Sorex_araneus Locus RANBP1
snOPY snoRNA Orthological Gene Database
Sorex_araneus RANBP1
Sorex_araneus
RANBP1
GeneScaffold_2755
SNORA77
6344..6470
7812
GGCGGACCCCAGTGGGCTGCGGCGCTGCATTGGGGCGTGAGCTGCCTCTGCCTCCCGCT
TCCCCAGGGCTGGCGCTCACCCCGCCGCTCGCGGGGGCCACCTGGGGCTTTCGGCCACTG
GCTACGGGGCTCGGCCCACCTTGCAGGCTCCCCAACCCCACCTCACCCCCGGACGCTGCA
GCCCTCCCCGGGCGCCGCCTACGCAGCGCTTCATTCATTCAGCCCCCGAGTCCCAGACCG
CCGCGGGCCTCTGCGGCGGAAACTCAGCCCGGCTGCCGGGCCACGAGCCCGCAGCGCACG
GCCCAGGCCAGGGCTGCTTTGTTGACCGCTGGCATCCGCCTCGTGGTTGCCGAGCGGGCC
TTGGCCGAGGGAGGCGCCCACAGCTGCGAGCTCTTACCTGATTTCGGATCTGGCTGTGGA
GGTGCCTGGAGCCTTTGGTTTTCACTGGTATTCCAGCCACGTGCCCTGCCAGACCCGTAC
CTGCAATAAGCTACTTTGTAGCTTTCCAAGTGGATCAGTCTTTATGGTTCTAATGTATAT
GATTACTTTTAACTTAAATTTCTTTCTGGTTTGGGGCGGGAGGGATGACGTGAGAATTGG
GAACTGTGTAAATAGTAGCAATCTGGTAGTAACTCTTTCTTTTTAGTAAGTGAGAGTACT
TAATGTCTCTGATCCAATAAAAAAAAAAAACTCAGGGTTACTTTTTGCTTGAAGAGTAAC
ATCCTCTGGACCCTCTGCCCCGGCCCCCGTTTTTTGATCTCCGTCAAAGAAATTGAGGCA
CGGGGAGATGAATGTTTCTTGGGTCCCTGGGCTTTGTCATAGGAGCCTGGTGTTGAGGTC
AGGGTCGGACCCTCTGCTGGGTTTCTGCAACCGGACCTTTTGCACACCTGCCTCTCCTGG
TTTTCAGGCAGGCTCTTGCTTTGGGGTGATATTATTCACTGGAGGCGCTGCTGATGAAGC
TCAAAGTGGCAAAAGTCACCTCTCCATCCCTCCTTCCACAGGACACCCATGAGGACCATG
ACACCTCCACGGAGAACGCAGATGAGTCCAACCATGACCCCCAGTTTGAGCCTATAGTTT
CTCTTCCTGAACAAGAAATTAAAACGCTGGAGGAAGACGAAGAGGAGCTTTTTAAAATGT
AAGTGACCGCATGTTGCTCCAGAAGTAGGTATCTTAGGTATAATAAAATGAAGTTAAGAG
TTTTATGGGTGTATCACTGTTGTTCTTCCCTTTTGTTGGAGAATGGCTTGAGCAGGGATG
AATCCCCCATGGAAATCAAGGCTCACTGTTCAAATTCACACAGCAGCTGCCCCATGCCAG
GCAGGGTGCACAGGTGACCCTTGCCTCGGAGCTCATTGTCCCTTCCCCTCGCAATCCCAG
ATGTCTAAGCCATTTTTATTGATTTTGCTTTATTGCATAGTGAACTTGGGTGGTCTTAAA
ACTACCCAGTATTTTGAATGTTTGGAAGCACAAGGAGAAAGGAACCATCCGCCTCCTCGG
GGAGGGACAAGACCCCGAAAATATGTGCCAGCCACTATAGTAGGTGGCCTCTGGGCATGG
TTTGCCTTGAGTTCAGGACTGCATCTGCATGCTGTGGTCCTACAGGTCCTATTGCTGGGG
CTCTTAGGTTTAGTTACCTATTATTTGGAAATAGGTCGTAGCATTTTATAAGCTCTAGGA
ATTCCCCACTGTCCTGAATGTACCAGATTAAGCTATTTGGGAACTTGTGGGGTAAAAGGA
AGACTGTTGGTGAAGAGAGATGACCGTTGCCCCTGACCTCCTTTTAAGGCAGGCCTGGGA
CTGCAGAGCTGCAGGTCTCTTCCATAGACTGGGTGAGATCTCTGAAGATGCTCATTCTCC
ATGCCTGTGCAGACCAAAAGTGATACTGCACTTGGGGTAATTTTACTTGGCGGCAGGGTG
GCATTGCTGCTTTCCTCTGCCTGCATAGGGTGGAAAGTGGTCTGGTGCTCTGATGGAAGC
TTTCCTGAGGATCAGCATATCAGGTCTTTGGGCTGAAGCATCTGGGAGATCCTTGTAAGG
ATTAAATTGTCCCACTTAATAAAATTAGGTCAGGATGGGAGAGCTGTCTTCTCCAGGAAT
GGGACCTTAGAGTAGAGGTTGGGGCTGGTGAGGGGGGTGTCACCCTGAATCCACAGGGCA
AGGATGCCTAGCTCACTGTTGACTGCCTTGCTTATTGTGCAGATGAAGGAACAGAGTCCG
GAGGTGTGATCCAGTGGAGGTCACCAGCCCCTTCTGGGTTGTGTGCCAGGGATGTTCTAT
CTTTGGCCTTGCTCTGACTCCGGGCAGACCAGTCCTGCTAACCAGGAGGAGGTCTTTGCT
GAGATGGCAGGTCTTTAGGAAAATGTTGCAGCTGTGAAAATCTTTTTTTCATTTGTTGCT
TTGAGGGCCACACCTGGCAATGTTCAGGGATTACTCCTGGCTCTGTGCTCAGGGATTGCT
CCTGGCTCTGTGCTCAGGGATCATTCCTGGTGAGGCTCTGGGGACCATATGGAATGCTAG
GGACCAAATCCTAATTGGCCTGTGCTAGGCACAAGCCCTACCTACTGGTCTCCAACCATT
TTTCTTTTATGCTGGTGTTTTGACTTGTATGTATAAGTTCTTCCCAGCAAACATTTGGTT
GGTTCCTGCTTTCTGTGCGTGTCTAAAGCTGTTGCTCACTGACTTTTTGTTTTGTTTTGT
TTTGTTGCTTTTCTCATTCTTTCACTGACTTTTCTTGAAGGCGTGCAAAGCTATTTCGAT
TCGCTTCAGAGAACGATCTTCCAGAATGGAAGGAACGAGGCACCGGTGATGTCAAGCTCC
TGAAGCACAAGGAGAAAGGGACCATCCGCCTCCTCATGAGGAGGGACAAGACCCTGAAAA
TATGCGCCAACCACTACAGTAGGTGGCCTCTGGGCATGGTTTGCCCTGAGTTCCAGCACT
GCATCTGCACGCTGTGGTCCTGCAGGCAGGTCGCTGTTTGGACCTCCCCGAGCCTGGGAG
TGGGCTGCTTCCCAAGACCTTCTGTTCTGCCTCTTAAATGCGGAGTAGGAAGTGAGGCTT
TCCCAGGTTCCTCTGCCCACAGAGGGTTTGGAGCACAAGAGGCGTGTCTAGGCAGATGGG
GCTGACAGGGGCCATGGAGAGCCCCAGTGAGGGCCTGATCGTGTATCAGGGAGCCTGGGG
GTTATGTGGGGTATGGTGTGGTCAGTGTCCTCTTTGTATTCCATCCCCACGTCCTGCGGC
TTGGTGGGGGGCATGGACAGGAATGAGCTCTCGTCCTTCAGAGAAGTTGTTGGGGAGTAG
ACCACTGGAGGCCCTCAGGCAGATGCGCTGCTTCAGCTCTGGTCCGGAAAGCAGCAACAG
GAAGTTACCAACCACGCTGCTTTGCTGTGGACTGTCCCCAGTGCTCGGAAGGTGCCTTTG
GGCTCCTTTCCTGACCCAGTGCTGGGTCTGCATGTTTTGGTGTCTCACATGGCTGGCAAG
GCAGGCGTGGGTCCTGCAGGGTGACTGTTGGTGAGGGCCTGGTGGCCCAGTGCCCAGGTG
GTGCGGGAGGAGTACACCTCCATTGTGTGTGCTCACCAGCCAGGTCACACGCTGGGGCCT
GTTCCAGCAGCCCTGCCCCACCCAGCCTGCTCTGCTCCCCTTGGCTGCAGTGTGGAGCAT
TTGCTACTCCCCTGGGCTTCTCCCAGAGTCTTGCTGGGAACTGGGGTGTTTCTGTGGATT
GTTAAGTGGACCTCAGGCCTGGGTATGATAGATTGGGTGGGTGGTGACAGGAGGCAGCCC
TGTGATACCTTTTATATACTGTCTTAGCTCTCAAACAGAATGTCTCCAGTGCAGACAAGA
TGGCCCTCCCAATTAAGTTGACTAGCGTGTGCCCAGAGCTGTGGGTTGTCCTTGTCGCCC
TAAAGTCTTCCAGAGACAGGGACCAGGCGTCTAGTTGCACAGGGGTGCTCGTGGCTCACC
TGCAGTGGGTCTGCCAGGGCCCAAGGAGATGGCACCGTGGTACTTCCCCTAGCCTGTGGG
TTGTGCCCTTCCTTTATGTAAAATCCTGCCATGAGATACTGCTATCCCCTTGCACTGGGT
CCCTGTGGTCTTGCCAGTGGAATGCTGAGAGTGGCTGTCCTGGTCTGACCACATGCCCTA
TGTGGGTGACAGTGTGCTTCCAGTTTCTGCCTTCTCTCTGCTCTGCATTCCTGGTGGTGT
GGTCAAAAGTGAACGTGGCTCTGTGGCTGCGCCTTAGGGGGGCCACTTGACTCGTGCCCA
CACCTGGCCCAGACTCTGGGGGTTGCTTTGGCTGGGCAGGACCAAGGGAACTGGTTTCTC
CTTAGGATGAGTGCCCTTGTCAGCACAGGAATTGGAGAGTTTCTCGGAGATTCTCTGTGA
CTGGGGAGCACGTGACTCTGTTCCTCAATTGGGGGTTGGCCTATTGTTTGGTCAATGACA
GTGTTTTCAAAGGTGCAGTAGAAATCCCGTAAGCCTCACACCAGGTCTGTTTGACCCCAC
GTGGACCCTGTGGTCTTTGAGTTCGGATGTGTGTGCTGACCCGTGACATCACCATCCTCA
TACGTCATCCTTCCACAGTCACACCGATGATGGAACTGAAGCCGAATGCAGGTAGCGACC
GCGCCTGGGTCTGGAACACCCATGCAGATTTTGCTGACGAGTGTCCCAAGCCGGAGCTGC
TGGCCATCCGCTTCCTGAACGCTGAAAGTAAGCCAGGGCTCACTGTGGCCCCTTCCACAG
TGTGTGACTCCAACCACAGGAGTATGAACAAGAATGGGAACTTGGGGGAGAGGAGGGGGC
TTTTCGCCCAGCACTCTGGGAGCCTTGTCACCACTTCCCTGAGGCTAGTTTTGAACGTGG
GTGTGAGGCATCCCCTGATAAGTTCTCAGACAACAGTGGGGTGTCCAAGAGTCTGCTCAG
CCCTGGCACTCATACCAGGACTGTTCAGGGCTGTCATTGGACTTTTGACCAGTCAACTCT
GTACTGGAGGTTTCTGGTACCCCTTGTGACACCTCTCCCCCCACCATTGGGGGAAAGGAA
GTGATTTAGGAATAGCACATTGAAGGGAGATCTACAGTTTGAGAGGAGGATGGGGTTTCA
TGCCCTTGCATGAGGTTGTGTGGGGACTGTTGTGCCCCAATCTATGTGTTCACCTACCCC
TCGTGCTCTCTGAGCCTCTCCTTTTGGGACTTTTTACACTTCTTTCAGTCCATAACTCTG
ATAAACTCATTGCCCACCGGCAGTTGAATCTGATCTCCGGGTGGAACTGGAAAGTTCTAA
CCATAATACGTGATTGGTTTTCCTGGCAGTTAGCCTCCACCCTAAGTGCTTCCTTCAGGT
CACTTTATTAAGAGAAAAGGAGCTACCATTGGTGTCTCCGTGTTCATCGGCGTCCAAAAC
TCTGGGGGAGTTGTAAGCCACGAGGTAGATGCCGTGAATAATATTTTGGTCATCTAGTTT
CTTGCTGTGATTTGGCCCCATTTCAGGTCATGTAACTGAATATGGAGGGCTGTGGAAAAC
TTTTTTTTTTAAATATAAGTATAAAAATCTTTTATAAACTTTGTTCTTTATAATTTATAT
CAGTAAATGATTTATGTGCCTAATTTATGTACTTATGTACCTAAAACTAGGTACCAGGGA
TTGCATTGGGTTGGTTGCATTTTAAGCTACCTCTTTGGCCCCACAAGTGGAGTCTAAGAG
GCTCGGGTCTAAATCCCTGAGAGTCACAGTAGCATGTGGTCACTTAGGGCAGGAGTCACA
GTGCTTGAAGCCTCAAACATGTTTTTTTTTTGTTTTTTTTTTACCTCAAGGCCTGTGTGC
CAGTAGGAGCTGGGCTGAGACCTGTAAACCAAGACTGACCTCCCCACTTGGGCCTCATTC
TAATCTAGTTAAAAATTGGGTGGTGCTGGGTGCACCCCAGAATCTGACAGGTACTAATTG
GACCTGGCCTGTGCCCCAGGAGCGAGGTGTAGCCAGTAGCTGGCTGGAGCGTGATGGAAG
AGCACAGGCCCACTGAGCCTCTGAGTCTGCTGGAGCCACTGCTGAATCGGATGGGAGCGG
CCTCGCACAGAGGCTCGCTTTCTCGGGCTCGCAGGGCAGTGGCTGCAGGGTCCTGGTGGA
AGTAAACCCCAGGTCTAGACAGGTGACCTAGCTGTTCTGGAGCTCTCTTTGAGCCCTGCC
TCCTCAGTCAGGTTTTGTCTGCTTCACTGCCCTAGACTCTTAGGACATCTCTTCTTTCTG
CAGATGCACAGAAGTTTAAGACAAAGTTTGAAGAGTGCAGGAAAGAGATCGAAGAGAGAG
AAAAGAAAGGTGATATGGGCCAGGGAAGTGGGGAAGTCCTCTTTGCAGACTCACTCTGCA
CCCTGCTGCATCACCAAGCATGGGTGCTTTTTCTGTCTGCCACAGAAACATGCCAGGGAC
TGGTACTGCTTTGACCTATCAAAGTGGCGAAGCTGCCATGGGGACACGGGGTGCTTCTCG
GGGAGCAAGCTGGGTGGAGGTGCCTGAGTGGGTGCAATCAAGACACAGGGTCTAGAGTCA
CCTGTGCCAAAGGGGCTTCAGAGATCTCCCTGCTGAGGTGGCTGGAGGGTGGGTAAGGGG
TGTGACACTTGCATGCCGGGTGAACCCGCTACGGCGTGGCTGTTGGGGGTCAGTGCTTTG
TTCTTACTGCACATTCCCTTCATTGTGCCAGGATCCGGCAGAAACGATAATGCTGAAAAA
GTGGCAGAAAAGCTGGAAGCTCTTTCGGTGAAGGAAGGGAGCAAGGAGTCTGAAGATGCA
GAGACCAAGGAGAGCGCCGAGGAGAAGCAATAAGTCATCTTCCCTTGTTTTCCTTCCCTG
CCTTTCTTTGCCTTTTTCTTTTTTAAAATTCTGCCCTGCCCCTCTTTTCAGTTTGTTTTT
ATTCTGTTTTGTTTTTACAAGGGACTTTATATAAAGAACTGAATTCCAACATTCAGGTTG
TTTTTCTAAGTTTTTGCCCCACTGAAGAAGACTACAGAAAATCCATTCCCCAGTCATGAA
AATGTACTGTGCTAACTTTCTTTTCCATAGTGGAAACATTTATAGTCATCAAAACAAGTG
AATAAACAACACATTTGAACCCTGCGTGGCGGGCAGGCCCGTGTGTGCGCCGGCCCTGTC
CCGAGAGCAGAGGGGTCCTGCTGGCTGCGGGCAAGGTGCCAGACTTGGCTTGGGATCTGC
TCTAGCCTGGCTTCAAGGCCCACTCTGTTATGTCTCTCCTTTGTGGGAGTTGTGCCCGTT
TGACCCAGTGGCCCAAGTAGAGAAAGTCTGGCGCTGGGTGCCCTGCCTTCCTGTGAAGTC
CTAAAGAGCCACTTTGGGCCTGACGGCAAGAGGAAGTACTGTTTTTTCACTCTTTGGTAC
CTTGGCATTGGCATCAGCAGGCCAGGCCTGGTTGATTCTGGTGGGCATGGCCAGTCTTCA
TTCTCCCCACCACCCTGGGAAAAGGTCTGCTGGAGTGTGCTTAGAGAGTTTTGAATAAGA
AATGTTTGCAAGACTGCCAGGAGGTCCATCCTGGGAAGAGGGTTGCCTCTGTAAACACTG
CTAAGAGGGAAGGGTTGTCAGTGTACCGGTACTTTGGTTTGGGTTTGTGGCCATCCCGGC
TGTGCTGAGGATACGGTGCAATGCTAGGAATCATACCCAGGACCTCACAAATGGAGGGCA
AGTGCACCGTCACTAAGCCACATCTCCCGCCCCTACCTGCTATTTTAAGTGCACTCTCCT
AAGATAATGTGTGTCCCCGAAGACCATCAAGACTGAGGAGCCCTCTGCCTCCCTGCAGGG
GAGGAGTGCTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1137, 2740..2897, 4578..4706, 6243..6308, 6688..6756, 6781..6812
1001..1137, 2740..2897, 4578..4706, 6243..6308, 6688..6756, 6781..6809
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved