAAGGATGCCAGTGAGCAGCCACTTGCCACTGCA
GCTCTTCACCTGCTTTCCTCCCTGGGGAGGCAGACCATCTCACCCATGCCTGTGTTCCTC
CTTTGCAGCATGATTGCCAAGTGATGAGCTCAAGAGTTGATTTGATTTGCACAGGGTTTC
TGTAGCCGGTGTAGCCAGGTGTTTCTCAGAACTGCAGGCTGCTGAGGAATGTGAGGTTCT
GCTTTGAAGATACCTGGCCGCGTCGGCACTGCTTCCTGGTACCGTACTTCAGCTGTGATA
GGCAGACAGCAGCCCCTCCGCATCCCAGAACATAGATAAATGAAGAGGAGCTGCATTGTG
TTGCTGGTGCCAAGGCCCTGTGTGGCTCTTGAATCCAGTAGCATGAGGTCACTGTGCACT
AGCGGAGCCCTTTGGCCAGGCTGCGTCCTGCTCCCGGGCCAGCAGTGGCCATGAGGGCCA
TGAGGTTCAGTCTTCCAAGGAGATAGCTCATGGGTTGTCTCCTCCCTGGCATACCAGGTG
TTAACCGAATGTATTTGAAGTAATGCCAGTGGAAAAACGTGCCTTCAGATAACCTCTCGA
GGGCAGTGAGAATCGAAAGCTTATATTTGCCTTTAAGTAACTTGATCTTAACTTTGATTT
TTCAGGAGAACATTTAAGTTGGATTAAAAAGGGGGGCAATAATGCACCATGGCAGCGGCC
CTCAGAGTGTCCCTCATCAGCTGCAGAGGGCCAGGACCTTCGCGGGCAGTGAGGAAGAGC
AGCAGGCCCATCCAATGCCAGCCCAGTCCCCCGCCACACCTTTTGCACCATCAGCGAGCC
CCTCCGCACCCCAGTCCCCCACGTACCAAGTCCAGCAGCTGATGAACAGAAGCCCCGTGG
CTGGGCAGAATGTGAATATCACCCTTCAGAACGTTGGCCCGGTTGTGGGCGGAAACCCCC
AGATTGCACTCGCTCCCCTGCCTCTTCCCAACCCCACTTCTCCAGGGTTTCAGTTCAGCG
GGCAGCAGAAGCGCTTTGAGCATGGATCACCGTCATATATCCAGGTCACTTCGCCACTGC
CCCAGCAGGTGCAGACTCAGAGCCCCACCCAGCCTGCTCCCGGGCCCGGCCCGGGCCTTC
AGAGTGTGCGGGCTGGGGCCCCAGGCCCGGGCCTGGGCCTGTGCAGCAGCAGCCCGACTG
GGGGCTTTGTGGACGCCAGTGTGCTGGTGAGACAGATCAGCCTGAGCCCATCTGGCAGCG
GGCACTTTGTGTTCCAGGAGGGCTCAGGCCGTGCCCAGGTGACTCAGGGAGCCCAGGTCC
AGCTGCAGCACACAGGGACTTCCATTGCGGTCAGGGAACGGAGACTCTCCCAACCCCACG
CCCAGTCTGGAGGGACTGTCCATCATCTGGGACCCCAAAGCCCTGCTGCTGGTGGTGGGG
CCACACTGCAGCCCCTGGCCAGCCCCAGCCACATCACCACCGCCAGCCTGCCGCCTCAAA
TCAGCAGCATCATCCAGGGGCAGCTGATTCAGCAGCAGCAGGTGCTGCAGGGACCATCGT
TGACCAGACCGCTGATGCCTGGGGTCGGGGGCGCTGCTGCATTTGGGATGACGTCCCCCC
CACCCCCCACCAGCCCTTCCCGGACTACGGTGCCTCCAGGCCTTTGCAGTCTCCCTCTCA
CATCTGCGGGGAGTGCAGGGGCAAGAAAGGCTCCTAAGAAACTAGAGGAGATCCCCCCAG
CCTCCCAGGAGCTGGCTCAGATGAGGAAGCAGTGTCTGGACTATCACCACAAGGAGATGG
AGCTACTCAGGGAGGCCTTCAAGGAGTACCTGATCGAACTCTTCTTCCTGCAACACCTGC
AAGGGAACATGATGGATTTCTTAGCATTCAAGAAGAAGCATTATGCCCCACTCCAAGCTT
ATCTTAGGCAGAATGATTTGGACCTGGAGGAGGAAGAGGAGGAGGAAGAAGAGGAAGAAA
AGGCTGAGGTCATCAATGATGAGGTGAGCAGCGGTGGCTGAAACCTGTGTTCCACAGATC
TGAGTAGAGGCTGTGGTAAATAAAAGTCATCTGCCAGTTTTAAGTGGTTGTTACAGTCTG
GATGTGGCTTCATAAAGATTTACATTCGAGAAGTAAAACTGAAGATGTACTTTGCTTTTT
TCCTTCATGGAAGGGGAAGAGCTGTTCCAGGTGTTGGGAGGAAGGTCCCGAAGAATCTGT
GAGTAATGCTGATCCAGAACCACGTGCTTCTATTTAGAACAGGGTTTTTCTGGGCTTCAG
AGGACTCCCTGGCGTGACCCTGCCCTGCCCACAGGTTGGGTATTGGGAATGTGGGTTCTA
GCTGAAACCAAAAGGCCTGCGCCAGCCACGGTGCTGCATGCCGTGTGGCTGGTTTTCCAG
TTGCTCCCTCTCTTAGGGCCCTAGCCATGGTGCGCTCTCTGCAGTTTCTGAGCAAGGGGT
TTGAGTCTTTAGCCTTTAATGCTGTACCAGTCATGATTACAAGTCACTCGATAAATTTAT
ACGGTATTGTCATGATTAAAATGCAGCTGTGATAAAACGTTTTCATTTTTTCCTAGATGT
TGTCTTATATTGGTGATCATATTTTAAACTCAAGCTTTTGTAGTTAACTCTTAAATGATC
TTTAGGATAGCATCTTCTCTTTTTTTTTTTTTTTTTTTTAAGATAGTGAAGTTTTGGGGC
TGCCTACCTGGAATGGGTGCTTAAATCCCTTAACCATTTCTCAGTACCATGGTGGTTCCA
AGAGACTTGGGTCTGTGTTTCTCCGAGCCCGCTTGCCCAGCTGCGGAGGGAGTCACACTG
TGATGCCCTGTGCTGTGTGCCTCTGTGTTGTGTGGTGTGCACGGTGTTGGTGCAGCTTAC
TGTGTTCTATGATGCAGCTCAGTCAGCTCTTCTCCTACAAAGACATCAGCCTTTGGAGAA
CAAAAGCTGGTCTCTGCCCAAGCAGTCCTCACTGATGTTTATGGACGTGTCTGTGTGGCT
TTGCCATTTTGTGTTTTCTTTAACACCCTTTCCAGGATATTCCCCACACCCCCATCCCCA
AAGATGTATATGATTATTTAGAGAATTTCTCCTTTGTTGCCACGAAATAGTGAAGTTCAG
TTCTCTTTGTACACCTATATTGTCTACGGGTTCAGGGCCCCTCTCTCCTGCACACCCACC
CCCCAAAAAAAATAAAACTTATAAAGGCTGATTAGTTCCTTTCATAACTTCCCATTGAAA
CAGGCTATTTTGACCCTCAGGTAATAGGAAATAGGAAGAGGTTAGGGCTTTGGCACTTGA
AGTGCATCAACCATTCCCATTTTTAATGTTTCATATGGCAAAATCTGAAAATGTTCTGCT
TGTGACATATTCCTGCATACTCTGTAGTTGAGTTAGGTGGTTAAACTCCAGGTCAGTACC
AGGTCCTCGCACAGGATTTGGTGGAAAAGTGTTCCATTTTAAATGATCAGATATCAATGA
GTGATCAGCAGTAAAATTCTAACAAAATTTTGAGCAGTCTTAAAACTATCTTGCCTTTTT
TTCTCAAAATATTTTCTCTCAGGTAAAGGTTGTGACAGGAAAGGATGGGCAGACTGGTAC
TCCTGTTGCTATAGCAACCCAGCTTCCACCAAATGTTTCTGCTGCTTTTTCATCCCAGCA
GCAACCATTTCAGGTACTTTTCGATGGTTCTCAAATGTAGTCTCATCCCAAACTTCTCCT
TCATCCAGATATTTTAACCTTCAATTTACTATTGCTCTTTGGCATTTTTTTCCAGAGCCC
ATTCCTTATTTTTAAAAAGTAAAAGTCTTCTTGCATATAAAGTGATAAAATTAAATTGCA
TGAGTGAATGACAACACAGATGTTAATGCATCATTGTCCATATTGACCTGTAATGCAGTA
TAGCTGTAGTATGCATGTCCTCTGATACTTAAAAGTTCTGTTGAATGTATGCCCAGGATT
CCTTGTGTGCTGTGTTTTAAATGTTGGCTCTTTCTTGTGTCTTCTATCTGTGTTTTTGAG
AACAGTGCAAAACAGAAAAAGGGGCGGAGGGAAAGATGTAAGCTGATGGTGACTTGCTGT
TTTCGGTAGTTAGAAGGAGCCTGGAGTGAAGCTGCTCTGGAACACCAGTACCTCAGGCTT
CTAACTGGATGTTCATGGACTCAGCAAACTGATGATTTTTAATTTTTGAAAATTCTATAT
TATATCAAGAATCTTAAATTACAGGCCAGATTCCTCTTTTTTGGAAGTAGATCATGCTGG
GTTTTAAAAGTAGAATCTTTGTGATGATTTGGAGGGGGTGGGTGTGACATTTAATTTTTT
TGTAATTTCAAAGGTATATAAAAGTCTCAGTAATAGTACAAAGAATTTCCCTTTATATCC
TTTACCCAGATTCACTAATTTTTGCCCCATTTACATTATTTTCATTCTCTCTTTCTCTAA
TTACACACACACACACACAGAAACAGACAGACACACACACACANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGAACCTGGGTTGGGTGCATGTAAGGCAAGAACCCTA
CCCTCTGTATTGTCTCTCCAGCCCACTAATACTATCTTTTTGTCTGTTCACTTTATCCTG
TGAGTCTTTTCCCATTGTCTGTAAAGTGAACCACAGTATAATTGGTTATTTATCGTTTAT
GAACAGGGAATATCCAAGCTTGAAGGATCTTAGTCTATGGGGTTGGGCAAGTGCCACATA
GCTCAGATGCCTGTCAGAATGTTGCTTTCTGTCATTTCAGACATACCTCGAGCCACCTGC
TGCCCAGCTCCTTCCCACAGATGGCCCCTGGTTCTTTTAGGGGCCTTAGCTGGTTGTACC
CAAAGCACATATTGCTGTACATCAAACCCAGGGACAAACATGCCAGGCATGTGCTCTATC
ACTTGAGCCACACTCCCTGATCCCAGTTCCACTTTTGATCCACTTCTGATGGACTCAGGA
GACCATATGGGGTGGTGAGGATCGAACCCAGGTCATCTGTGTGCAAAACAAGTGCCCTAC
CCACTATACTATTTTCCCAGAGCTCAAAAAAGATTTTTTAAATTGAAGATTGTCTCAGGA
AGTTTCTTCAGTGAGGGTCCTGTTATTGCTTAATGCCTCATTGACAGGTGTTTGTCAGGA
GCATATATACACTTGGAAAAGTTCATTCTGTCTGAACAGATATGCCAGTTAGGTCACTGA
TTCACTCTTGCCACATTGCAAAGTTCAGAGTGCTCAGAAACCACTCTTGATATAAACCCA
GGGCCTTCTTAGCCACTTTGGTTGGGAGTGTAGCTGGAAACATTCACAGGATTTGAAGAT
GTCTAGCACCATTCCCTAGAGATAACTTGTACTTGTGCACACACTGCCTGTATGGTGGTG
GTTCCAGTAGAACTGTTGTTCGACTTCACCAGAGACACCCCCCCCCAGCAGCCTCTCTGT
GGTGATGCAGGGCACATGGATGAGAGTGCACCCACTCTGGAGCCCCCGGCCTCCGCATCG
TTTGGTGGGACCGAAGCTTCCAGGAGGGCCCAGGTCTCATGCTCCTAGTCAGAGGGCAAG
TGAGCAGAGCCAGGGCCAGTCTGAGGAGCTGCATGTGATGAGCGTATGGGAGTCTTACTC
TCTTGTTTAATTTTTTATTTTGATTTTGGTCTTTGGGCTACAATCAGTGGTGCTCAAAGA
TTACTCTGCTCAGGGACCACTCTGGTGAGGCTTGGGAGAATACGGGTGCTGGAGATCAAA
CTTGGTTTGACACGAGCAAGGCAGCTGCCTTAACCCTGCCTGATCTCTCCTGCTCAAAGT
CTTACTCTTAGATGGCATGTGCACATTCTTTAATTCCTTTCTCAGTGTTTTATTGGGAAC
AATTTCAGCAAATTGAGTGGGTTGTTTGGTGAACACCCATACTCATGATGTGAATTCTGT
GGTTGATTTTACTGTGCTTTAAAAATCACACAGTCTATATTGCCATTGTATAATAGTTAA
GCTGGAAGAGGGAAGGAAAGTTGTCTATTTTGAGTTTCACTGTTCAAATTTGAAACATAC
TAGCAGATGTCTAAGGAAGTAGGGACATGGAGTCTGTCAGAAAGAATTACAGTAAAAGTA
TGTCCTTGGGTTTCTCTGGGAAAAAATTCAAGTATGTGTTTCATTAAAGTCAGTCGTAGA
ATACATTAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTTAGTCCC
TGAGCTACATTCCAACTCAGAAGAACTGAGCTGTCTTTCACTGAGTTTTCTGTTTGGAAA
AAAAATAGTTGTGACTTAAGAGGTAGTACAGCAGATAGGACTCTTGCCTTGCACATGGCT
GACTCAGGTTCTGTCCCCAGCATCCCACAGGATTCCCCGAGCATTGCCAGGAGTAATCCC
TAGGTCCAGAGCCAGGGGTAAACCCTGAACATTGTTGGGTGTGGCCCAGAAACTAAACAA
AAAGAGAACCCAAACAAATAAATTCATCCTTCTAACAGTTCTTAAAATACTACATATAGG
GGCCAGAGCGATAGCACAATGGGTAGGGCATTTGCCTTACATGCGGCCGACCCGGGTTCG
ATCCTCGGCATCCTATATGGTCCCCCAAGCACTGCCAGGAGTAATTCCTGAGTGCAGAGC
CAGGAGTAACCCCTGAGCATCACTGCCGGGTGACGCCCCAGAGAGAAGAAACAAATAAAA
TCCTACATATATATACACCCTCATGGTTCAGGATAGTGACTATCTTCTGGTTATTCTTTT
TCATTTTTTTGCATTTTGGGTCACACCCGGCGGCGATGCTCAGGGGTTACTCCTGGCTCT
GCACTCAGGAATTACTCCTGGTGGTGCTCGGGGGACTGTATGGGATGCTGGGAATCGAAC
CTGGGTTGGCCGCATGCAAGGCAAACGCCCTACCCACTGTGCTATCGCTCCAGCCCCATT
ATTTTTCTTCTTCTTAACTTTATTTTCATTTTTAGTAGCTCCTGATCTCTCATTTTGAGA
AACATGTATCCAACTATATTTTCTTTTCTTTTTTTTTTTTTTTGCTTTTTTGGGTCACAC
CCGGTGATGCACAGGGGTTACTCCTGGCTCTGCACTCAGAAATTACTCCTGGCAGTGCTC
AGGGGACCATATGGGATGCTGGGAATCAAACCCGGGTCGGCCGCGTGCAAGGCAACTACC
CGCTGTGCTATTGCTCCAGCCCCTATCCAACTATATTTTCTAATTAGATCTGTTTTACTT
AGAAACAGTACTTAGGGATGGCCTTAGTTAGAGTCATAGTATCTTTATATGGTGTTCAAT
CTAAAATCATCTTTTTTCCCCCCTTTAGTTAAAAGTGATACTGGAATAGGTGAGTGGTGT
TTGGTTTGGTTTTTTTTTTTTTTCTTTTTGGGTCACACCCAGCGATGCACAGGGGTTACT
CCTGATTCATGCACTCAGGAATTACTCCTGGCAGTGCTCGGGGGACCATATGGGATGCTG
GAAATTGAACCTGGGTCGGCCACGTGCAAGGCAAATTCCCTGCCCGCTGTGCTATCACTC
CAGCCCCATGAGTGGTCTTTGTTTTACTGTAGTCTTGTCAGTTTTGCTAAGTATTCTATT
AAGAGGTTAAGACCTTCCAGGATGGATTTTCTTGTTTGCCACCAATTTTAGGATTCTCAC
AATCTGTTGCTAATTTTATAAATTGGGACCTCTCTATGATAAATGTAATGATTTCTGCTT
ACAAGAGGGTTTGAGAAGGCATTCTAAAATACAGTTACTGTAGACAAAATAATATCATTT
TATTATTTATGTATTAAAAACCTGTTATGTTAGAACAGTAGAGTTCTTTGGCGCTACCCA
AGCTGCTCTTTTCATTCTACATGTGTGTTCTTCTTTTTCAGAGAGCTCTTTTAGAACCCC
TTAATTCCCAGATGCGCCCTGTCTTCCACCCACCTCTGCTCTGGGTCATCTCCCCCTTTT
AAATTGTCAATTGAATCGGGTTTCTTTCCATTTCCGTTACTGGCCTTAGTTTTTTTCCTC
CAGAATAAGAAGTCTGTTCTTTCACCTGAAATATTTTTCAGTTGTCTTTTCTAGGTGCAT
ACCTGGTTCATGTCCGCTATTCTTTCTCCTTGCAATTTTTAGACTTTCCATAAACTGTCT
CCTACGGATTAATTCTATTTTGGCATTGTTTTGTTAAAATGAACCAGAATTCAGTGAAAT
TCAACTTAACTGGGAATTAGTTCTCATCAAAGAGGGTCTGAATTTTTCTCTCAGTCTTTT
TAAAAAGGAATTCCAATAAATGCTTCAGTAACTGCTATAAAAATGTAATTAAAGTTAATT
TTGTTTGTTTTGGGGCCACACCCAGTGGTGCTCAGGACTTAGTCCTTGTTCTGTGCTCAA
GGATCACTCCTGGTGGGTTTAGGGGAACATATGCAGCGTGGGCCCAAATCTGGGCGGGCC
ATATGCAAGGCAAGCATCCTGCATACTGTGCTATCACTCTTACCTCTAAAATTACATTTG
AAGACAGTAGTGTATCTTCATGGAGGCAGTATAAGTTGAAACTGAAAATCAAGAGTTGGC
ACTGAAAAGGTGAAGAACAGGAATTGGTCTTTCTGTGAGTCTGGACTCTTCCTGGGTGAC
GGCTCCTCCGTGTTTGCCTGTGACATGAGTCAGGAGCACCTACTTGGTGACCAGACTGTC
ATTTCTTGTGAGAGTCACTGAAATGACACAGTCACTTGGGAGTGTGCCTGTGTCCTTTTT
TTTTTTTTTTTTCATTTCTTTTTGGGTCACACCCAGCGATGCACAGGGGTTACCTCCTGG
CTTTGCACTCAGGAATTACTCCTGGTGGTGCTCAGGGGACCATATGGGATGCTGGGAATC
GAACTCGGGTCGGCCGCGTGCAAGGCAAACACCCTACCTGCTGTACTATTGCTCCAGCCC
CGTGCCTGTGTCCTTGAGGGAGTTTCTTTCCTTCGTGGTTCACCATCCCTTCCAGTGCAG
AGGGTCCCCTTCGAGCTTTCCCGTGCTCCTATCTTATCCCACTGCCTCCACCCCAGCTCC
ACTGCACAGCCTTTCTGGTCTGGATTCTCGGCTCTCTGTAATTACTCTTTCTGTCGAGAA
TACCCCTTACCATGTATTAAACCCTATTTAAAAGAGCGTTTGGGCATACAGATTAAAGCC
ACTGTGAAAACTTTGCTGTTTCTGTGGGTGCCGGGAGCTCTTCTAGGACTGGTGTTCTTG
TTTTCTGAGGATGATTTGTGTCCTCAGAATAATTTGAAGTTGGCCTTTGGATGTGGCTAA
TGAAAGGCTCTAGAGAATCTGGGTTCTGTTAAGTCTGTTGCAGAGGTGATTATTATTATT
ATTATTATTATTATTATTATTGGGGTGGGGTCACATCTGGCAATGCACAGAGGTTATTCC
TGCCTCTGCCCTCAGGAATTACCCCTGGCAGTGCTCAGGGGACCATATGGGAAGTTGGGA
ATCGAACCCGGGTCGGCCACGTGCAAGGCCAACACCCTCCCCCCTGGACTGTCGCTCTGG
CCCCCAGAGGTTGTTATTTTGCTTTCACCTTTAATTGAGTTGAAGTAACAGAATTTCAGT
TCCCTATGTCTTAGTGGCACCTGAAGTCTGTGGTTGTGTTGGCATGTGCTGGGTGTGTTT
ATGTGTGTGTATGTGGCCTATGGAGAGAATGTTGGCTGCCTCCTGGGGTTCCCACTTCCT
CATGTACGAGGTGATTTTCTGCTCTTGGTCCTAGTGGTCCTCATGCCAGTGATAGAGCTT
CTGTATTTCTGGATCTGAGATAGTCCTCAGGCCAAACGACTTAACCCAAAACCTCCCTCG
TTCCGATCTCCTTCCCTTCCAGTTCTCTATGATAGTATTGGTATTACTGTCCTGCATCTG
CCTTCCTTTTTGAATTTTTAAAATTCCACCTAGAGTTTCCTATCTTTATTCAGTAGGAAG
TACTTAATCATCACTGGGCATAGAATGTCTTATCAGTGTCTTTGTTTTAAAAAAAAAAAA
CCCTTCCAGTTCCAGAAGTGATACATGTTCATTATAGAAAGATTTTAGTGCACACACACA
AATGAAAGTCACCTGTAGTCCAGTTCTCATAGATGACCACCGTTCACATACTCTATCAGA
GTCATTCTTTCTTTCCTTTCTCCCTCTCTTCTCTTTGTTCATCCCTTCCTCCCTTCTTCC
TCACCCCTTTTGTTAAATGTAAATGGAGGTGTTTATTCTCCTTTCAGTCACTTTGGAGCC
TTTCCCCAGTATCCCCCCTTCCAGGGCAGGCCGCATAGAAGTGGATTATCTATCCCTGGA
ACTGCGTGGGCAAACGGCCTCTCCTGGAGCAGTCACTGGGGTTAGGCATTAGTAATGTTT
GCATTAAAAATATCTGGCTAAGTAGAGTAGGTACATGGGATTGTTTACAAAATCAGCAAC
TGAAATGTTAAATATCATCCTTAGCATTTATTGTAATGGCAAGGATGATGGATGGATGGG
AAAACTGAACTCCAGGCATAGCCAGTTTTTGCCTCAGCTAATAGCGTTTCATTTAAACAT
TAAATGTGATATATGTATATGTATATATGTATACACACACGCACATACATGTATCTCAGT
TTTCTCTGTGCCAGGTAGGTGCTGGCTACAGAAATCGTGCCTTGAAGAGCCCAAGTCAGT
CAGATTGTCTCTGGCTCGGACTGTGGTGGCATTGTCCAGGGGGAAGCATTCTACCTCTCT
GGTCTGGGTTTCCGGGAGACTGGCCAGAGGCTGTGCTGCCGGTGCTGCCGCGCTCCGTAC
AGAGCAGGGAGGGGCTGAGGATCTAGGTCTGAGCGCAGTTCCACTCAAAACCAGAAAACT
GGCTTTTGTAATTCTTTTTTTCCCTCAAAAGGTAAGTCAGAACTTTCCGGGTTTTTTCTG
GTATATATATATTTAAATAGATTGGGTATTTAAATATGTCTTCTGAAAAAAGGAGTGAGG
TTAATCTTGGGAGTAATTATGAGACTCTTTCCCCCCCACCCCCCTTGCTTTTGGAGCCTT
ACCAGACAGTGCTCAGGGGCTGTTACTGGGTCTGTGCTGTCCCTGGCAGTGCTCAGGGGT
TTCTTGAGGTGCCAGGGATAGAACTGGGGTTGGCTGCATGCAAGCAAGCGCCTTAACCCC
TGTGCTCTCTCTCTGACCCCCAGTTAGAAGAATTTCGACTTATAGTCATTCTTGTAATTC
ACTTGAACATCAAAGTCTCATTTGCTCTCTCTTTTTCTAGCAGCAGACCCTGACAGGAAC
CCTGGTGTCAGGGGCTGGAAGTGCAGCAGCAGCGGAGACGGATCCCTTTAAGCGGCAGCA
GGCAGGACCCCCAGCAGGTATGTCTAGGAGCACAGACCCATGTGGGGATCATTTTACTGT
GGGAATCATTGCATGGCATGTGTAGCTCTGTGCCACACACTGCTCACATCTAGTGGGGTG
CCTGTTCTGTCCTACTTGGAGAGCGAAGCCAAAATGCTGTGACTGCTTCTGCTAGAAGTC
CGACAGATGAATAGATGATCTCATTTTGATTTTGTGTGCATTTGAAGATTCTTTCATGAT
GTGGTTTAGTGTAAAGCCACATGATTTTGCAAATTGTCATTCATTTTTCAGACTGGATTG
TTTTCCCCTATAAATTGTTGATGTGCACACATTTTATGTAAACAAGACAGTTCAGATGCT
GTAGTATGTCTGCTTCTGGCTTGGTATTGCCTGCACCCAGAGGTAACTGCCATTCATGTG
ATTTTTCTTTTTCTTTTTTTTTTGTTTGTTTTGGGGCCACACCTGGCAATCTTCAGGGGT
CACTCTAGCCTCTGCACTCAGGAATTATTCCTGGTAGTGCTCAGGGGCCCATTTGGGGTG
CCGGGGATTGAACCCAGTTCAGCTCTTTGCAGAGCAAATGCCTTACCCACTGTACTATCA
CTCTGGCCCTTCAGGTTATGATTTTTCATGCATACCTTTTTTTTGGGGGCAGTGACCACA
CCCAGCAGTGCTATGGGGTCATTTCTGGTGGTGCTCAGGGGACCAGGTAATGCTGGGAAT
TGAACCTGGGGCACCCAATGCAAAGCCTGCATGTTCCAGCCCTTTGAACCATTTCTCTGG
CCCTCACAGACATCTTTGACCATGTAGAAGCATTACCACCTGGGTGCTTTTCTGGAAAAA
AATGACGTGATCATAGTGGCTTAAGCACTGGGGCTCTAGGTCAGGTGACAGAGCACGTGT
AAGTCATCCTGAATTCTGTCTCAGTACTGCATGGCCTTCTGCCTGAATGTTGTCAGATGT
GGCCTCAGTGACCCAGACTAAAAATGAGTGACTTACAAGACCGCCTCTCCTAGCCTATTC
CTAAGCCTCATTTGTTTCGTTGGCTGCCTATTATCTCATTTTATGGTAGTTTGTTTATAT
GACTCTTGTGTTCTTTAGTTATTACAACTTTTTTTTTTTCTGCTAAAATCAAGATAGGAT
TAGATAACAAGTTACACTTCCCCCCATACAAATGATTCTGAAGTTTGTCAACACATTTCT
ACAAGGAAAAACTTAGAGAATTGCAAGTAGGCAGATCAGAAGCCCACATGCAGTTATTAT
TATTTTTTTTTTTTTTGGTTTTTGGGTCACACCCAGTGATGCTCAGGGGTTACTTCTGGC
TCTTCACTCAGGAATTACCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGATTAG
AACCCGGGTCGGCCGCGTGCAAGGCAAACGCCCTGCCCACTGTGCTATCGCTCCAGCCCC
CCACATGCAGTTACATGTTGGTGATCCTAGCTGCTTTTTAGAAGAATAGGCAAAGGCAGT
TTTCATGCCTGCCAACAGTTTCTGGGCATTTTATGAAGTATGAGTCTTTGAGTCTTCATG
GATGGGATAGTAACCATTTGTGACCCTGTTCTTGTGCTAGCTTTTTGCTCTGCTCATTTT
ATCTATCTGGTTGCTAAGATCTCATTTTAATTTGTAAGAGCTTTCTGAATGTTGAATAAA
TCAGCCTTCTGCTCATTGTGTTATGTGGCAAATATTAGATTGTCGCTTGTTCTTTTCCTT
TTTATGATGCTTTCTCTTATGTTTGCAAATTTTTAATGTAAAAATATATTTACCAACCTT
ATCTTTTATGGCTTCTGGATTTTAGTTCATGCATACAGAGATCTTCCTGTTCAAAGATTA
TAAAACACACGTTTTATCTACTACTATGTGGTTTTATTTTTACACCAAACTGCACCTTTT
CTGAAAATTATTCTAGAGCAGTCTAAGAGACCTCGGCTTGAAGTGGGTCACCAAGGGGTA
GTTTTCCAGCACCCAGGGGTGAATACAGGAGTCCCTCTTCAGCAGTTAATGCCGACAGTC
CAAGGTAAGACCCGGCACCAGAACTCGGCCCTTTAGCTCAGCAGAGGGAGTGCAGAGAGG
GTCACAGCCCATGTCGCTGAACTGGGTGGTCCAGGTAGTGTGCGTGCAGGACCCTTTCTG
CAAAGGGGGGTTTCTCTGAGCCCTATAGCGCAGCATGGCCTGTCCTAGAGATCGCTCTGT
GTCACTGCACTGGCCACACTCCTGTTCTTGAGCCCCTCCAGCTTGGACTTATGTGGTCTG
CATCCTGCTGCCGCAGCAGGAGACCTGTGCCTGTCCTCCACTGTCTTGCTTCATGCTGAC
TTGCAAAGGTCAACCACCTCTCTTTCCTTCTGCGTGTGCTCATTTACAACTGGAGATCTG
ATCTAATATAAATTTCCCACCAGTTAAGTGTGTGCGTGTGTATGTGTGTGTGAGAGAAAG
AGTGTTGCTAATGACTGACAAGCATCAGGATGTGAAGTCTGTGCCCTTTCACGTTGGCAC
GCTATTTCCCGGCTCTGGGGTCAGTACAGGTGGGCTGTTTGCTCTTTTGCAGGAGGAATG
CCTCCTGCTCCTCAGGCCACTCAGCTGGCAGGACAGAAGCAAAGTCAGCAGCAGTATGAC
CCCTCCACTGGGCCTCCGGTGCAGAATGCAGCCAGCTTGCACACACCGCCACCGCAACTC
CCTGGCAGGCTGCCCCCTACTGGTCTCCCTGCTACGCCTCTCTCATCCACACTACAGTTC
TCACAGCAGATGGCAGAGCCACAGACCCAGCTCCAAGTCCCAGCAAAGACTCAACAACCA
AATACACTGGTCCCTGCACCACCTCCCAGCCAGCTCTCTACAGCGCCTCCACCTCCTGCC
CAGCCAGCCCTGCATGTGCCATTGCCCGGGACGGCACACATGCAGATCCCGCAGCTTGCT
CCCAGCCTCAGTACGCACGGCATGGGACGTTCTGAGAGTGAAAGGAGAGAGGAGCTGTGT
TTGCCTCTGTCTCAGCTGTGAGGGACTCCTCAGAGCAAAGGTTCTTGGTGGGCTGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGGCTATGCATATGCTTCACACTGAGAAGGCCCAG
GTTGGCCGCTTTCAGCACTGCTGGGTGTGATCTGAAAGAGTGAACACAAAATCTTCAGAA
TTTGGGGGGCAAGAGATAGTACAGTTTAGTGCTTGCCTTGCCATTTTGATCCCTAGTATT
GCATGGTCATTCACGAAACAGTGGGACCATATCAGCTGATCTTGCCATCCATCCCCCAAG
TGCACAAACAGGAATAGCCCCCAGTGCTGCTGGGTATAGCCCAAAGAAACACACTTCCCC
AACTCCAAAAAATACTCCAAAAGATATTATTTTACTTAAAATTTTTTTGTCTTTTTTTTT
TTTTTTGGAGCTACACTTGGTTGTTCTCAGGGCTTACCCCTGGCAAGGCTCAGGGATGTG
AACATGTGTGCTATTAGGGATCAAACCCTGGTCAGCTGTGTACAAGGCAAGTGCCTAACC
CACTGTACTCCTTCCAGCCCAAAGACATTAGGAGTTATTAAAGCTCTCCAGGTGATTGCT
TTAAAGAGGCATGCTTAGCCCAAGTTTACTAAGTAGCTGGAGCTGAGTCTCACTGCCTCT
AATGTAATGTGTTACTAACGTAACATCTCAGAACACTGCTCATGCTGCTCTCAGGGATGG
GAGCTGTGCAAATTTCCCCATTGTCCACCTGACGACAGAATGGACAGTTTCTGCTGTGGT
GAGTTTTGGGGAAGTGAGAACAGGTTTGGAGATGTGTCCTCTGGGCCACCTGATCTGGGA
GTCAGTTGGGCTTGGCTAGGGTGTCTCGTCACCCACAGATGCTCTCTAAAGGAACCTAGC
CTACAGCACGCTCCCCAGTGATACCTCGGATGTGATGGGAGTGATGCAGGATTCATGTCA
GCTAACACCTCCACTCCTGCTAACTGGCTTTACCCAGATACCTTTGCTGACACTTAGTGA
ACTGCTTTAGGCCCTCAGGAATTGTGGATCCTTGAGCCAGCATCATTGCCATAAGGACGT
CAGTCATGTCAGATCGACCTCATCTTGAAAAGCAGCCTTGCTCCCCTGGGATTCTGTGGG
ATCATTCCAGGGGCTTCGAGGGCAAGTACCTTCTGGCTAGTGGAGACTCAGTGGACTGTT
TGGTTGAAATAATAGCAGTGAGATGAAAGCTCCTTTACTCAGTGTCTGTCAGGCTTCAGG
TGCCTATGATGGACATGTCCTTGAGGGTCTTTTTTTTTTTTTTTTTTTTCTTTTTTGGGT
CACATCCAGCGATGCTCAGGGGTTAGTTACTCCTGGCTTTGCACTCAGGAATTATTCCTG
GCGGTGCTTGGGGGACCATATGGGATGCCGGGGATCGAACCCGGGTCGGCTGCGTGCAAG
GCAAACGCCCTACCCGCTGTGCTATCGCTCCGGCCCCGAGGGTCATTTTTTCTTGCTGCC
TGAGGGTAGTGGTGGAGCCTTGTCTCTGTCCATACGGATATGGCAGGCAACCTGTGCTCA
GCACATGAGGCTGTGGGGAGAGGAGAGGCTGTTGTTTGGCAGCAGGGCTTCAAGGCCTGT
GCTCTGTCTTGGAGCTGCCCTGAGGTTGCTGTGAAGGAAGTGACAGGCCCGCTCTGCTGT
GGTCTCAGCGCTGCTCCTGAGGAAGCCGTGCAGCTTGTTCCTAGAAGCCTGGGCTGGGCT
GGCATGCTTCCTGGAAATGAGCACAAAGGGAGGTCTCCCATGCTCTCGGCTATGTGTACA
CTATAGTCTTCGATGCCATTCCTAAGCCACACCCCATGTGAAAAGCAGTCACAACCAGCA
TGCCAGCTGGTGCTGTGGTATGACTGGATGACAGGAGAACTTCCTTTCTCTGCCCTGGAG
GAGGAGGACAGCATTCCAGGTAGAGGCAGGCTGCATCCTCTCCAGGCTTAGGCCCCTCTA
GTCTTGCAGGCTTCTGTCCAAGAGCAGTACAGGAGGAGGGTTTGCATCTTGCAGCACCCC
TGCCCTGGGCAGTGTACAGAAAATGTGTATGCCTGCTAGAGAGAGGTGCGAGGTGAGCAC
TGGGAAGTTTCCAAAAGACAAAAACTATAGTTAGACATTTAGAAAGAGCCAAAGTTGTGG
TTTAAGTGGAAGAGTACAGGTCTTGGTTTGTTTTTTTTTTGGTTTGGATTTTGGGCCACA
CCCAGCGATGCTCAGAGGTTACTCCAGCTCTGCACTCAGGAATCACTCCTGACAGTATCT
TGAGGGCCATTTGGGATGCCAGGGATTGAACCCAGGTCAGTCGTGTGCAAGCAAGCTCCC
TAACCCCACTCTACTATTGTTCTGGCCCATAAGAGCACAGCCTTGGCTGTGGGAAATCCT
GGGTGCAGTCCCAGTACCACATGCTGGCCCTCATCCCCCACTTACAGTGATGGTCTTAAA
TAGCAACAGCATGAGAGAAAAAGAAAAAAAAAAAAAAAAGGCTTGCATAGGGTAAGGGAC
CAAGTGCTGTACCGCTCCTCTTTGGTCTTGTGGGAAGTAGGATCTGTTACTGTTCTTGTA
CACAGGCTCAGTGTGCGTTCATCATGGTCTGTTTGCTTGTGTCCATGTGGGGCATGCTCA
GGTGGTGATACCATCTCTGGCATTCATTACTGGGTACTGAGCCGTGTTTCCTTTTCTCCT
TGCCAGACGGTGGTGCCAACACGGCCAGCTGTGGACTCTGCCCAGCCCTGTCAGCGCCCC
CTGCCGGCCTCCTCTGCTCCTTTGTCCATTGCTCCTAGCAGCGTCTCCGGCCCAGGACCC
TCACCTGCGAGGGCCTCTCCTGTGAATAGACCTTCTGCAGCAACCAGCAAGTCATTGTCT
CCAGTTACCTCCCGGTCTCCAGGGGCAGCTCTCTCTGCTCCCCCAAAGCCACAGAGCCCA
GCTCAGAATACCGGCCCACCCCCAGATACTTCTCAGGATAAGCTGGCAGAACAGATTGCA
CTGGTAAACATACTTCGAAAACCATTTTTAAGTGCTTGAGAAGAATGTAAACATGTGTTC
CAACTTACGGCTCACATTTGGTTTTAGTGCCCAAGGGGGTCAGAGTTAATAATTGAACAG
TAAGGACAGTGGACTGCTTTGTGGTCAGTGGGCCAAAGTCACAGGTCACTCTTGAAGCTG
CCCTGGTGGAGTTGGCATCGGGCAGTGGCTGGGAACAGGCAGGCGTCCAGCTCAGGTGAG
GCTCCCCTGCCAGTATAGCAGGCTCTCAGCCTGAAGGGTTCACAAAAAACTAGACATTCA
TTCTATAGAGCTTTGTGGGGGTATAGCTGGTTAGGATTGTCCCGAACCCAGTATTGTCTT
TAGCCAGTCGCACCATGCCCATGTGCCTGTGTTGTTGGTCTGATCCTCGCCCTACTCAGC
TGCTTATTTCTTTTCCCCACTCTGAGTCACCTCAGGCCCTGCTTAGATCCACGTGGTGAT
GGGGATTCCGCATGCCTCTTCAAGCCACCTCCCCAGCCATTTCTGGTAGTCTGAAAGTGA
ACTCCAGGCACTGCCTCTCTCCCTGCCCCCCACCCAGTGAATATTGTGGGGTGTTGTGAG
GGCTGCAGGCTCTTTACTTTCCTCTGAGATGAGGTGCAAAAGTCCTTTAGCCTGCGCTTA
CAGGGAGAGTCCCCTGAGGAACATTGTGACCTATGTTGGGGAGACACAAGTAGTTTCATG
TGCCCTTAGGAAAACCAGATTCATCAGCGAATTGCAGACTTAAGGAAAGAAGGCTTGTGG
TCACTCCGGCGGCTGCCAAAGCTACAGGAGGCCCCCCGCCCCAAGTCACACTGGGATTAC
CTGCTGGAGGAGATGCAGTGGATGGCTGCAGACTTCGCCCAGGAGCGCCGGTGGAAGATG
GCCGCGGCCAAGAAGGTGGGTGTGCTAGGGCCGTCCTGCCCACTGCTGTCTCCCAGTCCA
GCTCCTGTGTCATAGAGCACTGGGCATGACCTCCCTGGCGCTGGTTCTCAATGGGGTTTG
AGGACCTTTTCTTGCCAGTCTTTCCTGGAAGTTGGGGTGACCACATCTGCAGCCTGTGTG
TCCTCCCCAGGGGCGAAGTGTGGCTTCCCTTTGACAGTCGAGGTGGCGCCCATTACAAAT
GGGATCTTTGTTAACTGGAGAGATGATGGTGTGAGAGGGATGTGGTACAGTGCAGCAAGG
TGCTTTTTCTAGAACAGGCTGGCACTCATGTGGGTGGCAGTTTATGCTAGTATCTGAGCT
TTTCCTGAGCACCATAGAGAATTTCTAAGAAACTCTTAGAAATCTGACATGGTACCAAGT
CAATTCTGGAACTTGTATTTCCCAGCTGGTCAGAACTGTTGCCCGTCATCATGAGGAAAA
GAAGCTTCGTGAAGAGAGAGGGAAGAAAGAGGAGCAGAACCGTTTAAGACGCATTGCAGC
CTCCACCGCTAGAGAAATAGAATATTTCTGGTCAAATATTGAGCAGGTAATTGTGAGCTT
ATCACAGGCTCCAGGAGAGGAATGCTTGAAAGCCTTCTTGAAGGCTCTTTTCTCAGTCAC
CCCCTTGATTCCAGTCACTTCCTACTACCTCTTGTTCTAGTCACTTTCTGCTACCTCTTG
TTCTGTTCTGTTTTGTTTTTGTGGGCCACACCTGGTGGTGCTTGGGGATGGAAATGGGGT
GTAAGGCGGGCACCTTGATGCCTGTGCTCTCTCTCCTGCCCTGCCTGTTTCTTTACTAAC
ATTCTCATATTGAGCTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTAAAATGCAG
TTAGATACAGAATGATGATAAGGTTTCCGACTAAGGGTCTGAGTGATAGGACAGCATGTA
GGGTGTTGCCGTTGCATTGCGGAGGACCCGGATTAGATCCCCAGCATCCCATGTGGTCCT
GATGAGCATCGCCAGGAGTGATTTGTGAGTGCAGAGCCAGAAGAATCCCCTGAGCATCGC
TGGGTGTGACCCAAAAAAGCAGAAAAAAAAAAGTAGTTCCCAACTGAAAATTTCTTTTTG
ACCTAATTTTGACTTGACATTTGGTTTGGTTTTAGGGTCTAGCCTTGTAGTCCTCCAGGG
CTGTCCTGTTCTAGGGGTCAGTCTTAGAATTCCCACATGCAGAGCATGCACTCAGTCCTG
TGAACCCCCTTCTCCGACCCTGGATTTATTGTGTGTTTCAGTGTTTCCAGCTATGAAGCT
TCTAAGACCTGCATCCTTAACATGTGTGTTCAGTTCACTCTTTATGTGTATACAGGTTGT
GGAAATAAAACTACAAGTGGAATTAGAAGAAAAACGGAAGAAAGCCTTAAATCTGCAGAA
AGGCTGCAGGAGAGGTAGGAGGCGAGCATGGGCTGCTGAGGTTCTGATTCCCTCTTGGGC
TCCAGAGCGCCGTCCAGGGCTCCTCTGTAGCTTTCCGGGAAATGAATCTCGTTCCTTTCT
CAGGGAAAGACTTGAGACCAAAGGGACTTGAGGCATTGCCGGAGAATTTTCTGGTAAGTT
GGGAGTGAGAGAGAACAGGAGTGAGGTGACTGACAGGCTTCTGATGCTCTAGAGATTCTT
GCCTTTGGAGATGCTGGGGGGTGCCCCTATCATTGTGCAGTCCCTTCTGCTGGGAGGGTC
AAACCTGCTTCTGGTTGGCATGTGCCTAACTGATGCATTGGCTTTGTGGCTGAGCATAGT
GACAGAGCCTGAGCCTGGTCTGGGGGCCTGGTACAGCAGATCTGTGTGTACCCCTCTCTC
TTTCAGGGGTTGCTCACAGATTGTGCTCAGGGTTCCCTGGCACTCTTCCCGGAAGTGCTC
GGCCAGCTGTGTTGAGGCCTCTGTGTTGGAATAGAGGGGTAGACGGTATGGGGCTGCTTC
TGCCGTAGGCTCCTCTGTGATTTCCATCTGTGTTTCAGGGTTCAGGGCCGTCGGTGAGGA
AAAGGAAGGCCAGCGCTTCCTTAACTGATGATGAAGGTCGGTCTCTAGGACACCACATTG
TGGCCCCTGAGGGTGGTGTATGTCAGCAGAGGCTTGGCAGGTGGCTTCTTTCCGGGGTTC
CACATGGCAGCCTGGGTGGGTTTGTCACCCTAAGGGGGCACCGGAGCGAGTGGTCCCCTG
TTTGCCATGCCCGCTGGTCCCAGGGTAATGAAAACGAAAGGGATTAGTTGTGAGTGTGCT
CTAGCTGGGCACAGCAGCTTCTGGGGTCTCCCGGAGGATTATAAAAGACAAGCCTGTCTT
ACTGACGCGCAATGGTGACCTTGCAGTGGAAGATGAGGAGGAGACCATCGAAGAGCAAGA
GGCCAACGAGGGGGCTGTGGACCACCAGTCTGAGCTGTCCAACTTAGCCACAGAAGGTGG
GCTGGGGCCCTTCCTTAGGCTGCCCAGATGCTGAAGTGAAGAGACTTAGGAGTGGGGACG
GATGTGGGAGCTGGGGCCCCTTTGCCTTTGCCCATCCAGCAGTCTGCAGCCTGCGCTGCT
CCTGGCTGTCTCTGACATGCTGCTGTTGGCCATGTGTGCAGATGTCGACTCCGCAGCGGT
TCCCGCTTCCCTGTCATGCTGTGCACTGTTCCTCACTGCATCTCCCTTGCTGTGTTCATT
CCCAGCTGTGGAGCATGCGCCTGGGGGCAGCATGTTACCCTTTCTCCCCTCATAGTTGAT
CCTCCCATGAGTTTCTGACATAGTAGCTGGATGGGCTTTACCCACCAGAAATATCTTCTA
TCTCTTCCCACCCCCAGCTCTCCCAATTGCCACCATAGTTTCCATCCAGTGCAACTCTAG
GTGTATGGATCTTTAGTTTGGGAGGGAGGAGGAGTTGGGCCACCCTCCTTTCTGAATTTG
GAGGACTTTATGGGAGTCAACTGCAGACCCTCACACCTTAAAGACAAGTGCTCTCTACCC
TGAATCTCCTCTCCAGCCCCAGCGAGTTTGGATTCTTTGTGGGGTCATTTTTGACTTCTC
CATGTAAGTGCAACCATCGGTGGGGAATCATCTCTCCTTTCTGATTGACATCATTGGGCA
GTATCCCCTTAAGCGCCATCCATGTTGTACTATCACTCCGACCCCTGACCCTTGATATCT
TTATTAATCTTCTCAGGTATTTTCCATCAAGAGCAGTTTTACTATTATCGTGAGTTTATA
AACTTTAATATACACTTAACATAGGTTCCAGAAAATAATGTTTATGGATCAACATTGAGT
TACTTCATTCTATAGACCTCCATCTTTCTAAAGTAGTTGAGATCCTGTGTTGGTCATGGG
CACTTGTTCATCCTTGGGAAACATGATAGACTGTGCTTAGGGAGATGGCACACCCCACTG
AGGGAACTGGAGTAGAGGTCTGTCAGTCCGTCCCTGTTGTGCCGCTCAGCATGCTCACAG
CCTCTCCTGCACCCTGCAGCGGAGCTGCCGTTGGTGGATCTGGTGAAGCTGTATGAAGGC
GCCTTCCTGCCTACCTTCCAGTGGCCCCAGCCTGCTCCCGACAGTGAGGACTCGAGCGAG
GAGGAAGGTGTGCAGCGGCTTCCCAAGTGACTCGGCTCGGGGGCTGGGGTTGCAGAGGGG
AGGGCTCAGGGAGCAGCTGAGTGGTGTCTCTATTGCCTGCTGCTGCAGCCTGCTGGCCAG
GATGGTTGAGACAGTACTGCACAGTGCAGTCTGAGTAGTGTCTTTAGTCTGTACTTACAG
AGCTCCTGTTAAGGAAATATTTTTCTCTGGACTTACGAAAGTCATTATTTTTTAATTATT
TTGTTTGTTTTCTAGATCCCCAAGCCCCACCCCACACCCAGGCTGTCATTTTAACACACC
AGTTTTAAGGAATTTATTTTACCTTTTATGGGGGAGAGGGGAAATGTCTCGCTAGCAGTG
TTTGGCAGGTGGGGCACTCCTGGTGATTCTTGGCTCTGCAGTGGCAGCCCTGACAGGCCT
GATAGTCTAAGGGCGATGTTCAGTCGTGCCAGGTAGCATGTAGTGGGGTCTAGCATCGAA
GGCATTTGCTCCAACTCTTTTGAATGATTTTCCTGAATCTAGGGTTGTAGACTTTATTTT
TTTTAATCTTCCAGATGTGTAGACCACACACTTTCTCTGAGTATTAGACCCTGGCCCTGG
GTGCATGAGTGGGGAAGGTCCCAGAGACCACAGTACAGTGGGATTGAGGAGAAGCTGGTG
ACTCCTGCTTCCCTGTTGTGGGTGATGCTTCTAACCTACCTCCTACTGGGGCAGGATGCC
AGGCAGTGTTGGGAGGGGACATTGATGCCCCGCGGTCACCGAGGCTTGCACTTGATAGTT
CTGCAGTGAGTTTATAAAGTGCATTAGAAACAAAATTCCTGTGGAAATGTGACTCCTCAG
GAGAGTGCTTGCATGAGGCCTTGGGTTTGTGCCCTGGCACCACCAAGACCCGACAATTGC
TGTTGTGGTCTGTTGTCGTTGGTAGATGTGGAAGACTACCCTGGGGACCGGGAGGGCCGC
AAGGACGTGGTCCTCATTGACTCGCTGTTCATCATGGACCAGTTTAAAGCCGCAGAGAGA
ATGCACATCGGGAAACCACACACGAAGGACATTGCTGAAGTGACGGCTGTGGCAGAAGCC
ATCCTGCCCAAAGGCAGTGCTCGCATCAGCAGCTCGGTGAGGCTGGGGTCTGGGCTCAGG
GCAAGCCTCTCTTCATCTGGGCTTCCCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTGGCAGAGCCATCCTGCCCAAAGGCAGTGCTCGCATCAGCAGCT
CGGTGAGGCTGGGGTCTGTGGCTCAGGGCAAGCCTCTCTTCCTCTGGGCTTCCCCTGCCT
CCACTCAGACTTAGGTAGCTCAGCAATGGCCTTTCCCCACAGGTGAAGGTTAGTGTCCCA
TCTCTGCTTTATGGCGTGCTCCGAGAGTACCAGAAGATCGGCCTCGACTGGCTGGCCAAG
CTCTATCGGAAGAACCTCAATGGCATCCTGGCAGATGAAGCTGGACTTGGTAAAACAGTG
CAGATCATCGCCTTCTTTGCCCACCTGGCTTGCAATGAAGGTAAGAAGTTGTTTGAGGGG
CCAGTGAGGGGGCTATGGGCTTAGACCCGGCGACACTCAGGGCTTACTCCTGGCAGGGCT
TAGAAGACCGTGTGTGGGGCCAGGAATGGAACCTGAGGTCAGCTGCATTCTCTCTCTCTC
TCCCTTCTCCCCCCCCTCTGCCCCTCCCCCGACCTGGTTGACATGTCTTCGGTTGTCCTG
AACCTAGAGTAGGGAGGGAGTCTCCTCCACCCCTTTCTCTGCTCTGATCCAGGGCATGAG
CAGAGCATGGCTCCTGAGGTCTCACTGTGTACCCCCATGTAAGGCTTGTGCTAGCCTGAG
GTGCTCACTGTCACTCAAAACTCAGTGTCCTGAGAGCCCTCACTGGGACTGGAGGTGCTG
CAGCAGTCATAGCATGTGGACAGCAGAGCTTGCATGTCGCTTGCGTGCCCTCATTCAGCC
AGGCTCGACCAGGGTTCTCGCCCCCTTTTCCCTTGGGTTCCCACTCCTGCTCTTGCCACA
GACTGTGCCCTCCACTGCTCCTACCTGCCTGACTCTACATGCTTAGGTCTGGTCTCAGCA
GTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGTTTACTGGTG
GTGTAGAATGGGCACTGGTGAAGCGTTGGGTTATCGAACTTTGTATGGGGGAAACATGAG
CACAAAAATGTATAAATCTGTAACTGTACCCTCACGTTGACTCACTAATTAAAAATAAAC
TATTAAAAAATAAAATAAAAATAAAAATAAATATTCTGAGAATTCCTGTTGTTTAAATAA
TGCTTCAGAATAATCCCAAATATATTGTCTCTACTTTTATTTTTTTAAATAACAAGGGGC
CAGAGAGGAAGTCCAGTTCGTTGCCTTGCATGAACCTGACCCAGGTTTAATTCACAGCAT
CCCATATGGTATCCCCAGCACTGCCAGAAGTGATCCCTGAGTACAGAGACAGGAGTAATC
CCTGAGAACTGCTGGTTTGACCCAAAAACAAACAAACAAAAACAAAATTCTCGATTTCTC
ATAGAAGACAAGGTCTCGAGTAACATTAAATGGGATACAGCAGCACTTATATGAATTACA
TAGGGCACTGAACTTTTTAGTTGTATAGAATTTATGAATAAAACCTTTAAACATTCTTTC
ATTCATCTTGTTTGTTTTGGTTTTTAAGTATTCAGGATTTACTCCTGGCTCTGACCTCAG
GCATCACTTCTGGTGGTGCTGGGTGGAATATATGGTGTAGGATAACATAGCCTCAGGTAG
TTTAGATTTATTGGGTTACTCCCGTTACAGTGCTCCCATCCCTCTTTGCTTATTTGTAGC
TTCTTTCTTCATGTTCTGTTGACTTGTAAGTATTGTTTTTCTCTTCTCCTTGAGTACTTT
GCATAGTTTATTCAGAGCCATGTCCTTTTGTATGGACACAAGAAGACTATAGCAAATGCT
ATCCTTTTGTAACCTGGGAATCATTTGACTCTACATAATATTTTCTTCCTGGGCATCTGT
TCTAGACCTAAGCCTCAGCTGCCCTTACTTCCTAGCACCCCAAAAGCAGGGTCCCGACGA
GGGATGAGACGGACCCAGGGCAAGCGGTGAGTTGTATGCTACCCTGGCATTGAGATGGGC
CTGGCCAAAGTGCCTAAAGCTTAACTATAAGTTAAGAGCTTGGTCATGGACAAATGCTGT
CATGATCCAAAAAGTAATAACTAGATTCGGACCCTGCTAGGGTTAGGAATGATTAATCTG
GCCTGAGTGCTGTAGTCTGAGTCTGTGGCAAGATGTTGCCTTGCAAGCCTCAATGTATCT
CTTGCTATGTCCATACAAAAATAACTAGTATTAAGATGTTTAATGAGTGTTTGGACTAAG
GAAAGGAGAAAAACCCCTTGAGAGGTATTTTGCCTACTGGCAGTTAGGAAGGGCTTTGGA
ATACCCCTAGGTTGTATTCACTTTGAACCTGGCAGCCCTCAGGAAGGGCTTTCTTAAGTT
GATTTTGCTACCAGGCTGTGTGTAGCCTAGGGGCAAGGGGGAAAGAGGTGGCTGCAGTAG
ATCCAGAGGGAGGACGGAGCTAGGAGTGCAGGAGATGAGAAAGATGGAAGATTGAATGAA
CGGTAACTAATCAGCAACCAGCTTGGTCCTCGTTCTTCCTTCACCTGTCCTTGGCCAACA
GCCATCCTGATCCAGCCCATTCCAGAGCACCGAACACGGGCGGTGAGACAGAGCCGCCTG
GAGAGCCTACTAGTGCACACGCCCATCGGTGTGCATAGTTTTTGACAAGTAAATAAACAA
TTAAGGGGGGGGCAATCCTGCCACCTTGTTGGGTGTGTTCACTCTGCATTGTCAGTAAAT
CTTTGTCTTTCGTTTGGTAAGCAAACAACCTCATAATCATAATCACATATTCACACCAAT
TATAGGCATCAACTTCTGGGCCCTTTCTTTAATTTGTTCCTGTGTTTTGGCCCAATATTA
CAAAATTCAAAATGTATTTCAGTATATTTTTATGTGCATGTTACTGTTTTTTTTTGTTTG
TTTGATTTTTTGTTTTGGTGGAGGGGGGCGGGACATACCTGGCCATGCACAAGGGCCACG
CATGCAGGTCCTTCATGCACCATATATGTTGTCATGATTCAAACCAGGTTGTGGCCACAG
ATGCATGTTAGGAAAGCACCTTAACCTTCGTACTGTCTCTCTGGCACTGTACATAAACCA
GTTTGCTTTATTTACTAATTCATTATTGAGTTGGGAAAGGAAATTATTCGCCTGTGTGTA
TGTGTTATGTACATATTCAAAGCATTCGTAGACGTATGTGTATGTGAGCAAGGGTGGTGG
TGATTGGGTCACACTGTCAGTGCTCAGGGGCTACTTCCAGCTCAGTGCTGGGGGGGGGTC
ACGCCTAGTAGCATGTAACCAGGAAGTGAACCTAGGCCTTCTGCATACAAAACACATACT
CAGCCTTGTGAGCCATCACTGTGCCCTATATTTGTTTCATTTCTTTATTTTCACTCTATC
TTTATTTTTCTTGATGCTCAGGAATCACTCCTGGTAGGGCTCATGGGACCACACAGGATG
CGGGGGATTGAATCTGGATTGACTGCATGCAAGGCAAGCACCCTATGTGCTGTCTCTCAG
GTCCCCGTATTTTATTTCATATTTTTAACTACTTTATTTTTTCTGGTTTTAGTCCAACTC
TGTGGTGCTTAGTATTCCTGGATCTATGTTCAGGGGTCACTTTTTTTTGGGGGGGGTGCC
ATTCCCAGCGATGCTCAGGAATTACTCCTGCTGGTACTTGGGGACTATATGGAATGCTAG
GGATTGAACCCAGGTTGGCTGCTGGCAAGGCCAGTGCCCTCCCTATTATACTATCGCTCT
GGCCCCTTCAGGGGTCACTTCTGCTAGCTCAACAATTCCTGCCTTTTTTTCCGAAGCGGC
ATAGTGATAAGATACTGTGAACAGTTTTCTCCATGAGTTCCAGAAGCTGCTAGATCAGAT
GCCTTCAGGGGTCACAGTGCTTGGGGAGCTGTAAGTGGTGCCAGGGATTGAACATAGGTA
GGCCATATGCAAGGCTAGCACCATCACCCTAGTATTTTGTCTCTGACCTACGTTCTTTTT
GTTTTTGGACCACATCCGGTAGCTCAGAACTTATTCCTGGCTTTGTGCTCAATGATTGCT
CCTGGCGGTGCTTGGGGTACTGACTATATGCAGTGCTGGGGATTGAACCCAGGTCTGTCC
CATATACAGGGCAAGGACCTTACCTGCTGTAATATCTCTGGCCCATGGCCCCCTTTCTAA
TATTTTATAATACCTTTTAAAGGAAAGAGTCTATGTCCACTTGTGTTACTCATTTGTGAG
GTTTCATTTTCCATTGAGTGATGGTGGGACTGGCCTTTGGTGAATAGTGGTTTTCCGTGG
CCACCATTTGTTTTAGCCTAGTGTTTGGTTGGGCTGGTTTGTAGAAGGGGGGGTTCCCTC
CTCATACTGGGCTCAGGGGGTGTGGTGTAACCCTGTGCCTGCTCTATGATCCTCTCCCTA
TGTTACAGGACAGAGAAACTTAAGGTATTCCCTTATATCCCAGGAAGATGGTGTGATCTT
GGGTGTTTCAGGCTGATCCAAGATAAGGGCCACCATGAGTATCATATCACCCCGATCCTG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
CATGATGTAAAGCCAGGGAAAACGCTCCCCAGTTTCTTTTCTTTTCTCCCTCCCTTCCTT
CCTTCCTCCCTTCCTTCCTTCCTTCCTTTCCTTTCTTTTTTTCATATCCAGCTGTTCTCA
GGGCTTATTCCTGGCTTAAAGCTCAGGAATCACAATCACTACCAGGGGCTGGAGTAATAG
CACAGAGGGCAGGGCATTTACCTTGCACGTGGCTGACCCCAGTTCAATTCCCAGCATCCC
ATATGGTCCCCTGGGCACTGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGGGTAATCCCT
GTGCATTGCCGGGTGTGACCCAAAAAGCAAAAAGCAAAAAAAAAAAAACCCAGGAATCAC
TATCAGAGGGGCTTGGGGGACCATATGGTGTGCAGGGATTGAACTCAGGTTGACTGCATG
CAAGGTAATGCCCTACCCACTGTAGTATTATTCTGACCCAAAAGTGCTCCCAGTTTCTTT
TGACAAGAAATTTTACAATGTAAAGTCACTTTTACTTGTTTAATTGGTATTGGTGATGTA
CTTAGGAGGTGCTGATCTTCCCATTATGCCGACATCCTGAACCCTTGAAGGCGCAGGTGG
CACTTGGTCGCACCCTCAGTACCCACAAGGTTGCTCCAGGTGTGGTTTGCTTATCTCCTT
AGAAGACCAGGGAGTTTTCTTCCGGAACTGACATGCCCTGGGGAAAGGCTGCTGCTCCTT
GAGATCATAGGCCCCTGGATTCTTGTCACCATGCTTGAAGGAGCACAGTGCCTTGTGGTT
GCTGTGACTCCAGAGGTAATGACTGGAGACACTTGATGTGGCTCCTGCTTGCCTTTGCCT
ACCCAGTAGTTTCCAGGGCGAGGGTCTCAGGGATAGGTTAGAGATCCAGTTCTTCCCTGA
GGGAAAAGTGTCCGTGTACCCTAGCATACATCACGCTTGATAGTCCTCAGGAAAAATGTC
TTTCACATACAAAGTGTTTTCAGAGCTGGTGCTCAGCAGCAGAGACCCTTTCCTTCTGAG
CAGCACCTTCACACTCCAGTTCTGTGTTCTGTGGCTGTCCGTGTCTCACAGGCACGCAGC
TGTCCCTGCTTGTGAGTGTGGGGTACGGGCGCGATGCCCAGCACTGACCTGTGTGCTGCC
CACAGGACTGGGCCGCGCCCGGCCGTTGCAATGTCTGCCTCACGTCCTACAAGCAGTTCT
TCCGGGGCTACGGTGCCTTCACGCGGGCACGCTGGCGGTGCCTGGTCATCGATGAGATGC
AGCGTGTGAAGGGCATGAGTGAGAGGCACTGGGAGGCTGTGTTCACGCTGCGCAGGTCAG
TGTTCTGCACCCTTCCCCCGTGAAGGGTGCTGGGAGATGATTGGTCTTTCACGTGGTCCT
TCTGTGCCCTTCCCAGTGACTCACTGGTCTGTCCCTTTTCTCCACAGCCAGCAGCGGCTG
CTGCTCATCGATGCACCCCTGCACAACACCTTCCTGGAGCTATGGACCATGGTCCACTTC
CTAATTCCTGGCATCTCCAGGCCATACCCGCACTTCCCTCTGAAGGCCCCCAGTGAGGAG
AACCAGGATTACTACCACAAAGTGGTCATCCGGCTGCATAGGGTCCGTGAAGCGTGTCTG
CATGATTCTTGCTGTCTATGCCTGCACCTCACTTTATGAAGAAGTCACAGTAGTGCTTGT
TTCAGGTGACGCAGCCGTTTATTTTGAGGAGGACGAAGAGAGATGTGGAGAAGCAGCTAA
CGAAGAAGTATGAGCATGTGCTGAAGTGCCGCCTCTCCAGCCGACAGAAAGCTCTCTATG
AGGATGTCATTTTGCAGCCCGGGTGAGTTGGCATGCTCCTGCTCCTTGAACCTGCCTTCC
TTCTTTTCTTTTTCTTCCTTTTTGGCTCACACTCGGTGGTGCTCAGGGCTTACTCCTGGC
TCTGCACTTGGGAATTAATCCTGGTGGTGCTTGAAGGGACCATATAGGATGCTGGGGATG
GGACCCGGCTCAGCTGCATGCAAGGCCCTCCCCACTGTACTATCGCTCTGGCCTCTGTAC
TGTTCTTTGTGGCCTCCCGGCACAGGCCGTCGTCACAGCTTCCTGTGTCAGAGACACTGC
ACTGGGTTGCTGACACATGCAGCCTGGACATGGCTCCCCCATCACCATGTGGATTGCTGT
TGAGGTGGGGGCAGAAGACACGTTGTTATGGCCCAGCTTGCACCATATTCCAGGGGCCCA
AGGCCCAGATGGCTGCCCAGACAGGGACTCGGTCGGAAACTGAAGCCAGAAGCAGACCCG
TGGCAGCCACCCCTCCCTGAGCCAGGGGTTCTGGCTACCTGTTGGCACGGCCTGCCCTTT
TCCCTGCTGCACCATAGGGCCTCTCTTGCTGCAGTGAGTTCAGGAGCTCTCCGACCAGTC
GGGGATTCAGATGGACACCCATCTTCACTATCAGCCAGGTCCAGGGCGGGGGTGCGTGCT
GCCATGTGTGGGCTCGGCCCCGCCCCAGCGCCTGGCTTGTCTCCCTGCACAGCACCCAGG
AGGCTCTGAAGAGCGGGCACTTTGTGGATGTGCTGAGCATCCTCCTGAGGCTGCAACGCA
TCTGCAACCACCCAGGACTGGTGGAGCCCAGGCTCCCAGAGTCATCCTACACGGCAGGGC
CACTGCAGCTCCGCTCGGCCTCGCTGGTCCTGAAGGCACTGGATGGAAATTCCTGGGAGG
TGAGGAGGAGCGAGGGGTATGGGAGGGGTGGGGCCTTCGGGAAACAGCATAGTTTGCTTT
GAAGGATTGAGAAAGTGTGCTTTCGCTCCTCTGGACCCAGGCACGACTCTGCTACTTATG
CGTGCATGTAGTGGGCTGCCACGTGCTGTGGTAGGTCTGGAGACCTCGAAGGACCTGCTT
TTTCTCTGGGTGTGGGGCTGGCTCCTGGGAGCGGGACCGTGCTTACTTTGCTGAGTGCTT
CTTGGTGCCTGGTTGCTCTTGGGCCCATTGCTCCTGCCTAGGACCACAGTGAATGGGGCA
GCTCCGAGCTTGCTTCCTTGGGGCTCCTGCCGCTTGAGGTTTCTTTTGTCTGTCTTTGTC
TTCAGTTTGCTTTCATCTTTTGCTTCTGGCAATGCCCAGAGATTGCATCTGGCTTGTCCT
TGGGGGGGCACTCAGGGTGTTTAGTGACCAGGTGGTACTGGGGTCAAACCCATACCTCCT
GCTACGTGCATGTGCTCAGACCATTGAGCTTTTTTCCTTTTTCGTAATCATATTTATATG
TAAGGTCAGATCCATTAAAATGGTAGATTTATCCTTGAATGATGAAAATTTGATGTTTTT
TATTTTTTGTTTAATTTGATGAGTTTTTAAACAAAAGAAACCACAGCCTTCGGTTGTATT
GGTTTTGGTATTGGATTTTGGGCCATTTCCCACAGTGCTTAGGGCTTACTTCTGACTGCG
TGGGGTCAAACCCCAGCGGGACTTAGGGGATCATATGTGGTGCCAGGAATGGAGCCTGTC
AGTCATGGGCAAAGAAAGCAGCTTACCTGCTCACTGTCCCATTGCTCCAGTCTTTCGGCA
GTTACTTGCATAAAGCGCGTTCCTGTTGGAGTGACCAAAAGGACAGTGCACTAGGATCCT
GGGTTCACAGTGTTATGGGCCACCTGAGTCTGTGTGTGGCCTCCAGGGTGAGGGGGACAC
AGTTGCCATATGCCCTGCTCCCACCATGCTCAGCAACTCACTGGCCGAGTGGTCTGTTGG
GAGACACAGGAGCTGAGTGTGTGTCCAGCAGGGGCCCTGCACATATAAGCAGATGCCATC
TTCTACCGCCCAGGACGTGGGGCTAGGCGTGGAGGCCAGGAGCTGCTGTCTGCATGGTCA
GCTGTGGTTCTCCACCCTCTGGCACAGCAGCATTGGGGATGTCACCCTGCCAGCTTAGTC
ATCTCATAGAGGGCCTAGTCTGGGTGTCTAGCGGTACTGCAAAGAGACTTCTTCCCACTC
TGCTCAGGAGTGACCCTTGGTGTCACTGGGGGGGGAGCCATCTGTGTGCTGGGGGTCAGA
CTGAGGTCAGCCACATGGAAGGCAAGCACCTTACCCTCCACACACATACACCCATACTCT
GTCCAACCCCCTGGGCACCTGCTTTCGATGAGTTAGAGGAATGTTAAGCCACACGAGAAG
TCAGGTTACCAGAAGGAATTAGACGTGAGCTGTGTCTCTCATATCCTAGTTTCTGTCGTA
AAGTCATTTTATTAAGAGAATCCAAGCCCTTCTGTTTGCTAAGGCTGCAGGATATCAGCC
TCCGTGTGCATGGGGTTATGCGCGCCATAGCTCCTTCCTTCAGTGCGCACGGGGCTAGAC
GCTCCTCGTCGCTCTTTCCTTCTGCCTCGTCTTCCTTGCATGCACTGCAAGTGACTTTGT
CATCCTTTGAGGCATTCCTCTTTATGCAGCCACATCTCTTTCCACCTAGGAGGCTGACCT
TTCCATTTTCGACCTCATCGGCTTAGAGAATAAAATGACCCGCCACGAGGCCGAGTTGTT
GTGCAGGAAAAAGGCAACCCGGAAACTCATTGAGGAGCTCTCCACTACACCGCCCCCCAC
ACCCCGGCTGGCTGCTGTCAGACTGAAGCCCAGCAGGTGTGTGAACAGGCCAGCACTTCT
GCTCCCTGCTCCCCCCAAAGGGCCCTGGATGCCCAGAATATGAACCAGGCACCTAGCCAG
AGGCTCAGGAGCTGTGTGGTCTCCCCCTCACCAGAGATGGTGCCATATCTCTGGTTTCTG
TGAGAAAGCCGCCTCTGATAGCCGCAGTGAGTGTGTGATCCCACCTCCACCCCAAGGTGG
GCTCTTGTTTGCTGTCCCAGCAACCTTTGGGGTTAGAAAATGTGTGATCTGTGCACGGTG
ACCTCTACCATCTCCAGGGGGCTTGGGGCACCCCTAAAGGACATATTAGGTGATGAAGGG
AAGTGAATGATTGAAGATTGGCCCAAGTTGGACATAATCCTGAACTCTGAACTCAGGAAA
AAACAAGAAGGCAAAAATAAGTCAGGGCAGACTGCAGATGTCAGCTTTCCCTGGGACACA
CTTGCCTTGTCAGCATAACAGGCTCCTGTCCAACGTGTGCTCATGGGCATTTGCCACTCG
GAGTTTTGGGAGGGGCTGTCTATCTGCTGTTGGACCCTCATGGGCCTGCCATGAGGGCAT
CAGGAACATCTTTGAAAGGGGCACACTGCAGCATTATTATGAAGAGGCTGCCCATGCCAA
TGTGTTGGCCCTCCCCACCCCAGCCCAGCGCTTCCCCTTCCACACCCTCTGCTGCGATTT
GCCCATGTGCATGTACTGGAGGGCACTTCTGACCCTGCCACTGTGCCGTTGACAGTGCGC
CTGGGCTGGTGGTTGTACTCTTTATGCGGGTGTTCTGGGTACTGTCACCAATCCCCAAGG
ACTCGGGGGAGTAAGGCACCTTATCCCCACCTCACTGTAGGCCATTTGGGAGTGAGACCT
CAGTTCTGCCCTCTCCTGGTCGATGCATGAGCCTCTAACTCTTTCTTGTCTTCTACACCA
ATGACACATCTAGGTTGTTTCAGCCTGTACAGTACGGCCAGAAGCCTGAGGGGCGCACAG
TGGCTTTCCCTAGCACACACCCACCCCGGACTGCCCCCTCCACCACAGCTCCTGCCGTGC
CCCAGGGCCATGTGCGAGGTCGGCCACCGATTGCCACGTTCTCTGCGAATCCAGATGCAA
AGGGTAAGCTTCCCGTGGTGGTGTGCTGCTGCACTGCTGCACCTGGTGGGGGCTTTCTGG
GGAGAGCAGTGACTGTCAGAACTGTGACGGAACAGGGGCACAGCCAGCTGCTGCCCAGTT
CTCTTCCTCCTCTCTCCTGGGCTTTTTCCCGGAGCCAGAACTGTACATTGAGTTAGCTGT
GGCTATGGTGAGGAAGATGTGCCTGGCTGGCAGATTCGTTCTCTTTCACGTAGGTAAAGG
TCAGTTGTTTGGAAACTCCTGATGATGTCTGCTCTGTTGTGCTTTGTTTCCTCACCCCAA
CTCCACTGGTCATTCCCTTGCAGAAGGAGAAGGCTAAGGGCAGACCAAGCAGCATACTGT
TCTGACGCATCCAGTGCCTCTCAGGCGTGTGTACAGAGGCAGGCATGGTGCCTGTGTGCT
GTGTCCCAGTGAAGAGGGCCTCGCCTCATCTCCCACATGCCGTGTGCCACTCAGGGGCAG
CTCTTGGCCAGTGAAGACAGGCCTGGTGGCTGCCTTACCTCCTCCTTCTGCGACGGCGTC
TGTTGGGAAACAGTGTGAAATAACGTCTGTTTCGTTTCTTTAGAGTTTGGGTTTAAGCAC
TGCGTCTGATTAAGCACTTCTAACAGCTTTGCACAAACAACCCTTATCGATTACAGCGGC
AGCCGCCCCGTTTCAGACCTCTCAGGCTTCCACCAGTGCTCCAAGACACCAGCCCGCCTC
GACCTTCAGCACAGCACCTAGCCCAGCCCATCATGTGAAACTCCGGGCTCAGACCACTGC
CCCGGCCTCCAGCCCGGGCCCACCCCAGCCCCAGCCCCAGGTCCCTCACCCAGCCGGGCA
GAGCACCCTGCTGCAGGGGCTGGTGCACACCTCGCAGGCCCAGGCGCGCCTGCCGAGTAA
GTGGCCTTGCAGTGCATCCCGCACCTCTTCCCCAGACAAGCTGTGTTCAGACCAGCTATG
TGTGAAGAGCCTTTGCTGTCCACTTCCTTTCTCTTCTCCCCCACCCAAGTGCTGCCTGAG
TCTGAGGCCAGCGTCCAGGCCTGCCTGTCCTCTCGGGGTCCTTTCTCCGCCCCCGCGTGT
CCACTCTGCTCGTCTCCTGCACTCGCACACGCACGCTCTCTGGTCGCGCATGTGTTCGTC
AGCCCCAGGGCTCACTTTGGAAGCAAGGCACAATCAGGTGAAAGCCATGCCTGTGTAAAC
TAGCCTTGGAGCTCTCAAACCCTGACATCGTCTCCAGTGACTGCCTGTAGCCAAGCTATC
TGGGCGGCTCGCTTAGAGGCGTCATGTGGCAGCACGGTTGCTAAAACATGTCAGTTTTAT
GGCAGTGCCCAGATGGCAATGAGGCCTTTGGAAGAAAGACCCAGAGTGAGCTTCCGTGAC
TCGCCCTTCTGCATGGAGGGCATGATGTCTCTCTGATGCCCTTTGAGCACTTACTCATGG
CTGACGAGCTATGCTGTGGCTTCCGGGGGCTGTGGGGTGGGCTAGAGGGCGTGTTGAACA
TCAGGGGCCACTGAGTCAGGACATTTCTTTCCTGTTGCCAGGAGAGAGGATGAGTCTCAT
GCAGAGGAACAGCCCAAGGGTAGACGGGTGGCCGTGGCCTTCTGCTCGGGTGGGAATCTG
TCTTGATGGGTCTGTGCGTGGGGGCTCTCAACATGCCAGGGGCCTTCTCCCTCGGGAGCA
GGGCTGCATTCCTGCACACACACATCCCTACACCGGTTTTTTCTTCCTTCCCTGGGGGAC
AAGATGTCATGGAATCTTTTTCTAGTCTTTTCTAACCTTTCCTTTTCTTATATCACTAAT
GATTCTGGCATGGATTTCCTGGGGAGAAACAGAGACTCGAATATCAACCCTAAGGTTCAT
CTCTGTGAGACATCTCCGTCACACCTGCAGCCTGTGCTTTTCTGGCTAGGGTGCATATGG
CTCAATCCAAGTGAAGTTTAAGAAAACTGGTTTAAACACTTTTTTACATTTTGCATTCTT
CGCATAATCATTGTAGATTACTTAGTGTCTGGGTCAAGTTACTATGAAACTTGGTGTCTT
TGTGTGACGTGTATTTGTGTTTTAACACCTTGATTTCTGCAATAATGAACCATATTCAAT
GTGAGCCATTGGTGACCAGTGCCAGTGTCAGTTTTTAAATACATTTCCAAATTTTGAAGA
GGTTCTGGGTATGATTGGACCTAGTTTGTTATTCCATGTGTGGTGGTACCATCTCGTTCA
CATAGGAGCGAAATTGGGTATATGCTTTAAACATTTGGAAAGTTGTCTACGAGGTTGATA
TGAGAGTTTCGAGTATTATTAGTCTATCTCTGCTCTTTCTGGTCTTTGCTCCCTTTTTTT
ATTGGCTGGAGAGAAAAGTGAAATGTTCCTTAAGTTTAATTCCTATCTAGTATCTGAAAT
CCTACCAGCGTTGTCTAAGTCAACCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATGAAATTACTACGAGCGTGGTGTAAGTCAACCCTCACCAATGCGTTTGTTC
ATTGGGATTGTTGTTCTTTTGTGTAAATATTTCCTGAAAGTGGTAGGAAGCACTTCAACA
GTGTTTCTTGCGCTCCCGCTGACCAGAAACGAGCGGTGGCTCACACACACTCTTGCCATC
GTCCTTTTCTCTGCCTTCCCTCAGGTGGCGAGGTCGTCAAGATAGCCCAGTTAGCTTCCC
TCTCGGGCCCACCAAGTCGAGTCGCACAGCCGGAGACCCCTGTGACGCTGCAGTTCCAAG
GGAACAAGTTCACTCTGTCCCACAGCCAGCTCCGGCAGCTCACTGCTGGCCAGCCGCTGC
AGCTGCAAGGTGAGCAGCACAGGACAGCCTGATGCCTGGCCCGTGAGCAGCTTGCAATAA
GCCTTGCCCACTGGAGGTTGTCAGTTTTGTTTCTGGTGACCTTTTCTGTTCTGGAGGGAC
ACACCCAGTGGTGCTGGAGGCTGTCCTGGCTGGGGCTTGTTCCCAGAGATGGAGAGGCTG
TATGCACAGGCTGCACACGTCTCCTGGGGGTGTGGGGGAGATGTCGGTTCTTTCCTTCTC
GCTCTGTTTTGGGAGGCTATGCTTAGAGGCTAGTGCTGGCTAATGTTCAGGGGGCCCTAG
AGGGTGCTGGGGATCTGACCGGGGTTGGCCACATGCATAGCAAGTGCTTACCCCTCTATA
CTTTCCAACTACCAGCCAATTCTTTAATGGTTTCTGCTTTTTGAGAAGAGTTTTCTCCTT
AAAATTGAAGTAGAGGACTGGAATAATAGTACAGTGGGTAATACAATTCTTTTTGCACCC
AACCAGCCTTGAGTTTGATCCCCAGTACTACATAACTTTTCTCCGAGCCCATCTAGGAGT
AAACCCTGAGCACTGCCAGGTATGGCCCCCAAACAAAACAAATAAGAAAACCCACCAAAA
CCCCAAAATTGAAGTAGTTACTACTTTCTCATTTAGTGCTCTGATTTGTCTCGACAATAC
CAAAAAAACCTGACTTTTTCTAGGTAGAAGTGTTTGTTTCTGCACTGATCTTAGGATTCC
AACATTAAGGACTTTGTGTAGAACGTGTATCTAGGTTCAGAAGAGAACAAGGGATGTGTT
TCATGACCACCTTCCAAAGGGTCCCAACCCAATTACAGAGTCACCATGTTCCTTATTTAA
TTGTCATTTAGACAAGGAATTGTCCTGTGTTTTTCTCCAGGTGCTTTTTTTTTTTTTTTT
TTTTGATTGATCGGGTTTTTTATTTTGGACCACACCTGCAGTGCTCAGGGCTTACTCCTG
GGTTGAACTTCACTCAGCCACATGCAAGACAGAGTGCCTTAACTCACTCTCCAGCCCCAT
CCCCAGGCTTTTAAATCAGTCTTTACATTTTTTTTATTTGGGGGCTGCGCCTGACGGTGC
TTGGTGGCTCATCCTAGCTTGGTACCTGTGTTGCTCCCTGTGGTACTTTGGGGAGGACTA
CGCAGTGCTGGGATTTACCTAGACTGCGCGTGGAACGGCTATGCTCAGCTCACTGAACTC
TGCTTCTGGCCCACTTGCCATGCTCTCAGTCTGACTCAGAGGAGCTGTCTTTCATGTCTT
GGCCTCTGAGCAGTTGCAGAACATGTTTCTGTCTCGGCAAGGTGGGGGATGTCTGGGGTT
CATAGAGCCCAGAGAGGAGAGTGAAGCACTCCTGTGCTTTGTCCAGCTTTCCGACCCAGG
AATGAGACCTTCGTGACAATCTCTATTCGAATGGGCTTTTATTTTATTTTATTTTTTAAT
GTCTTTGTTTGGGGGCCACACCCTGCCGTGCTCAGGGCTGAAGTGACCATATGTGGTACC
AGGGAAGAAACCAGCCTCTGCAGGGCAAACACCTTAACCCCAAAAGCTGTCTCTCCAGCC
CCTGAGCTTTTATTTACTTGTGGTGACCATGCGGCGGGCCTGCGATGAACCAGAGAAGTT
CTCCTTTTCTGAGCTGAAATGCCAGGAGGAATCCACCCTGAAGGCTGGAAAGGCCATGAT
CCTTCCACAACCCCTACAGAACCTCCATTGTGGGTGCTAAGAGCCATGCTTGTAAATGTC
TTTTCTTCCTTATAGCTCAGGTAGGCCAGTATACAGTGCATGGCTAGGAGCTGGGACTGA
CTTCTCCCTCCAGCCCTCGAACCCATGGACCTCTTTAGTGGGTGGGGTGGTCATCCCCTG
CCTAGAATGAGAAACCAAGGAAGATAAGGTGGCATTGAGCAGAGCTTAGTAAGTTGCTTC
AGTTCCTCATTGACTGAATTTTTTATTTTCCTCCGAGTGATGGAGCTTTGGGCTGGCTGG
TTGGATTCCTGCTGACCCTGGAGCTTCTGTCTCTTGCCTTGTTCTGGATGTGGGGGTGAG
TGTGGCTGCAGCTTCCATACCCCGCCTGATGGTACCCATGACTGTTCTTGCAGGCAGTGT
CCTCCAGATAGTGTCTGCCCCGGGCCAGACCTACTTGCGCCCACCAGGACCTGTGGTGAT
GCAGACAGTGTCCCAGGCGGGGGCCCTGAACGCCCTTGGAAGCAAGCCCCCAGCCACCGG
CCCTGCACCCTTGAACTCGCAAGGTAGGGTATTTGAATTAGGAAGTCCAGCAGAAGCTTC
TCTGGCTGGTGGCATCCCTCTTCAGTGCTCACCCAAAGTTACTGGCTGGTTATTAGTAGG
CTTCTCTCACCCTCATTGTTTTCCCTTTAAATGAAGCTCTTGAAATAAAAAAAGTCAATA
GAGCCATTTTGGGAGTCACACCCACCTTAGGGGTCAGACGGGAGGTCAGGCTTCAGCATA
GGGGTGGAGACCGGCACTCTTTGGAAGGTGCATGTGGGTGAGGACAGTGGGCAGCATTGG
GGGTAAGGGGCTCTACACTTCAATTGGTGACATTCACTTTTGTAGTTGGGGTTCCTGGTC
GAGCGACAGCTAACCCCCTGGCTGCAGGAGAACCCGGAATGGCCCCTAAGCCAGCTTCAC
CCATCGGAGGGCCCAGCCAGGTAAAGTACAGCTTCTGACAGCTGCTATTTTACAAGGGGT
GGTTGTTGCTTTTTTCCCTTCAAAAATGTCCTGGTGGCGCGGAGCAATAATACGGTGGGA
AGGCCGTTTGCCTTGCACAGGTCCAACCCAGGTTGAATCACAGCACCCCGTATGGTCCCC
TCAGGGTTTCTGGTGTGGCTCAAAAAAGAACAGGGAAAAAAATATGTCACTTTTAAATTT
TGTTATTTTTGTTTGTTTTTTTTTTTTCCATATTTTTGGATGAAGGATCACCCCTTGGCA
GTGCTCTGGGGTCTGTGTGGTATTGGGGTCAGTCCCAGAGTCCAGTGTACAAAAGCCTGG
ACTGTCCGTTGAGCTGTTTCCTGGGCCCAGAAATTATGAAGACATTTTTCTAATGAAAGG
AAGCAGCTTTGGGGGCCAGGAGATAGGGCAGCGGTCAGGCCACAACCTAGCAGGCCCGGG
CCAGGTTCAGTCCCAGCATGCCATGGTCTCGTGAGGTTCACTGGGTGTGACTCTTAAGTC
CCCAGCCTCTCAACCTCATGCCCTTGCGCTGGACCCAGTTCAGGGCCCAGTTGCCTGAGG
CGGAGGAGGGCGTGGCCATCATGGAGCCCTGTTTGGGAGATTACCCTGCCCCAACAGAAG
GTAGGCATCTGGTTGGAATTGCAGAGTTCTCAAGCTTGTGTCTTGGCTCCCTCCTTCCCT
CAGTGCCCCGGCACCCCAACAGGCAGTGCCACATCAGCCCTTGATGCTATATCCCCCAGT
GCAGGGTGGTACCTGTGCTCTGCACTCTGGAGCCTGGTGCGGGCGGTCTGCTGACAGAAT
GTAGCTGTGCTAGTAACCATTTCCCTCCCTCTGCCTGTGGAAGGAGGAGAAGAGCCGGCT
TCTCAAAGAGCGCCTGGACCAGATCTACCTTGTGAATGAGCGGCGCTGCTCCCGAGCCCC
AATCTACGGCCGGGACGTGCTGGGCCTCTGCTCCCTGGCAGGGCCCACGCGCTCTGCTAC
TCCCCCTTTGCAGAGCCAGACAGAGTTGATCCTCACACTGGCCCAGCGGCGAGAGAGTCT
CCAGGACATCATGGACAGGTATGGGCCTGTAGACACTTGCTCTTGCAGTCACACACGCTA
CCCCGACTGTGTTCTGTAGCTACTCATGTCTCCATTCTCAGCTCTGGAGGGTCATGTGGT
CTGGGGTCTCCGTACCCTACAGCCCGAGCTCTTCTCTGTCCAGGTTAGGGCCACCTTGAA
GTGAATAGTGGGGCCCCTGTGGGGAGCAGAGTGCTGTGCTGTGTTTTCTCCGGTTCACTT
TGGGGGTAACTAAGTCCTGGTGCTTGTGCTCAGGTGTCGGGTGACTGTGCAGAACCTGTC
CACTGGCCCCCTGAACCATCATCTTCACCTGCTGGGGGTCATTTTCAAAATGGTGGCTTG
TTTCTGTTGTTCAGAGTTAGAGGTTTGCTCTCGGTTCGTGACATTATGCCTTGGTCAGAG
ACAGTCTTTGATTTTAGGCAAGTCCAGCTCACTGATTGTTCCTTTCATGGATCATGCTTT
TGGTGGTGTATCAAAAAAGTTGTCACCATAGTCAAAGGTTTTTCCTGTTGGCTGGTCCAT
GTTTCTGCATTTTAAGGTTTGTTTCTGGTGACTTGGTGAGAGGGTATATGGGCAACCACG
CTGACACTGATGGCGGAACCTCAGAGAAAGCCTGGAAGTTGGACGGTGTCAGGCCTGGCC
TGGCTGCCTGGCTCTCCTCCAGTATTGAGCTGGCTGTTCTGGGTGTTCTGCCTCCCCATG
GGGACACCAGCTCTCTCTGGCCTCTTTGCACTGCCACTCTCTGGGATTCGATGGAATCAC
ACTGAATTGATTCATGAAGCTGGGAAGAACTGCCTTGAAACAGTGCCTCGTCCTCCTGTG
CATGGACATGGATAGACCCCCCTCCCACGCCCTTCCTTCCCTCCCCCTGTCCAATTGTGC
CCTGGGCTGTGTAGTCTGGCATGTGGTGGGTGGTAGCCAGTCAGGGAAAACCGTCTGTCT
TTCCTCCTAGTGGCCCAGGGCCACAGCAGCTTCTAGTGCACAGCTTCCCCGGCCCTCCAG
GAGACAGCAGCAATATTTAGTGGACACACCATATCTTGTACTGTGGCTTCAGGTGGTTTC
TGTGTAGGCCAGTGGTCCTGTTGCCTCTATGTCACTGGCGTTGGGTCCCCTTGGTCGTCT
TTCCTCTCCTCCAGGACAGAGATGTTGCATAGTGTGAGGCGTGTGGTTGGGTGACAGGGC
TTGTGTTCTCTTCCTCAGGGTGCTGTGCGTGATCCCTGCAGTGGTTGCCGCACCCCCGTC
CTTATGGGTGGCAAGGCCGCCCTCCCTCTACAGCCACAGAATGAGGCTCTTTCAGCACCG
CCTGAAGGAGCACACAGCACCCTATGCCCAGCAGCTGCAGCAGATCACAGCCCTGCGCTC
ACTGCAGTTCCCCGAGCTGCGCCTGGTCCAGTTTGACTCAGGTGGGAGATCAGCCCCACC
ACAGCCCCGCCTGCTCACTCAGTGTGGGGCCCTGTTGCAGTCCTGAGGCACCTCTGGCTC
CCTTGCTCCCCAGGAAAGCTGGAGGCGCTGGCCCTTCTGCTGCAGAAGCTGAAGTCAGAA
GGGCGCCGGGTGCTGATCCTGTCTCAGATGGTCCTCATGTTGGACATCTTGGAGACCTTC
CTCAACTTCCATTACCTCACCTATATACGAATTGATGAGAATGCCAACAGTGAGCAGCGG
CAGGTATGGAGGAAGCTTGGGGGCCACGCTGGCACCCTGAGGTCCAGCCCGGCTTGTCTC
CTGCTCCCTCAGCCTTACTCCAGGGGCTTTTGCCTGTAGAGTGCCCTGGCATTGCCTGAG
GGTACAGGAAAAGCGCACTTCCCTCCCCAGGAAGACTGTGTCCACTGGGGCCTACAAGGT
GAGCTGACAGCCACTGTTGGGTAGGATCTGACCTCGGCTTCCTCTGAGCAGTGAGGAGAG
ATGTTGGGGTCAGTGAGAGCCAGAATTAGAAATGACATTGCAGTTTAGTTTGGGAAGAAT
TCCTAGCTGATGAGAACCAAAAAGCATCAGAGTTTTCCAGCTCTTGTCAGGAAGACTCAC
GGCTCCATGTGGCCTCTCCTCAGGAGCTCATGAGGAACTTCAACAGAGACCGGCGGATCT
TCTGCGCCATCCTCTCCACCCACAGCCGTGCCACTGGCGTCAGCCTGGTGGAAGCAGACG
CAGTGGTATTCTATGACAATGACCTCAACCCTGTGATGGACGCCAAGGCCCAGGAGTGGT
GTGACCGAATCGGGAGGCGCAAGGACGTGCACATCTATAGGTGAGGGGCCGAGGGCCACT
TGCTGCGTTTGCTGTAGCTGTGGAGCCCTGGCCGGGGTATGTGCTCACAGTACCAGAGCA
CTCTGGAGAACTGTCCCCTCTTCTACCCAGGCTTGTCTGTCCTGTCCCTGAGCATTGCCC
TTGAGGTTGTGGTGTGGTTCAGTTGGGCTCCGAGGTAGGGAAGCCTCTGTACTGTCAGCT
TTACAAGAGAAGTTTCAGGTCAGAGAGAGAGGCTGTGGGAGGTGGTTCACCCAGATTTGA
TCCCTGCTTCTCCCGAGCACCCCGGGAGTAGGGCCTGAGTACCGCCAGCTGTGGCCCAGT
TGCCTTCTTCCTCTCCCCTGCCAAAAAAAGAGAAGGACTCCTATTTCAGGTTGTACAGAT
TTACAAATGTACATCTGTCAGTAAAGTGGCTACTGAAGAATTTAAATCTGTATTTGTCAC
TGACGTGTGGATTGGGAAGGGCCCTACTCTGACCCTCTGGGGAGGCAGGTGTGTGCCTCC
ACCCCTGGTGCTTCTCTCTGGGCACCTCTGCTCAGCACCAAACCTCCCTGTGTAGTGTGG
GCCACACCCGCTGATGCTCAGGGGTTACTCCTGGCTCTGCACACAGAAATTACACTTATA
TGGGATACTTGAACCCGAGTCAGCCATGTGCAAAACAAACACCCTCCCCACTGTACTGTC
ATTCTGGCCTCCTCTTCCTGTGCTGTTTTGCTTATGCTTTTCACCAGACGCTTGGTGTCA
CTTAGCCCCAGTGCTGTGTCACAGCACCTTCAGCACTCATAAACAGTCCTTACTAGAGGC
AGCCATTAGTCACATGAGGTCTGTGTTCCTGTTAGGTCTTCCGAACTATCCCACCACAAG
ACACCCCACAGCCCCTGAGCACATTAGCTCTTTTCCTCTCCGTCTGCCCAGTGTGTATCT
GCATCACTAGCTGTACCCAGTGGAGCAGGCATCCTCACTATGAGCCGTTTCCTCATACTC
GCCCTCTTTGAAGGCTCATGAGAAACGGGGAACTATTTCCCTCTCAGAAGAGAGCCCTCC
ACTTCAGACAGAGTCATCCAGGAGGACAGTGCTCTGAGCTTTTGACAATGTGACTCAGTC
TCGGGATAGTCTGAGAGGTCACACCCAGTGAAATAAAGCTCTGAGTGTAGTAGAAAGAAC
CTAGAAGCCAAGGTGTTTACGCCAGCTGGGGCTAGGAAACGGGCTGCATCTCTCCCAAAT
AGCAGTGAGATATGACCTTTGTTGTAAGTGCCACACTGAGACCAGCAGTCCAGGCCAAGT
GGGTAGCTAAAGTCCCCCAAATTCACCGCCTCACCTGCTGCCTGCCTGCTTCCTGGGAGC
AGTGTGAGGGTCTCCCGCATACAACCTGCTGTGGTGTTGCTGGTGACCTGTCAGCCACGA
TTGAGGCTCCTGAAATCCTCTGTTCTCACAGGCGAGCTGGGACCGTGTCCAGAGAAGATG
GGCAGCGGCTGTGGGGAGGTCAGAGCCTCTGGGCCTAGAGTCCCACGTAGGGTTCTACTT
GGGGTTCTACAAGCTCCCAGGGACCCACACATGTATGTGTGCTTTGCAGGCTGGTGAGTG
GCAATTCCATTGAAGAAAAACTCTTGAAAAATGGAACCAAAGATCTAATTCGTGAAGTGG
CTGCTCAGGGCAACGACTACTCCATGGCGTTCCTCACACAGGTGCTGCCCTTCCCTGGGA
GGTGGGGTCCAAGGACACATGGGTCCCTGATTGGGAGACACCCTCCCCAGCAGGGGTTAC
CCAGACTGTGGGCAGGTGTGAGCAGTGGGCCTCTTGTGTGTCCAGCGGACGATCCAGGAG
CTGTTTGAGGTTTATTCTCCTGTGGATGACACTGGCTTCCCTGTGAAAGCCGAGGAGTTT
GTCGTCCTTTCCCAGGAGCCATCAGTCACAGAGACCATCGCACCCAAAATTGCCAGACCC
TTCATCGAGGTGAGTCCTACCCAGTCCCACCGGTTTCCTGCCCTCTGAGTTACAATAAAG
GGACCATGGCCTCCGAGCCACTGTAAGGCCCAGCCTGCAGCGAGGAGCCCACCCCAGGCT
GCCACCCCCTTGTCTGTGCTTTTTCCCACTGTCCTTTACACTTTGCTTTGGGGGTTGGGG
GTTGGGGAAGAACAGCCTTGCAAATGATACTTACAGACCAGGGGCCTGTTCTGGCAGTTC
CCAACCAGTGGGGTCAGCAGGTTAGTGTTAGGACCCGAGACTGGCATGCCAGCCACCTTG
AGGTTTGGGTCAGCATATGGTAGCCCATCTGCAGAGATTTAAGAGGTGTTTGAGTCTTGT
CGAGCAGTGTTCCAGGCCTAGGTACAGTGGCTCCTGTACCTGCTTATGAGGACGGGCCTA
AAGGATCATGCTGGGTCACAAAGGAACAAGTGTGGGACCAGTTTCGTGTCAGGACAGCAG
GAAAGTATGTGTGACCCGGGTACAGGGCATGAGCCTGATGAGGGGCACGGGGTTCTTTGA
GGCTGTGGGTGAGGGTGCCAGGCCAGCACAGGAACGTGGCATGGAGAAAGGGGGTAGGAA
CAGAGGCAACATCGCTCCCACAGGGGGACAGTGGTGCCAGAAAAGGTTCCTTGTTGACGT
GGTGTCATGAGGACACATGGGGGGTGCCCATCACCCCCTAAGTGAGTCCCACCTACATCT
GCCCCAGTAGATACCGCTGGTGGCAGGGTGGCATGTCCCATGCAGGCTAGCAGCACTAGT
AGACTCGTTTTGGCTGCCCCATATGGTTTACTCCTGTTTGGGGGACAGGCTGAGCAGGAT
GCTGGCCGCCTTCTCTCTCAGACCACACATGTACCAGTGCCTTGGGAGTGCGGCCTACCA
GCCTGAGAAGAAGGTTCTGTGGTCATTTCTGTCCTGTGGTTACTGCTGTCAGGCCCAGGC
GGCCCTGGTGTGAAGCTGACAGCAACTAACAGGAGCTCGTGAGCTAAGGATAGCCTCACG
GCAGTCTGCATGATCCCCCAGGCCCTTAAGAGCATCGAGTACTTGGAAGAAGACACGCAG
AGACCCCTGGAGGAGCCAGAGCCCGGGGACCCTGGCAGGTGGAACGAGGAGCCCTCGCAT
TGGGGGGAGCTCGCGGACTTCATGGAGCAGGTAGGTTCCCCACTCCTCACACTGGGCTGT
GGGTGACCTTCTTTCTAGTGGCGTAGAAAGAAATGAAACTTAGTCACTTGCTGGTCACCC
ATTTCAAAAAATCTGTTTCAAAACAGCTTACTCCAATAGAAAAGTATGCTTTGAATTACC
TGGAATTCTTCCACACCTCCATCGAGGACGAGAAGGAGAGGAGCAGGGAGGTGAGAAACT
TGAGGGAGTCCAGGCATTGCTTGCTCTGTGCTCTGTGCTTGTGGGACATGAGGGACCCCA
GCCACGCTTGCTGGTATAGACCCGCTAAGACTAAGTGCTGTCCCGGGTAGCAGGCAGCAG
GCTCTCGGTTTGTCTTGGCCTGCCTCTATGCTGCTGACCAGTGCTCAGGGAGGCAGCGGG
GCCAGGCACAGGCCTTGGCTGAGACTTCCCCCACCCACCCTGGGCTCTCACTGCAGGATG
CTGTGCTCGCTGCGATGCAGGAGTGGGAGGCCCGGAATGCCAGGAGCCTGCAGGAGCAGG
AGGCCAGGGCACAGCAGGAGCAGGAACAGGACGAACTGCTCACCTATACCCGGGAAGACG
CCTACAGTGCGGTACGGGAGGGCAGGGGACTGGCCGGACTGTACGTGTCTGGCCCCTTGA
GGTGTGGTGGTCTGCTGCATCACCCAGTCTTGATTCACTGTCTCTGCGTGCGTGGACTTG
CTTGCTCTGAATATGATGCAAGAGTGTGTAGGTTCTAGAGTGATGTTGATAGCAGGTACG
GTGCTGGCCTTGCACATGCCCAACCAGGGTTCACTCCCCGGCACCCCGTACAGTCCCCTG
AGCACCACCAAGAGTCATTTCAGAGCACAGAACCAGGAGTAACCCTTGAGCATCACTAGG
TGTCACCCGACCCACCCACGCACAAAAAAATGTGACGGTGTCATCAACTCCAGCTGAACC
CCTTTTCCCCCTAGGAATACGTCTGTGAGGGTGCTGATGGACAGACGGAAGTCATGCCGG
TGAGTATCATAGCTCTGGGCCAGGTCAATTCACCTGCAGGGGAGTGGCAACTCACTGCTC
TCTCTCCTCTCCCAGCTCTGGACCCCGCCCACGCCACCCCAGGATGACAATGACATCTAT
ATTGACTCGGTCATGTGTCTTATGTATGAGACCACACCCATCCCTGAGTCCAAGCTGCCT
CCCGTGTATGTGAGGAAAGAGCGCAAGCGGCACAAAACGGACCCGTCAGGTATGTGCTGT
GTCCGTTACCTCTGTTCGGGAGCAGAAATGGGGCACTGTCCCCCAGTGCCTGGCTTCCTG
AGTGCTCTGCCTAACTTCTCCCTGCTATGGCTTAATGGAGACGCCTGTACTCAGCTGCAG
GGAGGAAGAAGAAGCAGCGCCATGGGGAAGCCGTCGTGCCCCCTCGGTCCCTGTTTGACC
GTGCCACACCAGGCATGTTGAAGATCCGTCGAGAAGGGAAGGAGCAGAAGAAGAACATTC
TGTTGAAGCAGCAAACACAGTTTGCCAAGCCGTTGCCTACTTTTGCCAAACCTACAGCAG
AGTCTGGTGCAGACAACCCTGAGTGGCTCATCAGCGAGGACTGGGCGCTCCTACAGGTGG
GCCTGGGAGGGGGACTTGGCTTGGGTCACACTGACAGTGTGCAGGGCCTGCTGATCCGCT
ATGCCTGAAACTTGTCCTCAGGCTGTAAAGCAACTTCTTGAGCTGCCACTGAATCTCACA
ATTGTGTCACCGGCTCACACACCCAACTGGGACCTGGTCAGTGATGTCGTCAACTCCTGT
AGCCGCATCTACCGCTCTTCTAAGCAGTGCCGCAATCGTTATGAAAATGTGCTCATCCCC
AGGGAGGAGGGCAAGGTACGCACAGAGGCCCGCTTGCTGGCTCCAGCTTCCAGCCCTGGG
GAGAACCCTGGGGCCCGTCTCACCAGATCCCGAGACCAGCGCTGATAAAGATGCAAAGTG
GTTAGGAGGGTTCTTAAGTGCTGAAGGACCCTGGGTGTAGTACTGGAAGAAAGCTGGCAA
TTGAGTGGCTGTGATGAGTGGTCCAAAGTAGCCTGTGTTCTGGTCCCTTCACCTTTAGCC
ACTGGCAGAGTCCCTGGGAATGGGTGTAGGTGGCTCCAGTGACTGTCCTCTAGCTGGAAT
ATGGGCCTGCGGGAAACTGACTCAGGAGGCCTGTCCTGGGCCACAGGTGCTGGTCAGTAG
GGTCGAATTCCTCAGGGTGCTTTTGCTGGGGGAACAGGGAGGCCCGACTGCTCTCACCAC
TTTGTTTCAGAGCAAGAACAATCGCCCTCTGCGCACGGGCCAGATGTACGCCCAGGATGA
GAACGCCACACACACCCAGCTCTACACCAGCCACTTCGACCTCATGAAAATGACGGCTGG
GAAGAGAAGCCCCCCTATCAAACCTTTGTATGCATCCCAAACTCTGGATGGGTGTACGGA
GGTGGGGGCTGGTGTCCCCTACCTCCCTGCTTCATGACTCTTGCTCTTCTGATCTGCAGG
CTTGGCATGAATCCCTTTCAGAAGAACCCCAAGCATGCCTCCGTGCTGGCAGAGAGGTGC
GTGCTCACACACATGGATGGGGGCTACAGGGGTGCTGCGCCTCACTCCGCCCAGAGACAT
CAAATTCTGGGCTGCTCTGCTCACTTGGCCGTTTAGCAGAGGAGGGAAGGGGTGACTGTG
AGGGGTAATCAGACTCAGTCAGGGCTTGGGAGTACAGGGGCATGCCTGCAAGTCGGCCCC
ACTTCCTAGAATCCTGGCATGTCACAGTAAAACGTGGGGAATGGTAGGAGGAAGGTGCTG
CTCTGCCCCCAGTCTCACTGTCATTTGAGCGAGGCCCGGTCACTCAGTCTGCCTGACCCT
GGCAGGGTGGCTGAGCGGTGTTATTTGAAACCTGCCTTCTGTCCCTTCCTCTCGAGACTT
AGCCCACTGGTCCCTGTGGGTGCAGGCCCTGTTCCCCTTCATGTGGGGTCAGGAATAAGA
GTCTAGCCTCAGAGAACTGGTGGGCTCTGTCCCCTGCAACACCTGTAGGGTTCGTGTAGA
GAAGTCAGAGGAAGCGAGGCTTCTGCCCGTGGTAGTGTGGAAAGCATGGTCTGGGCTGTT
GTGCCTACAGGCAGTTATCCGCGTAGTTGCAGGAGACTTCCGTTGCCAGCAGAGCCACAG
CACGGGGGCCCTTATGCAGTGCGGCTGAAAGGCAGGCCTAGGTGAAGCCAAGAGGGTTGT
AGGGAGGCTGGGGTGGCTGCCATGCACCTGGGCCAGGCAGAGAGACAGACCCCATGTTAG
TGCAGGTAGATCTGTGGCTCAGGAGCTAAGCGGCTCTGCAGTCGGGCCCGTGGCAGAAGT
AGCTACCAGCCCAGGCTGAGGCGCACTGGAGGCAGGTGTGGTTCTGTTGGGCCCAGAGTA
GGCTTTCCTCAACACCAGCAGGCTGAGCACCAGGTAGGATGGGGAACTGGACCATCACAA
GGGTAGTAGTCAGTGCAGGGTGACCAAGGTCAGGTGGATCAGGGCCTGGCAAGAGGACAC
AGAGCAGGAGGAGGGGTCAGCCTCTGTGATGGAGGGTGCGTGCTGGGGTCCTGGACAGAG
AGTGGATTTCGAGCCAGGGGCCACCAGGGCCCTGGGAGCATCCATGTTGCTTTAGGCCTG
CACACCATTCTCAGATTCCCAGACCCTGGGGCAGGCAAAGGAGGGGGGGGGGGCTGGGCT
GCCATTCTCAGCTTCTTTCTGCCTGACTTTTTCAGGGGCATCAACTATGAGAAAGCCGCT
GCCTCTCATTCAAGTGGCCTCTCTTCGTGCTGGGCCCATCTCCAAAGAGAAAAAGGTATG
GGCACCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCCCAGGGCCC
ACCCTCACAGCCCCCAGCCCAAGGGCCCACCTGCCATTACCACGGTGGGCAGCGCCGCTG
TGCTGGTGAGCACCTGGGGAGTGGGGGCGGAGGTGGGTGGGGAGCACTTCTGAGGCAGGC
TAGGAGCAAGCACATTCCATGACCAGCACATTTCAGTGTGTGCCATGCGGCTTCGCAGTG
CCACACACTGAAGTGACTTGAGACTGGGGGGCCGCTGTGTCATGTAGATCCCCGTCATGG
AATATGTGTCAGGCCTGAGGAATGCATGAGCACTGGCCCTATAGAGGGGCAGGCAGAATT
CGCGCAGACGTGGTGTGTGGTACCTGAACTGGGAGTATGTGAACTTGAGGCTAGTTTGAC
CAAGAGATGACAACAGGGGCCTGGCAGAGGAATGAGAGCTGGACTGGGCCTCTCTCTGCT
TGGAGGGCGACAAGGGAGATCTTCAGGACATATGCAGGGGAGAGCTTGGCTGGAAATTTA
AAGTAATTCTCTCTAGCAGGCAGGTGCCTTGAAGACGTCGGTCACAGGGACGAGCATGCC
CACTGGTAAGAGGCGGTGGCCAGCCTTGGGGGACCCTTGACCTCGCCTGGCCTCATACTC
TCCCTCCACAGGTACCGTGAGTGGGAATGTGATCGTAAACACCATCGCAGGTGTCCCCGC
AGCTACCTTCCAATCCATCAATAAGCGGCTTGCCTCACCTGTGGCGCCTGGGGCCCTGAC
TGTGAGTGTCCAGCCCCTGGAGGCTCTTTACTGGCTTGAGTGCCCTGCATGTACTCCACG
GGTGGTCAGCAGCTTCCTAGAGAGCCTGCTTCAGAAGCAGTGCAGGCTGGGCTGAGTGGG
CATGAGGGAGGGAGCGAGAGTGAGTCTGCTCCCATGTGTAGCAGGAATGGAGTACAGGGG
CTCCAGGGACGGCTCGAGACCCTAAAAGGAGGGGGAGAAGTCAGGCAGGATGGATGAAGC
TCCCTAGGACCCCTGGGTGTGTTACCAGAGGGAGTGGGGTGCCACACAGGGGAACCTTAC
AATGAGGGTCCAGCTCATCCTTGGTGCTTGATTGTGAGAAGCAGAGACAGTTGTGAGCCT
CAAAAAGGTTTGACCCTGGGGGCTGGAGCGATAGCACAGTGGGTAGGGCGTTTGCCTTGC
ACGCGGCCAACCCGGGATCTAATCCGAGCGTCCCATATGGTCCCCAGAGCACTGCCAGGG
GTAATTCCTGAGTGAAGAGCCAGAAGTAACCCCTGAGCATCACTGGGTCAGGAGTAACCC
TTGTGCATCGCCGGGTGTAACCCAAAAACACACACAAAAAAAAGGTTTGACCCTGTTGCC
AGTGTAGTCACCAGCCCACAGATGAGGGATCTCCACAGTCAGGGTTGGGTACAGGACAAG
GTTTGTGCTGCTGCTGTCATTGAGATGGCTGTGGGCCAGAGTCTAGACACAGAGCCATGT
GTGTAGTCAGGCTACCCTCACCTTTGCCACCTTACTTCAGGCAGATTTCTCAGGAAATCA
GATGCTTGTGAATTGTAGAAGGAAAATCAGATGATGCTTTCTCAAAATTATGAATATCTG
TTCTTTGAAAATTGTTGCTAAGAAAATGAAAGATCTGGAATGGATTTGCAGAACAAGCGT
AACAAGCAACTTGACTGTCGAGTCTGGCGTCGTCTATTAGTAACAAGCTGTTCCTAGGTG
GGGAGGGTCCCCACCCAGCAGTGTTTAGGAGTCACACTTAGGGGAGATAGGAGACCATGA
GTGCAGGTTAGTCAGCTTCTGGCCCCCTGCACACAGAGCATGTGCTCTAGTCCTCTGAGC
ATTTCAGGTTACAAACCACCTTGTTAAAGCAGACAGGAGTATGGAGCAGTCACTGGGGAA
AGACGCAGAGGCAGGGGTAGAGACTCAAGCCACATCACCTCAGGCCAGGACTATGGGGAA
GAGGGAAGGCGTCTTGAGGTAGTTTTAGAAGCTGCCGCAAGGAAGCAGGCAAGCGAGAGG
CTCATCAGGGACAGATCTTACCTGTGTGTGCAGGATTAGTGAGACTGGCATCAGGGTGCA
GTAGTTTTGCAGTACAGCTGGGCACCCTGTGGCCTTAAGGCTGCTTGGATTGGAATTGGG
GTATCAAGCCCCAAAATGGGTTTGTTAGCAATCTTTTTTGCTGAGGGATCAAAAAGGGGG
GGTGGGTGGGCGGTCACACCTGGCGATGCTCAGGGTTTACTCCTGGCTCTGCACTCAGGA
ATTAGTCCTGGCAGTGCTTGGGGGACCATATGGGATACCGGGGATCGAGCCTGGGTCCAC
CACGTGCAAGGCAAACACGTGTGCTATCACTCCAGCCCCATGTGCTATCACTCCAGCCCC
CAGCCCTCAGCAATCTTTGTGTTCACCTGTATCCCAGTGAAGTGCCGTGACAGTTTGTGG
GAGTAGATTGGCTGGGAAGAGTGTCAGGAAACCAGGGGAGAAAGGTCTTTCATACATGCT
CTCAGGGATAGTAATTCTGAGTATGGCACAGATGGGGCTGGAGCGATAGCACAGCGGGGA
GAGCGTTTGCCTTGCACGCGGCCAACCCAGGTTCAATTCCCAGCATCCCGTATGGTCCCC
TGAGCACCGCCAGGGGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTAAGCATCGCCG
GGTGTGACCCCCCCCCCAAAAAATAAATAGTATGGGGACAGAAATAATACGAACCTTTAA
ATACTTAATACCATAGAGACAGTATTCTCTGGCCCAAATCTAAAGGATGCAATACCCAGA
GAGGGGGCTGTGAAGCTGTGTGCTCCCTGGAGAATNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGCACCTTCCTGGAGA
AGCAGTTGCACGTATCTGGGGGTGTGGTGGGGTGTCAGCTGGCGTCCAGCTTCTCATCAT
TGCCACACTCTCTGTGTGAGGGTGGGAGCCTGATCATGCTTCCAGTCCCATCTTCCCACT
TTTTTGCATTTCATACCACAGCTGAGGGGCCAGAGAGAACAGTGGGGCCACTAGGTCCTG
GCCCTAACACGAGAAGCCACTGGCGCGTCTTCTCAAAAGTCGTAGGCAGCCTTGGTTTTG
GCAGCTCTACTGCCCGAGTCTTCGGGTCTGCACCTCCCATGCTGTTACGTTTGGACATCT
GTTCATTTTATGTGGTTCGTCTGGGTGGCAGATGGAACTCCACCTCACACCTGTAAAGGT
GCACTTTCCCCCCGAGCCCCAGGCCTGGCAAAAGGAAGTAACTTTCGTGCCATAAATGGA
GAAGCATAAAAGTTGCCATAGAAAGTTCCCAGAATGGCTCACTCTGGCCTCTTCTGGGTT
CCAGAGGGAGGAGAGGGCAGTCAGGTTGGGGGTGTGCTCCTCACTGTCACAGCTGCAGGG
TCCAGCATATACCTCATTCCCTTTGGAACACAAGGAATCAGAAGCATGTCTTCTGATGAC
TAACCACTGGCCACCTGTGGGTGTTCACCTTCACTCAGCCTTAGCCCATGCCAACCACAT
TCAAGAGCTCAGTGGCTATACATTGAATAACCCAGATTTAGAACATTCCTCTTAGTGCAA
AAGTTCTGTTGCTGGGGCTGAATCAGAGGCCGGGTTGAACCAGAAAAAGGCAAGGCTAAG
TCCATGTTCCAAGCCCAGCAGAGGTGAGTTGTCGAGTGGACCGAGCTGGTCTGCCTCCTC
CTGTTCTTCCTCCTCACCCTGCTCTGTATTCTCGAGCCCTTCTCAGCTCCTCAGCTATTC
AGAAGCCCCGCCCCACCCTCCTGGTTTCCTGTAATGCTACCCTCCAAATCTCTTAAATTC
ATTTAAAAACTAATTTAAAAACAAATCTTTTTTACTTTAAAAGAGGGAAGATGGTCAGGC
ATAACTGATTTCTAAAGGCCAGCATGTTTATTTCTTTGTTCCTAATGATGCTATGTGGTG
CTGGGATTGACCCAGGGCCTTGCATCGCACCTGAGTGCCCCACACAGGGACACGTGCCTG
GTCCCACGTCTTCAAGTATTTTAAAAACTATTTTGTTGTCTTGATGCTTTGATTATTTTT
TTCTTTTTGGGACACACCCGGCGATGCACAGGGGTTACTCCCGGCTCTGCACTCAGGAAT
TACTCCTGGTGGTGCTTGGAAGACCATATGAGATGCTGGGAATCAAACCCGGGTTGGCCG
CGTGCAAGACAAATGCCCTACTTGCTGTGCTATTGCTCCAGCCCCCATGCTTTGTTTTTT
CATGTGACATTTGGGCCAGAGACCTGCTGAAGTAGTAGAGTCACTGGCCTTGCCTGCATG
AGGCTCAAGTCAGATCCTTGGCCATCCCCCCTGCCCAGTGTGGTCCCTGGCTCTGGCCGT
ATGACCCTCAGTACTTTCACCTACTGTACCAGCCCAGCGCCACAGCCACAGAAACGAGGG
CATGGGGAAGTATGTGGGACAGGGTTATTAATCAGATTTTATTTGGAAACAGTTGTAGTA
GAAAATTGAAAGCTGGTATTGTTATCTTGTAATTTCAATTTTCCAAAGGGGAATATGATT
TTAAAGTTTTAAAAACATTTGCTGTACAACACTCTAGATTTATATTAACTGTTTGGCTAG
CCTAGAGGGGGACCAGGTAGATAGCTCGGGTGGTAGGGCACATGCCTCCTGTGGTTGAGG
CCCTAAATTCAATCCCCGGGACCACATGTCCAAAAGTGATTCATCAGGAATGGCCCCGGC
TGCCTACCCACACCCTGCCCTGAACCACTGGGGGCAATGTACATTTAATTTCAAAATGAA
GCAAGAAGTATTCTGTGGCTCTACTGATCTGTCCCCAGTTTCCACCAACATTGTGCTAAC
TTTTCATCAAGAATATTTTTATAGGGGTTGGAGCAATAGCACAGCGGGTAGGGCGTTTGC
TCTGGACGAGGCCGACCCGGGTTCAATTCCCAGCATCCCATATGGTCCCCTGATCACCAC
CAGGGGTGAATCTGAGTGCAGAGCCAGGAGTAAGCCCTGTGCATGGCCAGGTGTGACCCA
AAAAAAAAAAAAAAAAAAGAATATTTTTATAATGTTGGAAAGGCCCTAAGGAGGATTTGC
AAACTCTCTATTAGCAACTGCTAACCTTGAAATTTTAGCGTTTATTTGGTCAGTAAATGA
AACCAAGCTATTTGATGTCAAATATTGTGTAATCACTATTGATGAGAAGCTACTTTATTT
GGGTTTTAGGAACATCTGATCAAAATGCAGAAGCAGAAACTGCAACTGCCCCAGCAGGCC
CCCCCACCGCAGGCTCCACCAGGGCCCCCACCGCCGACGGCTCAAGTGCAGGTGCAGCCC
CCGCAGCCCCCGCAGCAGCAGACCCCCCAGCTGACCGCGGTCACGGCCCCGAGGCCTGGA
GCCCTGCTCACAAGCACCGTGGCCAACCTCCAGGTGGCCCGGCTTGTAAGTTCCCACTGA
TGCACTTGTTTCTCCAGGCAGAGTCTGTCCCATGTCAGGGGACTGCCAGCACTCAGGGTG
GCACAGTTGAACTACACTGAGGACATGCTCCTCTCCCTGCACTAGCAAGCTCCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGCAGATGCAAGCCCAGCTCCCAGCCCGCCCAGGTGGCTTGCGAA
GCTCCCGTGGGTGTCCGTCCTGCAGCAGTGGTGTCCTCGCCGGGTGTCACGACCCTTCCC
ATGAATGTTGCTGGGATCAGCGTGGCCATCGGGCAGCCACAGAAAGCCACAGGTGCTTGT
CCGCCAAGTCCTGTAGCCAGCTGGCTCAGGGCCAGAACCCCCTTGTTAAGTGTGTGCCAG
GCTTTAGCCAACATGTCTCCCGCTCCCCGTTTGGTCTCTGGAGTTACCAGGAACATTCTG
AAGTCAGTGAGTCAGTGTGTGTGGTGGTGGTGGCAGGGAGGGGGTATGCTTCAGCCATAG
TGGTCGCAGTGTTGCCCCTTTTTGTGCAGAAGACACTCTGAACCCCTCTGTGGCTGGTGG
GGTGCAGGGAACTCGGCCTGAGCTGGGAGGTTCTTGTCCTGCCCCGGGTCCAGGACTCAG
CTGCACTCGGTGTTTTACAGGTCAGACTGTCGTGGCCCAGCCTGTGCATGTCCAGCAGCT
ACTGAAGCTCAAGCAACAAGCGGTGCAGCAGCAAAAGGCCATCCAGCCGCAGGCCGCACC
TGGCCCCACTACCGTCCAGCAGAAGGTGCTGCCTGCAGTCAGGCGTGCCGCCCGAGACCC
TGTGGCCCCGCACCTGGGCTGCACAGCTTGCGGGTCTAGGGGCAGTGTGAAGGGGGCAGG
AGTAGAATGACAAGGTCAGGGGAGTAGAGAGAAGCCTGCCAGGAGCCATGCTTCTATATA
CGTGCCTCCTAAGCCCTTTCCTGAAGGCACAGCTCGCAGGGCTTGGGCTAAGTCTGGGCC
AAGTGTTCATAGCCAGAAGTGACCTGCTGGGGCAGAGAATACAGTGGGGAGGGGGGTACC
GGGGGGAGGTAGTAAAGAGTCGGAAATGGGGGCCAGGAGGGAGAACAAGAGGTGAGGCCT
TGGCATGTGGTATCTTTGGCTGTGACCTGGGTTCCATCCCTGACACCACCAGGACTAAAC
CCTAAGCATAGTTGCGAAAGATCCAGAAAACCCAAAGAAAGCTCAGAGTACTTGTGTCGG
CTTGCTCTTCCTTATAAGCCATAGATTTGGGTTTTGTGAAGTTTTCCAAATCAGCTGTGA
GGAACTGTGCCTATATGTTTGCTCACTCACACGAGTGTACACAAAGCAGGTATTGTGGGG
CGGTTTGCACGGTTGGACCCCACCACTGGGCTTGGAGGGGATTTCTGAGAGAGGAAGAGA
CCACGTGCCAGGTCTGGGCTGTCTGGGAGAAGTTGGGGTGCCCAGATGAGGTGCTGCTGG
CTCTGAGAAGGTGTCTGCCTCTCACCAAGTTCTTTCCCTCAGATCACAGCACAGCAGATT
GCGGCTCAGGGCCAGCCCCAGAAGGTTACATATGCCACCCAGCCTGCTTTGAAAACCCAG
TTTCTCACCACACCCATCTCCCAGGCCCAGAAACTGGCTAGTTCTCCACAGGTGCAAACC
CAGATCCAGGTGAGTGAGTGGGGTATGGTTGGGAGGGCCATGGGCCACACAGACTGGGCA
GTGGCAGTGCCACGTCTCTGTCACCACTGCTCAGGATCCTCTACCTGCTCCTTCTCTGGC
CCCCCACATGAGTGGGTGCCTCCACTCCTTTATACCACCCCAGACTTCGCCACGAGTTTG
GCTTTGCTGTTTCTCTGTCCTCTGGAGCCCATGGGACAGAGCCTGCAGGCAGGACTTGGC
AAACATCCTACCCACTGTGCTATCACTCCAGCCCCTGAATGGAAGAGATTCTTCCCAGGC
ATGCATTCTTTACCTGTCATTCAGTAAAAGCCGGTCATTTCACCCTTACCTTAAACTCCT
AGCGGTCAGTCCTAGCCTGGTTGTTTGCAAATAGAAATACAGGAATCAGGGCCAGAGCTG
AGACTGTGGAAAGGTGCTTACATGAAGCTGACCCAGGTTTGAGCCCTGGCTTCCCACATG
GTCCCCAGAACCCTACCAGGTGTACCTAGTGTGGGCCCCCAAAAACAGATACAGGGGTTG
AGGCTGGCGATTCGGTTCTTCGCTTGCAGGTGGCCTGGGTTAAGACCCTAGGGCCACAAG
ATAAACAGTAAACCTAGGAGTTCTGGTGACAAAGGACTCAGGCCTCAGGACTGTGTGTCT
GCAGGCACAGCAGATCTCCTTATGTGGTAGAACAACTGCTATTCCGTTTGTCTGCACTTT
TGTGCTCATTTGAGTCAGCTTCGTCTATGGACCTAAATCTTAACTGCTGAGCTTTGGTTA
AAGTCACCAGCACCAGAACAGTTGGCAGCAGGGTTCAGCTCTGACCCCATGTCTCTTTAG
TGCCTTTCACATTTCCTTCATAACCACCACTCAATGGAACCACGTGCATGCTGCCAGGAA
GTATGATTGTGGGCTTCACATTCCTGCTTGGATCTGTAACTTCCCTTTGGCCACCCTGAA
TTAGGTGGGGCTACTTCCTGGGGACATATCTGTCACCTGTGCACAGCAAGGTGGCACCTT
CTTTCACCTTCCTGCAGGCAGGCCCCTACCATCCCTAGGGACTGGCCTCCTGGGCCTTCA
CTGTCCTAGACCGTCTTTGTGGAAAGTCCCTTCTGCGTCCTTGGAGTTTCCTATAGTGGT
TGCATACACCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCACAGCAGGTAGGGCGTGGGGTGGCACAGTGCCTG
CTTTGCAGGCAACTGCAGGGCTCTGTGCTGAACGAGTCCTTGGTGGGCGCCCAAGGAGGT
GGAACCAAACTCTTACAATCCCCTCTTGGGATATGCCTGTTGCCTGTAGCTAGTAGAGCT
GGTGTGAAAGTGTCTTGACTCTGGCACCTGCCCTATAGGAGCCCGGCTGTGTACATTTCT
GGGCAGTCAGCTAAAGGCTCCAATATATCTGCCAAGTCCCCTAGTTCATGGACTCTGGGG
AAGGGAAGGGAGAGGGCCGCTGCCTGTGGGAAACAGGAAAGCAGGAAGCAGGCTGGCAGG
GGGCGGGGGCGCTACTGCTGCCTGTCCTATAGAGGCACCCAGGTATGTTCCTTCCTGCTT
CTGCTGCAGCAGGTGGCCTAGAACGTGCTTTGTCTTTGTGGTACTGTCTGGACCTGGGAC
CTCACCCAGATTTGTTTGTGCCCTACCACAAGGCTCTGTTTGCCCTGGCCCCATAAAAGT
TTTACTCTGTTCAAAGCATACAGATTTCAAGGAACCAGAACGTATCCGACAATAGCCCCA
CCAGTCCCAGAGCCCATTCCAGCTAGAGTAGAGGCCAGTTTATGGCAAGAGGTTTCTCAG
CCCACAGAAGCCTTCATGCCAACAGGCCCTCCCTGTACCCCTCACACCTGTGTGGCCACG
CCACTTCTCTCAGTGATGTCTGTTCTCTGACTGTCTGGGTTCAGGCTTCCCCGCAGACTG
TGACACTCACGCAGGCGACAGCGGCCGGCCAGCAAGTGCAGGTGATCCCCGCGGTGACGG
CCACTGCACAGGTGGTCCAGCAGAAGCTCATGCAGGTTGTCACAACGGCAGCAGCCCAGC
TTCCAAAGCCTGGGGTCCCTGCCCCCCACCACCGGTGCCAGCCCCTCCGACAGCCCCAGC
CAGCAGCCCAAGTTGCAGATGAGAGTGCCTGCTGTCAGACTCAAGACCCCCACCAAGCCT
CCGTGTCCATAGGCAGTGCAGCCACCTCTACGTGGGAACAGCTGCCCTGTGCCCCCCACG
ACCTTTCCAAAGCAGCAGTGTGGTCTTGTGAAAGCCACTTAAGACAGCCTGTGTCACTGC
TGCAGACCCTGGAAGGGCCCTGACCCAGACAGTGGGCGCTGGGTGCCTGGCAGCAACTGC
TCTGTAGGCCCCTCCTCATCACTGGGGAGCCCCCTGGCCCAGAGGAAGGACTTCTTCCAG
GAAATTACTCCAGTGGGAAAGCCACCGTGGCTTTACTTGCCTGCCTGCAACGTGATTTAT
CTCAACTCTTAAATGAAATCTTTAGCAGTGACACCCAATGAACCTCCTGTTCCAGGCTTA
TGTTGAGGGGAAACTGATTTTTTCATTCCAAAGAGTAGCCAGGGCCCAGGACACACCTTG
GGAGCTCCCATGCGAGGCCCCAGCATTGCGTCATGCACACATAGCTGCAGCAGCAAGGCA
CCACAGAACATTAAGCGCCCCAGGTCCTTGCTAGGTTCCCTGCTGAGGGCTCCTGGCTTG
GGCTGGTTTGGGGCCACCTGTGCTTCTGCCCAGTGCACGATGAGGGCTCAGAGAGCAGTG
CTGAGCTGACATGCTGTTTCCTGTCAGTTGCTGCTTGCCACCCTTGCAGGTAGTACTGGC
AGAAACAGGCACAGACCAGTACCAGCACAGCTGTGCAGCTGGCTTCCTGTGACCTTGCAT
CAAGCCAAAAAGCATGTGTGTTTGGGACCGGTCTAGGAATAAACTTGGGTACCATCAAGG
GAGGAAGCACCATGTTTGCTTCTGTTGTCCAGATTGACGTTGTTACAGTGGACTCGCAAG
TTATCCCTTGGTACTTCAGGTCCATGCCCTGGCAGGAAGGAGCACTCCTCCCCCCCCAGT
TTGCAGGAGGAAGGTTACCAAAAGGAGTTCACTGCTGTCCAGCTGGTGAGGAAGCGGGAG
AAAAGTTAGTATGAGGGCTTGAAGATGGATAATACCATTGTTGGGGCCCGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2302, 3862..3972, 11923..12025, 13936..14043, 14572..14936, 14939..14950, 18006..18302, 19029..19214, 19645..19789, 20222..20223, 20875..20953, 21063..21112, 21518..21575, 21866..21955, 22999..23106, 24025..24215, 24822..24999, 25664..25800, 31505..31674, 31787..31961, 32045..32181, 32872..33058, 34789..34955, 35893..36062, 36716..36955, 38784..38948, 41033..41182, 41505..41599, 42463..42677, 43878..44080, 44173..44342, 44723..44919, 46489..46600, 46725..46868, 47901..48029, 48146..48229, 48476..48610, 48974..49018, 49095..49248, 49374..49615, 49701..49874, 50290..50426, 50519..50575, 51755..51769, 51771..51834, 52072..52245, 52250..52264, 52267..52278, 52280..52324, 52759..52804, 52871..52980, 56103..56316, 56417..56652, 60069..60284, 61481..61531, 61533..61553, 61555..61581, 61584..61671, 62000..62124, 62862..63008, 65349..65426, 67364..67518, 67521..67542, 67545..67631
1001..2302, 3862..3972, 11923..12025, 13936..14043, 14572..14936, 14939..14950, 18006..18302, 19029..19214, 19645..19789, 20222..20223, 20875..20953, 21063..21112, 21518..21575, 21866..21955, 22999..23106, 24025..24215, 24822..24999, 25664..25800, 31505..31674, 31787..31961, 32045..32181, 32872..33058, 34789..34955, 35893..36062, 36716..36955, 38784..38948, 41033..41182, 41505..41599, 42463..42677, 43878..44080, 44173..44342, 44723..44919, 46489..46600, 46725..46868, 47901..48029, 48146..48229, 48476..48610, 48974..49018, 49095..49248, 49374..49615, 49701..49874, 50290..50426, 50519..50575, 51755..51769, 51771..51834, 52072..52245, 52250..52264, 52267..52278, 52280..52324, 52759..52804, 52871..52980, 56103..56316, 56417..56652, 60069..60284, 61481..61531, 61533..61553, 61555..61581, 61584..61671, 62000..62124, 62862..63008, 65349..65426, 67364..67518, 67521..67542, 67545..67628
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved