Sorex_araneus Locus ZNF507
snOPY snoRNA Orthological Gene Database
Sorex_araneus ZNF507
Sorex_araneus
ZNF507
GeneScaffold_5467
SNORD94
22334..22466
31597
TGTGAGTAAGATTCCAAAATGCACCTAAAATGTGGAAAAACAAAACTTGTTGCTGGCAA
AAAGCCTGAACTTAAAATATGATCCAAATCAACAAATTAGATTCACTTTAAGCCAAAGGA
AATTTTCGAAATGACAATACTGCCAGGAAATAAGAGTATTCAAGATTTAGGCTCAAAGAT
ATTATAGCATTTTATGTTTGGTGACTTCCTTGGCCATCATGCACCCACACATAATCCTTC
TAAGTACTAAACGTATGCAGACCTGAAGCACAACTAGAATGTCTAATATTTTCTTTGGTG
CTTTCACTTTCGGGTGGTGACAGGGGAGAGACAACCATAAGCGTGTATGAGTAATGATTG
ACCACTAATTGGACCTCTAGAAAAAAACCACAACATAGTTTGTGGTTTATCTTCAGGAAG
ATAAATTTAAGGAAGTAAAAGAAGGAACAAGATCATTGCTTGTATTTCATTTCCCTTGTG
TAGTACTTCTCAAAATTCACTATACCCTTTCCAATACATGACTGTATTTTCACTATCTTA
AAAATTGAGAGAGGAAAATATATATGTATTTGTGTGTGTCAGAACTAGTCTCTTACATAG
GTGACATGGCTCTATAGAATGATATTTCATGAAAACTTACAGGTTTCACATACCTGGGAA
ATGCTTTGTGCCTTTCATTTAAGAATAGATATCTTTTTTTTTTTCCTGCTTTGGCATTGT
ACAGAAGAGAGAGCACACAATTAGTTTCAAGCAAGATGTCTAGGGAAAGGGGAAAAGATT
GTTGAAGTCATTTCTAAAGAATTAAATCAAAGATGAAAAGATACCCATCTTTAGCCTTCA
TTGGGAGGTAGCTTTCCAAAGAGGAATTCCAAATAATCTAGGTCTGTGTTGGAGACATCT
AGGTTTACCAATAGGGCCCACCGTGTCAGAAAACACTGAGTCTAAGTTTCCTGTTACCCT
ATAACCTGGTGTTTCTTTCTATAATGTTTTCCCTTTTAGATATGGAAGAAAGCAGCAGTG
TTGCCATGTTGGTCCCAGATCTTGAGGACCAGGAAGCTATATTAACTGCCGAAACCGTCC
TCAATACGTCATTGGAAATTGATGAACAACGGAAAGCTAAAACAGATCCATTAATTCATG
TTATCCAGAAATTGAGCAAGATAGTGGAACATGAAAAGTCACAAAAATGTCTTCTGATTG
GGAAAAAGCGCCCACGTCCAAGTGCTATACCACGGTCTCTTGAAACCCAAGAAATTTATG
AGATTCCAGCTAAAATAACTCAGACATCTCCTGTTAATACTAGAAGGGCCGAGATGTCAC
ACACAAATTTTGTCCCTGACTCTCTTGCCCCAAATGATGGGAAGGTTATGTCTTACCAGT
GTAGCCTTTGTAAGTTTTTGTCATCCTCTTTCTCTGTGTTAAAAGATCACATCAAGCAGC
ATGGTCAGCAGAATGAAGTGATACTGATGTGTTCAGAGTGCCATATTACATCGAAGAGCC
AAGAGGAACTTGAAGCTCATGTGGTCAGTGAGCATGAAAATGATGCCAATAGCCACTTTC
AGTCAAAAGCCCAGCAGTGCATAAGTCCCTCCAACTCCTTCTGTCAGAGAACCACAGAGA
GAAACTGTGAAACCATTCCTGACATCACAGTAAGTGTGGATAGCCCACAGACTCATACTA
TTCAGACTGCATCTGTGGCAGAAGTGGGCAGGAGGAAGTGGTATGCATATGAACAGTACG
GCATGTATCGATGTTTGTTTTGTAGCTACACCTGTGGCCAGCAGAGAATGCTGAAAACCC
ACGCGTGGAAACATGCTGGGGAGGTTGATTGCTCCTATCCAATCTTTGAGAATGAAAATG
AGCCCCTCGGCTTACTAGACTCCTCGGTGACTGCTGCCTCTGGAGTCGATGCAGTAGTCA
TTGCAATCGGAGACAACGAGCTGAGCATCCACAATGGGCCCTCAGTTCAGGTGCAGATCT
GCAGCACAGAACCATTGACGTCTTCCTCTCCGTTAGAGCAGCGTGTGGAAGCCGGGATTC
ACCTTGAGTCAATCCGTTGCCTTGACCCTCATGAGGAGGAAATGCTAGAGTGATTTCTGA
TGCCGAGGAAAATCTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCAAGTGGACTGCAAAGGCCAAGTTCCAGGAGCAGCTT
CAGCAACATACATTCATACCTCATGAGGGTAGATGTATACACATGTTCTTGATAGTTTAA
GGCAAAAGTTAGCAGGGGTCCAGCAGTGACTGGTTAGGTTTATTTTGGTGCACTGTTTTT
CTCAACACTACTCTGCGCTGGGCTTGCCAGTAAGCATATACATGCTGTGCATAAGCACTT
CCTAAGCAGTGGCTGCCTTTCAGAGAATGTGAAAAGAACTGCTTTTCTGATGAGACAGTG
TTTTTCTTATTATATCTATTACCATGAACTCAAATGGGTTAAATAATTTTGTAGTATGTT
TGATTTAAAAATATTGGGATATGTTCTAGGCCAAGAAAGCTTTAACACCTATAGCCTCCT
GTTAACTGGGCATGTATGTTTATTGGAAATGACGTATTCGTTTCTCTCAATTTCTCTCAG
AGTCAACTGAGGAATCATGAGAGAGAACAGCACAGTCTTCCAGACACCTTGTCAGCAACA
ATTTCTAATGAGTCAAGAATTACCAGTGATACAACTGATGGAAAATGTGTTCAGGAAGGT
ACCTGCATTTTTTTAAAATTCAGAATGCACTGATGGGCATGCACTGATAGATCATTTCCA
CAGCTAAAGCTCAAGTTGTTGTTCTTATGTGATACATCTGAGTTGATCCTATCTTTGTTC
CTGAAGAATTTCAAGTCTGAAACAATTCCTATGACCTATGTAAGAAGTCATTAGTTCACC
CCCAGCGTCAGCAGCGCAGATTGGTTCTGTATTGAATTTAGGCACTCCTAGAAGAACCAG
GTTGCAGCATAAACCCTTAGATGTGATGGCCAGGGAAGCTGCTTGTAGGGAACAACCTGC
TCAGTGCTTGGTGACCCACAGAAAACATAGCTTTGCAGATGCTAAGCCCCCACCTCAAAC
TTGAACTGAGCCTTCCTGCTGTGATCCTATTCTTATCCAAACACGCCTGCCAGATTCCAT
CTGCATTATTTAAAAACACACACAAGGTTCCAGCCACCCCCAGCCCCCTCCTCCACCCAA
ACACCCCACACAAGGTTTTTTATGTACTAGTTAGGTACCAGTCAGCCAAGTTTCTGTGAA
TAGGAATATTAGAATCAAAAGATTTAATTAGAGTTCCATGAAAAGGCAAATGCCACATCC
AGAGAACTAGGGATTAAGTGTAAAAAGCTGTGCTTTCTTGCATCAGCTCACTTCAATTGA
TATACTTTGAAGTCTCAAGTGTGGTGCATAGGGTTTATGGGAAATAAAACATATTGGGGT
GACTTTCCTTTTCAGATTTCCTAAGAATTAAAGTTAGGAACAACTGCAGAGTAAAATGTT
TTACCATAATGTTTCATTAAATTATACCCCAGAAAGCATAACTGATTCTAGAATGTTTCT
GAAAGAACTGATTTTGACACCACTGTAGCACGAAAATTCCCCTGTCAAGCAGATGTCATC
CCTGTAAAACTATTCAAAACAAAAGGAGTTTATGACACAGCATCTGTTTCAGCGATAGAT
GGCTGAGCTGAAACAGTTTCTTTTTTTTACAAAATAGCCCTAAATGCCTCTTTTTATTTT
AATTCATTATGCTTCCATATCCCCTTTAAAGGAGACATTAAAACATTAGATATCATTGGA
TCATAAATCCCTAATGAAGGAATAAAGTAAGTACTACTCAGTGGCACCACCTGCAGTTAA
TAGCAGCGGTAGAATATGGCTTTTCTACAACCATCTTCAAAAACCGTAAATTTGAATTGT
CCAAATGGGTTAACAGATTAATACTCATAATTTTAATAAAAAAGATTAAGATGTCAGTTC
AAGTTTATACTCAGTTCAGGCTTTACAACATTTCTACCTGCCACATTCCATTTGGAAGCA
TCTTTGTGGAACATACTGTTTCTTAAGGTTAAACGTGTGGGTTTTAAATGCTTGCCATTT
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAAGAGTATTATTAACAAAGGAAAATTCAGTTTGTAGGAA
AGCTTACATTTATCCTAAGGATCTTCTTTGTGTTGTTAAAATTTCATTATAGGTCTTTTG
TGCCACCAGTTTCACTTTTATGCATCGTGCACTCATTCTACCTAAGCTTTCATCCTGCTC
TCCCTTATTCTTTAGCTTCCATGCCTGCTTTGTTTCTGAATATAAAGCAATCAGGCTGTG
AAAGGCCTACGGACTTTATGATAACAGAAGAGTAAATAAAGCATTCTATACCACCAGGAA
CAGTTTCATATAATCAAGTCATTCAGCTTGTATTGTCTCAAATTTACCCTAATTTGAATT
ACCCAGCCTGTAGTTAAAGAGGGAATTTCGTAACACAGCTTAATTCCATTGGATTCATAT
TTCCTGAATTCAGAGAGCTGCCTGTTCATGTTAGTCATAACCTGTATCCCTGTAACCTGT
CAATTTACTAGATATGATTATACTACTTATGAGGTACTCATAATTTACAGTTGCTTTTCC
TTTCATTGTTGTATTGATAGCTGACGTTTAGTTATAAACAAAGGAAACCCACAGAGTGAG
AAAACCTTGTATTTTGAATTATACTAAGTTTATTACGCACCAGTTCCCCGTTAGCCACAG
TGGATATGTTCCAAGCCCCTAATGTGCCTGAAACTACTTATGATACTAAACTATCTGTGC
TGGTTTTTCCTATTTCTGTGACAAAGTTTAATTTATAAATTAAGTACAGTAACAGATTAA
CAACATTGATAATGAAACATACCGCACTAGAATAAAATCTCAGTTAATCTTCTAGGATAT
TTTACATGATATTTTGAGACTTATTAATTGAAGATAATTGAAGCTATAGCTAAGGGGGGA
TGTACTATATATGCCTTGTAACTTTTTGTAATATCAGATCACAGTATGAAACTGTAACTT
TGGCAACTAGATCTCCTTTAAAGACAATGTATTCCTCTATGGATTAAACTAGCACCTTTC
ACAAATGACAGGTATCTCTTGGGTAGGTCCAACTGGCTACGTTTAAGGAATAGCCTCAAA
AGCTCAAAAGTTGGGAAAATTGGCCTTAAAATGGCCCCCCCGGCCATTTGGACCTGTTTT
CCAAAAAAGAGAAAACAAGGGGGTGGGGGTTTTTACCCTTGGCCAATACCAAAATACGTT
TTTTATAAGAAACCCACACCCCTTTTGTGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATACAGGTAAGTGTATTGGGTCTAAGTTTTAT
TGTTTGTATTAAACATATTTTGTAGTAAAGGGAAAACAAAGAAAAAATAGCTTAAAATTC
CTAATGTGTTTAAAGACAGGATAAAAGTTTAAATTTCATTGGTTTCACAAATTATTTGTT
GTTAAGGAATTGTTGCACTTTTAACCTTTGGTCTTGGGATCTTAGACCCATTTTATCTAG
TTTCAACCAGAGGAAAGGTCTCTATATCTGTCAGTTTTATATTTTTTATTTAACTTGGGT
ACAGATTATAGCAATTTCTATTGCTTGCAGTACATTTCAGTTCGTTAAGTTTCTCAGTAT
TTCAGCAAAGATTCTTAAAACTTGAATTAAAATCCCATGAGGGGCCTAAGAGGACTCAGT
GGACTGAAGACATGCTTTGCATGAGGAGACCTTGGTTGTCTTCTGCATGGCTTGGAGACT
TAGTCCCCGGAGCAAGAGCACGCAGCTAGCAGAGGCTCCCCACCCCCAGATCCCTGTGAA
AGACTCCTTAGAAACTAAGCTGTTGTGTCATTTAATTTTGTTCCTTGACTTTTCATAAAA
GCCTTTTCTAATGTGTTTTTTTGTTTGTTTGGTTTTTTCGTTTTGTTTTAGGTTTTTGTT
TGGTTGTTTGTTTTGGAGGGCCAGACCCTCCGTTGTCCGTTGTCGTTGTTGTTGTCAAGG
CTTACTCCTGCCTCTGTTCTCAGGGCTCAGGGGACCATACTAGGATAACGGGAGATCAAA
CTCGGTTGGCCACATGCAAAGCAGATGCCTTACCTGCTTTACTACCTCTCTGGTCCCTCT
AATGGTGTGTTATCAGAAAATATAGGCGTTCTCGAGATACGCTAATGAATAGAAATAGTT
TTCTTTTTATTTTAGTCACCGTGGTTTACAAAACTGTTAGTGAGTGTTCATGCTTCTGCA
TTCCAGCACCACGCCTTCCACAGATGTTCATTTCCCTCTGCCATTGTCCCAGTGCCCCCA
CCCCCCCACCCGCCACCAAACCCGTGGGAAGCTTCCTACTGAAGACCAGCAGTTCTCAGT
TTCTGTTGCTGTGGTCATTTGTTATTCCCCTGCTGTGTTTCTTTATATCCCACATAGAGA
AACCTCCTTCTGACCAGCTAAGCGTGATGCTCTCCAGATCCATCCACGGAGCAGCAAATT
GCATGATCTCATCTTTTCTTTAAGCCAAGTAGCGTTTCACTGTATGTTTTATAGTTTCCT
TATCCAGTCATCTGTTCTTGGAGACTTGGGTCCTATCCAGATTTGGAGAAGAGTCTGTAT
TTCACAAAAAGCCCAGCCCAGTGGGCATTCCCACCAGAAGGGAGTAAGGGTTCCTTTTCC
CCCATGTCCCTGCCAACAGTTGTTTTTGATTGTTTGTTGTTCTCTGTGATGTGTGCCAGT
CTTACTGGTGTGAGATACCTTGTTATCTTGATTTGCCTTTCCTTGATTATAAATAATGCA
GAACAATTTTCCTTATTCCTTTTGGCCATCTGAATGTCTTCTTTGATCAAATTTCAGTTT
ACTCAGCTTCCCCTGCCCCAACCATCCTCCCTCATTTTCTGGTGGAGTAGATTGTTTTCT
CCTTGTAAAGTTCCACCAGAACATTATATATTTTGGATGTCAACCCTTTATCAGATGAGT
AGTGGGCAAATAATTCTCTTTGAGTCTGTGGGGTGTTTCTATTGTGGTCAATTTCCTTTG
TGGTCCAGAAGCTTCTTAGTTTGATGTAGTGCCATTTGTTTATCTTTGCTATTTGCTTGG
CCAGTGACATTGAGTCATTGAAGATACCTCTAGATTCAGTATTCTGTTCTACCAAACGAT
TATTTCTTAACCAATAAGCTGATTTTTACATAAAGGTAAAGTTTGTCAAGCGGTCACAGC
ACAGGTTGCTCTACTTAACAACCACGGTAAATATCAAATTCACCCTGACTATAGTACAAA
ACCTTAGACATGAAATCTGTTAGCCCCTTTTCAGTCTTTTCAGATTTCAGCTCCCTTCAG
GGTTTGTAAGTATGACACAGATGATTATTGGAAAGTTAGTATAGATTGATAGCTAACTGA
AAATTTGATAAACTCATAATTTGATTTGTAGTGTAGCTCTTCCTATATGTATCCTTTTAA
ATACTTAATATGTGGTTAATTCGCTAACCAGCAGAATTATTATCCGCTCCTCAGATAATC
TTAATGCTTCTAAAAAGGGGATTGACCTTCCAGCATTGTCTAAGCACTTCTTGTATGCTA
ATTTAGCCCTTACTGTTCCTATGGTAGATCTTTTTCCCCACCAATTTATATATTCGGAAA
CAGGGAATCCACAGAAGAATCGTAGATTGGATTCAACATGAAGTTATCTCACTTTGGTTT
ATGATACTATGAAATTTGGGGAGTATAGCTTCGCACTTCTTACATATATAAGACTTACCA
TATGCACCACCAAAGCTCTAGTGTCATTACATTATCAAAATGACCCCCTCACACACCCTC
CTTCTTTCCCTCTGGTAATCAAACTCTTCACGGTCTGGGTGATTTTTATGTTTCATCAGT
TGGTCATTTATGTTCTCATGTAGATGAAACCATTCAATAATTGTCTTTGAATTCCTGACT
TACTTCACTAACATAATCAGTTGCTTCAAGTTCCATCTACTTTGACCCAAAAAGAAAAAA
TGTGCCCTCCTATTTTATAAGCTGAGAAACATTGCATTGACTACATAGACTACAGCTTCT
TTAGACAGTCAGATATAGAAGTTGAAGTGAATAATGCTGCTATGAATATTAGGAGGAAAA
TAACTTTCTTGGTGAGTAAATTCATAGGAGTAATGTTGCTAGACTATCTTTTTGGTTTCT
ATTTCAGTTATTTTTGCTGAATTTTGATTATTTCCTTTATTGACTTAATCTAGTGCCTTT
TGAATTCATTTGTCTTTCTAGGTCTTTTTGCTATAAAGTTACATTGAGAGTTTTATTGAT
AAGGGCTTGTATTTCATGAATTTCTCTCTCAATTACCTTGATTGCATACCTAAATAGCTT
GTCTCTTCATTTTCATTGTTCTCTAGCTAATTTTTATTTCTCTTTCAGTTTCTTCATTTT
TTCAAGAATTGTTCGGAATTATGCTAGTCTCCTAAATATAATTTCCTTTCTGTTTTTGAT
TTTTGTTTCCTTAACCACTGTGGTCAGAAAAGATGCATGATCAGTTTTGATCTGCATGTA
TTTATTGAGGTTTGTTTTGCAACATAGGATCTCTCCTTGAGAATGGAGTGGGAATTCTTG
TTAAATTCATCTGTTCAGTTGTTTCATTTAAGAACATTCTTTCCTTGTTAACTTCTGTCC
AGGTGATTTATCCATTAATGTAAATGGGGTGTTGAGATCCTCTGCCATTATCATCTTACT
ATCTATAGCTTGCTTTTGGTCATGTTAATAAATGTTTTATAAATTTTAAGTGCAATTATT
AATGAGTTATATCTCTTGATCATTATAAATTATCTGTCTTGCCTCTTACTGTAGCACTGT
CATCCCCATCATTCATCAGTGTGCTCGAGCGGGCACCAGTAATGTCTCCATTGTGAGACT
TGTTGTTACTGTTTTTGGCATATTGAATACTACACAGGCAGCTTGCCAGGCTCTGCTGTG
TGGGCGGGATACTCTTGGTAGCTTGCCGGGCTCTCCTAGAGGGACAGAAGAATCAAACCT
GGGTCGGCTATGTGCAAGGCAAACGCCCTATCTGCTGTGCTATCGCTCCAGTCCTTGTCT
CTTACTAACTCTTTTAACTGAGTGTCTAGTTTATCAGGAGCATAGTAGTTCCTGCCTTTT
TTCTGTTATTGGCTTGAAATAATCTTATTCCTGTCTTGCACTTGGAGAGTTTGTCTTGTC
TTTAGATTTGGTAAGAGTTTCTTGTTTGCACAATACAGATGGATTCTGCCCTTTTGTGTG
CTGCCAGGGCTTAGGCCCAGGCTTCACACATGCAAGGCGAGCACTTCGGCTACGTCCCCA
ACCCTGGCTCTTGCCTTCTTATCCAGTGTTTTTTGAGTGATGAGTTAGATCGTTCACCTT
TAGGATGATTAATGATAAATGGGGCTTAATTACTGTCATTCTGTCTTTGTTTTCTGGCTT
TTATATTCCCGGTGTTCTTTTTCTCTGCCTTATCATTTGGATGGATTTTTCTGGTGTGTC
TGAATTTATTTGATTTTTCTTCTAAGTGCCTAAAAAGTTGTTTTTCTAAATGTAAAAAAG
AAAAACAAACAGATTTTTATATTGTGGTTACACTGAGGATTATATCAGTTTTTGTCAAAC
AATATTTTTATATACTGATGCCTCTTCATTTTTAGACTATCTGTACTCTGCCCTGTAATA
CGCCCCTGAGATGTGTTGAGATATAATCTGATTCTTCTTATGATTATTTTCTTCTTTATT
TAGCAGAACTCCTTCGGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTATGTCAT
GGGAGCTGAGTGTATGTGTTTTGCCTTTGTCCTGCATGTGGCAGGCTGAAGCAAGCACTT
ACACGAGGATGCCTCAATCTGAGCCTGGGAGGGGGAGAAAAAGAAAAAAACAGTAAAAGT
AGTGACTCCTTTGAACCTTTCTTGTAATGGTGGTAAACTTTTGTCTTTCTTTTAATCTTG
AAAAGCCTTTTACTCCATCATTTTAAGTAATAATTTTGCAAAGTAAAGTATTCTAGCCTG
GAAGTTTTTATCTTTTGAGAATCTCAGTATATCATTCCACTCTCTCCTAGCCTATAGAAC
TGAAAGTTCTGGCGACAAGCCCGAGTCGGAAGCTTTTATGTCTTATTTCTTGTTAGCCTT
GAATATTCTTTCTTTATTGCTGACTTGGCAGCTTACATGTGGTGTATCTTGGTTTGGGTT
TTTTTTTTTTTGTCTTTTTTTAATTTTGTTTTGTTTATAAATTTGAGTATTCAGTCAGCT
TCCTAGACTTCTATGGTTGGTTCTTTCCTTAAATTTGGCTTTTGCAGTTATTTCTTTGGT
CTCTCCATCTCTTCACCTACTGCTATATCCATTGTCTTTATGTTTTTCTCCTTTTGCCAA
AACTGAGCCTGATAGTTCTCAAAATGTCTTTGATTTTACTAAATTTTATTTTCCGTTTCC
ATTTTAGTCATTTTTGGAATTTTATCTTCAATTTTACATATTCTTTCCTCTGCAAGATTG
AACATATTGCTATACTTTCTTTGGAAGTCTTCACTTTATTCAGTTTTATATATCTAGCAT
CATCTATTTGGTTTTTTGTTTTGGGGCCACAGCCATTGGCGCTCAGGACTTGTTCCTGTT
TCAGCATTCAGGGATCACTCCTGGCAGCGTAGCTGGGGACCAAACCCAGGTCGGGTGTGT
GCAGGGCTGTACTGCTGTACTCACCTGCTGTAGTACCTCTCCAAGCCCTCTTAAGGAATT
TTCTCCTGTCTCAAGAAAAACTCTTCGGTTGTGCATTTCCCTTTTATTTCACTGATGTAT
TAGTGTGCTTTGATGTTCTTCACAATAGTTACTTTAAATCCATTGTCTACCTTAGGCTTT
CCATTTCCTGATCAAGATTGATTTCTGAGGAATTTTCTTACTCAGCCTGACATTTTAGTC
CTTTTGGCATTTGTTTTTCCAGCAGGATGTTTTTTGGCTCCTTTCAGAAATGTTTTGTTT
TTCATTCAGTTCCCTGGGGAGTGGAGAGCGGGAGAGGAGTCAGTCTGTTGGGGGCCTCCT
GGATAAATCCCTCACTGTCCCTGTCGTTTTTGTGACCAGATGCATTCCCTGTCCAAACCC
AGCATCCGTGGGCCCAGACGGCTCCTCAGTGTCCAGATGCAGGTAGCCGCTGCTTTTGGT
TGCTCGCTCTGGAGAGGGGCTCAGCCTGACAAGGTGTATCTGCTGCAGTTGCTAAAGTTC
AGTGTCTGGTCAGAGGTTGCCTTGTAAATCCCCCCTTCTTTGTGAAAGATCTTTCTTGAA
TCCTAAAGACTAACGAATATGTCACTAAAGATTTGAGATTTCCATCCAGAGAGCCCTGGC
CCTTTCCTTACTTGGCCTGCAATACATCCCACTGGTTCTTCTCAGCAGGCCAGAGTTGTC
AGGCAGGTTTTCTTCACTTGGCGCGGTTCGTCTTCTTGCTAAAGACCGAGTGCCCCGGGT
TAGCAAGGGGTGGTGGAGGGGATTCATTCTACCTCCACCAAAGCTCTTGAGGGCCTGAGG
CTAGGTGACTAGTCTAGTATCCATTTTCAAGTGGCCGTGTGGGTTTTTCTCTGCTTAGTG
AGGTCCTAACCAAACTGCTGCGGACGTGGCTGCACCCAAACTTCATCCCTCCCCCTTGGT
CTGCTGTTCGCACTGCTGTAGTGCTCTAACCTTCCTTTGGCAGATGGTAGCGAGAGTGCA
GATAGCCTGCCTGTTGCCAGTGGAGTGCCCGAGGTGGTCAGACTAGGAAGGGTCTGCACA
AGCTCTTGTTACGGATCTTGGTATGGATTCTGCATGGGCCCTCATGCCAACCCCACAAGG
GCACTGTCAGCTGCACCTGGGACCCATGTGATGATCTGCATGGTTTGGGACCTGGTCGTC
AGCCCTCGAGATTTCAGGGGATTGTAGAGCCATAGTTCCCAGGCTGTAGTGAGATTTTTG
TCCTGCACCAGAAATGGAAAGTCTGTCCTAGCCCCTGTCCAGATTCAATATCAGTTCTCA
CAGAAAAGAACTTTAAGAAGATAAATATTGAAGAAATAGTGTCCTTCAGAAGAGAATGTG
GGCTTCTTTGGAGAGAGGAGAAAGTCTCAACAAATTTTGAAAGGGGTTATTTTATATATC
CATATATATGCTTATATATATGGATATATAAAATAAAGTCCCTTGGCTTGGAGTTCTCTG
TGCAGATAAGTTATTGCCTGGGTATTGTCAAAGGGGAAGTGCTGTGAACTGTGGATGGTC
CTTTATATTCTTACTAGGACCTTTTGTTCTTGCTCTTCATGCTGCTTTCCAGAGGTGTCC
AGCCTCTTCCATTCCGAGACTCAGAAGTCTTCTGAATCATCTGGGATCCAGCATTGGGTT
TTGGGCTGCAGTAGTAAGTGCCAAGCTGGTGGCCGGAGCTCCATTTCAGATCATATCTTG
GTTTTATTTACAAAACACATCTTTATGGCGAGGTCCTCTTTACCTTTCTGCCTGTCCTAT
CTGCCTGCCTCCCTCAGCACTCCAAACCCAAATTTGGGTGCTCAAGGCATGGACTATATT
CATTTATTTTGGCCACACCCAACTATGCTCAGGGTTTCTTCCTGGCTCTGTACTCGGGGA
TCACTCCTGGTGGTGCTTGAGGAACCAAGCATTGCTTGTGGTGTTAACAATCAAACCCAT
GTCAGCTACTGTACTATCTCTTTAGCCCCTGGAAAAGTAAATTTGAATAAAATTGGACAG
TAAGGGACCATGGAGTGGAATGGGTCCTAATCCACAACATCCGTTCCATGGGATTATACA
CCAGTCTTCTAGAGTTTTTGTCTTTCCCCTCTAGTCATAACTGGGCCTCATTTAACCTTA
AACACACAATGTTTGAGACCCTCCCTTATAGTGGAAAACAGGGCAAAGGCCAGTGAGGAG
AGAGACACTTTTTAGATGTCTGTGGAGGAGGAGATGAAGTCTCTAGTGCTTTCCTTGCTT
ACAGGAGAATAAGAAGGATGAGGCTAGAGGGTTCAGGGGTTAAGGCACTTGTCTTACATG
TGGCCAACCCCACTTCTATATCTGACCCTTCTGGCAGATGCCACGTAGCACAGCGCCATG
AGCACCTCTGGGTGCAGCCTAAACCCCACCCATGCTCTCCCCGGCTTTACAAATCAGCAG
TGATAAGTTATGTTGACAGTTTGATGTGATGAGAATGACTGTTTACCTCTGCCCTTCCTC
CCATGAACTCATAACCCCAGAATATTCTCAGAATATTTGATCTTGTTTCTTAATCTGTCA
TTAAAAATAAAGACAGAGAAACTGTCACAAGACAGAAGACAACTAAATATAATGTGTCCT
GGATCACATCCTGGAACAGAAAAAGGGCAGAACATTGGAATAATGTGTGTACTTTAGTTA
ATAATAGTGTATTAGCTCTGGCTCCTTTGTTATGTCAGCAAAATAGAAGAAATGCAACTA
AATTTTAAGCTATTCTAAAATTAAAGGTTTATTTTTATAGAAATAAATTTTGAATCATTG
GTGAATAAGTGAATGGTGATTAATTTCACCACCCTTATTTTGAAAGATTTGAACAACATT
GGATATGATCTATGAGATAAGTTCGGCATTTATTTTCTGACCCATTTTCTCACTTGAGAA
CTATTCATTGCATGAGACTTGACTTTTCATTCAAGGGACAGTTGTGCAGTATTCGGTGGC
TTATTCTGGAGAGAGAATTTCTGGGCAGCTTCCGGGAAACATTCTGAATCGATGTGAGGA
AACAAGAATATAGATGAGACTATATGTGAAGAGCCAAGATCTCATGTATACTTACTTCCC
TTTGTACAAATACAAAAGTGTTCATGTTCAAATGACCCATGTGAGGTTGCCTGAGGTAGG
AGTACTCCGTGGGAATGAGTATCTCTTGACCTTGACTGTTTGACTCCCACTTGCTCGTTG
TTAGCCACAGCGATGCCAGGTAGTCATCCTTTAATGAGACCTATCCAGGTTTGAGTGGAA
AACCATATTCATATTCCACCTGCCCCACGTCCTTGGCACATACACAGGCACAGTCACAGC
TATAGATGCCTAGTTAATAGCGTGACATTACAAGTGATCCTCAATAGATCTGTCGAATAG
ATTTGGCATTAATTGTTGTCCCCCACTCTCCACAAAAGCACTCATCTCAGTTGAAAAATA
AGCAATATATCCTATAGCAGGGCCACAATGAGGGGAGCACACTGAGGGTGGGGCCATGGG
GTCCCCTGAGACAGTGGTGGAGGGAAGTAGTTACGATAGTGGGTATGGGGTTGGAATGTG
TGCATGGAAGCCAATCATTAGCAGCATCGTAAATCACGGTGACTAAAATAAAAGTATCAG
AATAAATACAGAAAGAGAAATTTTTACTTTAAAATAAATAAAATGCAGTGAACTCTGATT
TGTGTCTGGTCACTAACAAAGTTTAACCTGATCCCATAAAGCTATAAAGTCTTGAGATCG
GGCTTAAAAATTCTTTGAACACTATAAACATTTTATGACATTTTGATGAAATAAAATGTA
GGCAACAGAGCTATACCTAGATGCTTCAGCTTTGGCTTTTGATGCTGGCGGTCAGACTGA
GGGCCGTGCATCTCCCTAGGCTTAGGTCCTTCCAGCTTCGTTACCTCCTGACCTCACCTG
TGCTCTTAAGCGTGGAGGTCTTGGTTTATTAACCTTGGGCTTGATGTTTCAGCACGTCTA
ATAAAGGTAACACTGCTGCCTGCCATCACAAATTTAAATTGAATGTAGATTAGAGGAAGA
ATTTAATCCCATACTTAGGGTTTTCTTTGTGCTTCATGTCTCTTACTCTGGGAAGAGTTT
AAAAAGTCTTTTAAACATTAAAAAAAAAAAACTTTTTAGTCATTTGAAAGGTTTTATCTG
CAAGGCTAAAGATATAGTGCAGTGGTAGAGCACATGTTTTGAATGTATATGACCCTGGGT
TGAATCACCAGTACCAAAAATAATTTTTTAATTTTAATTTAAAACAAGATGTCTGGAGAT
AGTGGACACCTTGATCTCAGTGGGTGAAGGCTTTCAGTTTTTCACTATTGACTGTAAGTT
TGTTGTAGATGACTCTTACCTATCTTGAGTTATGTTTCTTAAATCCCTAATTTTTTAAGG
GTTTTTATCATGAGTAGATATTTAATCTTGTCCAAAGCCTTCTCTGCACCAATTGATATA
ATCATATCTTTTCTTCCATTGATACAGCATATTACATTCATTGACTTACTTATATTCTAT
TAATTGATTTGTGTGTATTGAACTATGCATCCTAGGATGAAAGCCACTTGATCGTGGGGC
ATAATCCTTTTGATAATATGGTTTGATTCAGTTAGCTAAGATTTTGTTGAGGAACTTTGC
ATCCTCAACACAATCTTAGGAATATTAGCCTATATTTCCTTTTTAGTAATATCTCCTGTT
TTGCTTTTGGAATAAGGGCCATGTTGACTTCCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCACCTCCTCCTTCCGGCCCCCCGGT
GTTGCTGGCCCCGATTCGGGTCCGGAGCATTGTCCGGGCCACGTTGCTCACCAGAATGCC
TGCCACTTCTCTCTTTAATTTTTTTTTAATGAACTGAATTATGGGAGCATTTTAGGGCTG
CCCATTTTCTGAACAATCTGTTAATAGGCACAGTTCAAGTTGGAAATTCGCTCCTTTTTG
CTTTCTTGTGTGTTTCTTTTTGTGTATGGTTAATTAGAAGATGTTATATTTTTCTAATAT
TAGAATCTTTCTAATATTTAATGCTAGAGTAATCTGAATCATTTGTCTTGATCCATATAA
AGAAACAAAATTCTTAACATAGAATTCTTAATTTCTGACTCTCAGATGGCCATAGAATAA
GTCCTCTCTAAAATTGCTGCCACAAAATCAGTATTTTGAATGTAGTGAAATAGGATAGCT
AGTCAATATTTCAGAAGGAATTTAGTTAATTGCTGCAGAATCACTATAGCTGTTGAGCAG
GGGTTTTGGGGAATGCCTCTGATTTGCTCACCCCTGTGTTTCAGATGCTCCTTATGTGGG
TATGTGTGTAGCCATCCTCCATCTCTGAAGTCTCACATGTGGAAGCACGCAAGTGACCAA
AATTACAACTATGAGCAAGTAAACAAGGCTATTAATGATGCAATTTCACAGAGTGGCAGG
TACGTGGTCCTTACCCTTTCACTTCATTGTCATATATTAATTAAGGTTAGAATTAAATCT
ACTCTGTCTGCAGTATAACCAATTCAAGGTTTCCTGTGTTTTGCTTTTAAGAGTTCTGGG
GAAGTCCCCTGGAAAGTCTGTATCAAACAGTAGTGAAGAAAGAGCTGACCCTGGCACTGG
AAGTCCAGAAAACCTGGTGTCATCCTCCGAGCTGATTTCCCAGGCTCCCAGTGAAGTTGT
AGGTACCAACGAGAATGAGAAACTGAGCCCTACAACTAATACCTCATATAACTTAGAAAA
GAACTCCAATCTGCCCCCTCCTAGTATGGAGTATTGTGTTTTGCTCTTCTGTTGTTGTAT
TTGTGGTTTTGAATCTACCAGCAAAGAAAATCTTTTGGATCATATGAAAGAGCATGAGGG
TGAAATCGTGAACATCATTCTAAATAAGGACCACAACACAACTCTAAACACAAATTAGAT
GGAGTGATCACTTGAAGAGGAAAAGCGTAGAAGAGGAGTCCTTTACTTTAAACCACAGTT
TCACCTTTGCGCTATCAAATAATTTGCTAGACACAGAAGAAGTAGTTGGTGTGATTTTTG
AGGAAGTAGCGGGCGTGACTTTTGAACCAAATTTGTAATGGAATCAAAGGTATTCCAAAT
GGTTGAGCAGTACATATTTAAATATTTTGAGTGAATAGTCATGGGTTGAGGAGGAAGCAA
AGATATAATCCTATATTAATCCTCTGTTATATCTTCTTAGTATTGAGTATATTTATTATT
AAGAACTTATTATAGTGTAGAAATGCAAGCAAAAGTGTTAAGGAGGAACTTTTTGGGAAC
TATTTTAAAACATAGAAATGTCACGGTCTTAAGCAGAGCTTGTTTTCTTCATTCTCAGTT
TGGATATGCCCGCTCGCAAGTGGCAGGCCTATTGTCAGTGGACACCGCCTGAGATTTTTT
TTGTGGTGTTTATCAAGAGCAGAAAGAAACGATCATTATTAAGGGTTTTTGAAGTAGTCT
CCTTCATGTCCCCGAAATTGACAGGAATTAATCATATACTCGGTCTAACCTGTTTTGCTT
TATTCCTTAAAAAAAAAAAAAGAAAGAAAGAAAGAGGCCTAAATCCTAATGTAGGATTTT
TAAAATGAATGGTGGTCTTAAATTTATAACGAATCTTTGGTGGGCAAAGGAGAGAAATGG
GTGAACTCCCATCAGACTGCAGTCACATTTCAAGGCTGATCAAGATGGTGAGTCACCGGG
CAGAGTGCATTCCCCACAGCCCTGTCGGTGTGTTGGAGGACAGCCCACATGTCACTCTAG
CTCCGTGGGCTTCCACTCCAGGCCAGGCCATGTGTGGTACCTGGAAAGGGGTTCACGCAG
TACAGTGTGAATTTTTACATTGATCGTTAGACCTGGGAAATACATTGAACCGTTCAAGTA
AAAATTCACTTGAGGGAAGGAGGTGAACTTCAGAAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2042, 2044..2060, 2063..2086, 2089..3126, 4500..4617, 16306..16420, 29984..30118, 30231..30597
1001..2042, 2044..2060, 2063..2086, 2089..3126, 4500..4617, 16306..16420, 29984..30118, 30231..30594
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved