Sorex_araneus Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Sorex_araneus EEF1B2
Sorex_araneus
EEF1B2
GeneScaffold_204
SNORD51
2803..2879
3017
GCCTTCAGGCGACGTCACCTGACCCGTCCAGGCGCCTCTTCTGCGGGCCAGGACCGGTC
CGCACTTCCCCCCCACCCAAGCCTGCACCCGGGCCCGCGCTCCCTGCAGCCTCCTTATCC
TCCTTCCTGCTCCATCAGTACCGGAGGTCGTGAGGATTCCCGAGGCGGGGGAGAACGGGG
GGGCGGAGGACGCGGCGCAGTCAAGGGCAAGAGGAGAAAAGAGCCGCCTGGGCCCAAGGG
AACAGTCTTGTCCATAAATAAACTCCTGGAGCCGAGCCTCCTCGGCTCCGTCCGCCCCAA
CACGACCTCACCTTCTCCCGGGAGCCGCGGAAACCGCTCTGGGGGAAGTATTTGCGCCTG
ACCCTTGCCTTCAGAGGTCCGGCCGCTATCTCAATATGGCGGCCTCGGCACCTCCGTCAG
CGGACCTGAACGACGGAAAGCCGGGAGGGACCAGAAACCTCAGGCTCCGACAATTCGCCC
GCCAGGATTGAGTTCAACGCTTTCCGTCCATCGATGAGGGGCGGGCCTAAGGCGCCGCAG
CGAGTAAGCGGCAGCGGCGACGGAGGTAAAGCGGAAGAGACCTTCACTTCCGCCAGAAGT
AAGAGGGCGGTCCTTAAGGCGGGGCCTCTTTAGCCGGCTCCGGCGCTTGGAGGAGAGCCG
CGGCGACTGTAATTTAAAAAGTACATTCTCAGTTAACTATTGACGCCCATGAAGAAGAAA
GAAAAAACGGCCCCGGGAAGCGGGGGGGGGCGGCGGAAATGGCTGGGCGATGACATTACG
ATGTCGAGACTTTCCCGTTGAGAAACGGACCGATGAGCGTACTTTGACCTCTGACCTTCG
ACCGGACGCAGCGGAGGGAAACGCCTCCGCGTCTATATAAGGGATTTTCCGGCCTCTCGC
GGCCCTTTTTTTCTGCCTCTTAGCGCCGAGCGCTTCTCGCCTTCTCGCTCCGCGTTACCC
TCGCGGCGGACTCGTGCCAGCAGCAGCAGCAGCCAAGCGCCATGGGTTTTGGAGATCTGA
AGAGTCCCGCAGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAAAGCTACATCGAGG
GGTGAGCGGCCGGGCCAGGGGGAAGCCACGTGGTGCCGCCGCTGCAGGAAAAGGAGGGAA
AGGCTTAGCGGCCGGCCGGGGAGACGGGCTCGAGATACGCCGGCTGCTCCTGCCAAGGCA
TGCGCCCAGGCTGCCACGCGTCTTGGCGGCGTAAAACTTAGTGGGAGATGCTTTCAAGGT
GGTCTTGGGTGGCGGCGGACGCGAACATAAGGGCCCTGATTTTGTGTGTGTGTGCGCGCG
GCTTAGAAAAAAATTTTTTAAAGGGGCTGGAGTGATAGCACAGTGCGTCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCGGGTTCGATTCCCAGCATCCCATACG
GTCCCCCAGCACCGCCAGGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGGCATC
ACTGGGTGTGACCCGAAAAGCATTTTTATTAAAAAAAGCAACCAAAAAGCCCAGACTGGA
GCGCCTTCTGGGCCGGATGCCGTCTGGCCGAGAGTCCCACGAGTTTATTAGGCCGAGGTG
GCGCGGGTGCGGCGTTGGGCGGGGCGTGAGCGCTCATCCTCCTTGGTGCCCTCGGTAGGT
ACGTGCCGTCGCAGGCCGACGTGGCGGTGTTTGAAGCGGTCTCCGGCCCACCCCCTGCCG
ACTTGTATCATGCCCTTCGCTGGTACAACCACATCAAGTCCTTCGAGAAGGAGAAGGCCA
GGTAAACCGGACCTTTTGGGTCTCCACCACCGTGTTTCGCTTTCCAAAAGTTGAACTGTA
AGGATTTTTTTTTTCTCCCCTCCTCCTCACTTGGCCCAGAGAATTGGACCCAGGTTCCTT
TAGAACAGTATTGCGGGGAGGGGGAGGCGGGTCATTGTAAGCTGAGTTTCTCTGTTCCTT
TAGGAGGCTAAGAGACTGAAGCCCTCCATTTTTTCACAGAACAGGTAGAACATGGACAGC
AGCAATGCAACTTGTCCCCACACTGCCCTGCCAATTGCCTCCACCCTGACCGGGGCGGGC
CCACCTCTTAGGGTGAGAGGGTGGCTCATTCGTTCAGTTCTTGGCCATTCTTCTGAAACC
GCCAGCCAGGGTGGAAGTTTGGGCAAGTGGACTCCAATTAACTAGGAATGGAACTGAGCG
TACTTAAAATTTCAAACAGAAACTTTCATACTGAAAGAGTAAACCATAGTGAGTATTGCA
TATACTATCATTGGAACATGCTACTAATGTTGGTTGTGGGAGGAGTTAAGTAGATAAAAG
TATTTTTTTACCTGGGAGTGTTGATCAATTACTAGTGCAAAGGGGGGAGGTCTCTTTAAG
TCTGGATAGAGTACGTTCTCACTATAAAACTACATTCTGTCAAGGTTCTTGTGTTTGAAT
TTGTGCCCCCTTCCCTTTCTTTCCCCCACCCAAGTCTGCCAGGGGTGAAGAAAGCTCTGG
GCAAATATGGCCCTGCTAATGTGGAAGACACTACAGGAAGTGGAGCTGGGGACAGTAAAG
ATGATGATGACATTGATCTCTTTGGATCTGATGATGAGGAGGTACTGCATAAATTAATAA
GTTGGGTCTGTCGTGCTTAGGGAAGCACAGGCTTGGTAACATAATTGCCTGGATTTGGTC
CCTGGCATAAACTATATTACCCTGCCTTTTAAAAATTTTCTCACTGGTTGTGTGATGAAT
AAAATCAAATCACCATCTTTCGGCTGAGTTCCTGATGGATTTGCTTTTTTCTGATAACAG
TGGACTTTATTGTGAGAACACCAGCCAAGAAACAACCAGCTTTGTGAAAGCTTTTCATTT
TTTTTCTTTGCAGGAGAGTGAGAGGCAAAGAAGCTAAGAGAAGAACGCCTTGCACAGTAT
GATCAAGAAAGCAAAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1738..1860, 2554..2680, 2953..2958, 2961..2999, 3004..3012
1001..1080, 1738..1860, 2554..2680, 2953..2958, 2961..2999, 3004..3012
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved