Sorex_araneus Locus CAB39L
snOPY snoRNA Orthological Gene Database
Sorex_araneus CAB39L
Sorex_araneus
CAB39L
GeneScaffold_1253
SNORA58
61950..62080
83236
TAAATAAATAAATAAATAAATATTTGAAGGGTAGATAAAGAACATATTCTAAATGATTT
TACATTGCAATTTTGTGATTGTAATGGGGTAGTATATTTTAAGTATTATATTACCACAGT
ATATGGAGTCTAGTCCCAATTTTGTTTTATATTTTTTTGTTATTATCATCATCACTCTTT
TCAATATCTGCTTTTCTCTTTTTTCCTCTTCTTATATAATCTTTGTATCTTTCTCATACG
AAACATTTTAAACTTCAAGTAAAGCAAATTTTGATATATATTTTTTTAAAATCTCAATGT
GGGCAGTCTGGTGATGTGGCTCAATGGTAGAGCCATTCATTCAGAAGACCTGGATTTGAC
CCCCAACACCACACGAAATAGATTACACATGTTTTTTTTTTAATTGAATCACTGTGAGAT
AGTTATAAAAGTTGTTCATAATTGGGTTACAGTCGTATAACATACCTGTATTTTAGAATA
TTGAAATTTGACATAACACTTGAGAAAACTCACTTTAATTGATTTAAATATTTTAGATGG
CTAAAATGAGGCTAATAATGATCCACACTACGTTTTCCAACAGTTTTGTGTTTGTTTTTA
GCATTCCATATAGGAAGAAGAGATCACTATCGATGAAGAAAATGCCTTTGTTTAGTAAAT
CCCAGAAAATCCGGCAGAAATTGTGAAAACTCTGAAAGATCATATGGGCATTTTGGAAAA
ACAAGACAAAAAGACAGACAAGGTAGGAGCTAAAACAATAGCACTGTTATTAAAATACAT
ATATTTTAAGACCAAAATCAATGTAAAAGTTTAACGAAGAACTTTAAATATGGTTTGTGG
TATACACATAGGGTCTTTGTAAATACATTTAAAGTTACTGTCAGTCTTCTGTAACTGTAA
TTCTGTTGTCTTAAATTCTTAGGTCATGATCTGCCCACTCTGACCAAACTTGGATCTCTA
GGCAGCTCGGAAACTCTAAGGGGTTATGCTGATATTCAATCTTAGATTTGCAGGAAGTGG
GAAAAGGTTTTAAGAATCAGCTAATATTTTCTTCTACAGTGCAATTTAATTTTAATACAG
ACTGAAGGACCTACTAAGGATGAATTCCTCAAATGAAGAGGGGTTGTTTGTTTTTAGCTA
TTTCTGCAAAAGGATATTGAATCCTACATTTTCAGTTTACCTCCAAGTGACTATTTTATT
GAAAGATACAAGAGTCCTATAAAACAGAGGCCCCTGAGTTCAAACTATCCATCTGTCCCA
GTGGATATAATATGGTCTTGTGTTCTTATTAGGATGTAGAAATCTTATTTTTCTTCTGAC
ATCTTATAATGGATATAGAAATATGTTCTTAAACTTTTATTTTGAGGTACCATGATTTAC
AGTTGTGTCCATTCTAGATTCTCATGCATACAATGTTATATACCACCAATCCCACCACAA
GTGTCAACTTCCATCCACCAGTGTCCCCAGGTCCCCAACCCCGGCAGCCTACTTCAGTTA
AAAAAAAAAAAATGTATAAGATTCATTGATTTACTTGAGAGGCACTATTAACGTCTCCAT
TTGTCCCAGCCCTGAGATTTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAGAAACTCTATCAAGTGAGTGGTCAGACC
CGACCTGCATTCTGGTCCACGAGCCAACAGTTAGAACCAAGATATAAGACCAGCGATTTC
CAGCCTTGCTGCATCTGTGGCCCAGGACTGGTGATTGAAGAGCTCTGTTCTAGATCTTTA
ATTTGTTTTTATTAGGGGCCACACCCATAACTGTTCAGAGCTTATTCCTGGCTCTTCCCT
TGGGGATCGCTCCTGGCAGGGGTCAGGGGTGGGGGGCTGGCACAATGTACAGTCCTCTGT
GTGAAACTGCTGGTAGGCACATGTACAAACAAGTTCCCACCAGTTGGGCTGTTTTGCTAA
TCCAAGGACTCTGCTCTCTCTAAGCTAAGGATTTAGCCTCATCCTGTAGTCCCTTTTAGC
CACAGGCCAGACTGTGATAGTGTGGAAGAAAAGCCCCGTGGGATTATCATGTGTTCCACA
CAGGAGTTTACAGAACACCAGAGCCAAGAAACACAGTAACAGATAATTATGTTCATTGTG
TGCATTCACTAGTATTCCAAACATCTTTTTAATGATTAGCAACATAGACACAGTTTCAGT
CTAATTTTATTGGCAGCATAATTCTATTAGCTGGCTAGCAGTTGTGCTTCATAATTTTAG
AGACAGTTCTGCCTGCAAGAGAGGTGGGTTGTAACATGGTAAAAATTCTGATGATCAAAG
TGAAGAATGTATCTGTTAACTTATTTTAGTATGACGTGTACGTGTATCTCTAAGCATATG
CTAATTTAGGGAAATGGCTTAACTAGACTCATTTAAATTAGGGAATTATTTGTAGTAAAA
TAGTAGCATTACTGAAAGCAAGTTTGTTCTCCAGTAGGGATGGAGGATGCCAGCAGTGAG
AAAGGAGAGGGAGCTGATGGTGATTACTCCTAATAACCATCAAGAAAGAAAAGTATCTGT
CCTGTTCCCTGTTAATCCCCAGCATCAAATATAGATTTGGCGTAATTGGGACTCTGAAGT
GTTTGTCCAATGAAGAGTGTGGTTTTTGTTTTAGAAAAATTTCATGGAGGATGGGGCCGG
AGCGATAGCACAGCGGGTAGGACGTTTGCCTTGCACGCGGCCAACCCGGGTTCAATCCCC
GGCATCCCATATGGTACCCCAAGCACTGCCAGGAGTAATTCCTGAGTGCAAAGCCAGGGA
GTAACCCCTGAGCATTGCTGGGTGTGACTCAAAAAACAAACAAAAAAAAATTTTCATGGA
GGAAGTGGAGACTAAATGTGTTTTGGGCTGAGTAATAAGTATTGGGAATATAAAATTGGG
ATCACTTTAATGAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTATATCAATCAGACTCACAAGCTTAGGCTCGCCCACTTAGTGCAAAGTGGG
GTCCTGGTTCTGCTTTCAGCTTGCAGGGCAGCATCCAAGGACTCATCTTCATGATCTGGT
TGGGCACCAACAACTATTAATCTTAGAATTTGGCGTGAGTTACAGTCCATTTTATTGGGG
AACCCTATGCTCAGAAGTTATTCCTTTAACTCAAACATGAAAGCTTGTAACTATCTCACA
GTGATTCAATAAAATTTAAAAAAAAAATCCTCAAGCATATGGTCTAGAGAATATTCAGTG
TTCTTTGAAGAGTTGTATTGATTTGGGGAGAATTGAAATATCCTATCAATGTCTACTAAT
ATCTACTAAGATCAGATATTTCAACTTCTAAATTAAGCTATTTTTATTATATGTTTTTCT
GTCTGGTTTGTTATGAAAATCCGGTATTAAACTTTTCTAATACAGTTGAAAAAAAGAAAA
AGAAGTGATTCCTTGCGATTTTCAGGGTACCTACCATATATGTTCTGGGGATTGAACCAG
AGTGGGCTGCAAGCAAGTCAAACACCTTGACTCCTGCACTTTCTCTCTGCCCTCCCTTTT
TTTAAAAAAAAGCTATACTTACATGTTTTTTGTTTGTTTTATATATGATTACATGTTTTA
GATACTTAGCTGCATATTCTGCTACTCCCTCATGTTCTTTTCAGATGACTTTTTTTAAAC
ATTTGAAAAACATTTTGAAAAAAGTGAAGCAAACATTAGCTTCCTAACTTCATCCTTCTG
TCTCTGTGCTTACATTTTCCTTCTTACTGATATATGTAATCATATATATAATATATATAA
TTACTCTTCTAAAAACTAAACTTCCCACCATGTTTTTAATCCTTTTCCATCATTGACTCA
AATATCTTTGCCCATTTCTTAATTGCTTTCTTATCTTGCATCTTCCTCATATCTATTCCA
GTCACTCACCTGAGTTCCAAAGTGAAATAAAAAGTAAACAAAACCTCCTTTTAATAGCCC
TTCAAGCTCAACTTCCATTTCTTATCATACACTTGGGAACTGTAATTCATGCGTGTGCCT
CTGTTACCACATCCTTAATCTTTTAGAATTCTAATTTTGCCCTTGCTGTTCATTATGTCG
GGTACTGCTAGTGAAACTCAGCCTGCCATTCCGTGTTCCAGACAGGCAGTCGAAGTATGC
TACCTGTATTAGAGTTTATATATGGTTGATTGAGCGTGATGGCTGGAGCTTGCACACACT
TGTGGCGCTTGCATACATGCTTGAGGGGTCACACTTTAGAGTTGTGGTCTTACATAAGTT
TTGGTGGCCGTACTCACCCGAAGTCACGTATTCATTTGTGTTCTTTTGCTCATACTTAGG
TGCAGTCCACTGGAGCTCACACACTATTGTGGCTTCAGGGAACCCAAGCAGCAGCCCTAG
CGGGCCCCTTTTGGCCTTCCTGCATGCAATGCAAATCTACCACTGAGCGCCCAGTGGACC
CCCTAGAGCTACTGTATTTAATTTCTCAGGACTGGCGGTGTGTCCTTTTCCTACTGGGCC
CTGTGCTGTGTTCTTACTTTTCAGACTTACTTTGTCCTCTATCAGCTCATGTCTTTAGGG
TATCAGGGGACTATCAAGTCTTTCTGCTTTGTTTTCTTTTGTTTTGTTTTTCTTTTAAAA
AATTAAGTTTGATAAATAAAGTTTGTAAGTGTACAAATTTAAATTATATAGTGGTACTTT
GATACGTTTATATCCTAATATAAGTGCCAGTGTAATGTTTATTATATTTCATAACTATAG
TACAATATTATTGTTTATATTCATTATACTGAACATTACAGCTCTATGAATTGTTTATTA
CAAGATTTTACTTTTGTAATGTGAACATTACTTTATAACCTCCCACCTTTTACCCTCCTG
ATAGCTACTATTTTACTATTGGTTGTTTATCACCTTTGTCTTTTTTTAGATTCCACACAT
AATTTCATATAGTATTTGTTTCTCTCTCTGACTTACTTGTGTGCTTAAGATTGACCCATA
TAGTCACAAATGGGAAGATTTCCTCCTTTCTTCTGGCAAAATAGAAAGCACATCTGTGTT
ACCCATTCATCCATTGATGGGCTTTTGGGTGGGTTTAAATATCTTAGCTAATCATAGTAT
GATAAACATGGGAACACATAGATTTTTTTTGAAGTCTTGTTTTCATTTTCTTTGGGTGTA
TACTCAGAAATAGAGTTACTAGATGATATAGATTATCTGGTAGCTCTATTTATTTTTTTT
TATAACGTAGAAGCACTGCTATTTATTCAGCCATTGATTAAGCTGATTGAATTGGGCATG
AACTCCACATTACTTTTGTAAAAAATTTTTTAATTTTATAAGTTAGTTCACAATATTTGA
TTACATTCAGTATTCAAACACCAATCCCACCACCATTACATCTTTCCACCACCAAATTTG
GGATGTTTCCATCCCAAACCCCAATCTCTGTCCCAAAACACAAATGTAATAACATATTTC
GTATTGTCTGTTATGAAGAACTGCTTACAAAATATTCATGTAGGAAACAGTGTGAAGATT
GTTCTATTTTGGCAGGAGCCATTAAGACATTCTCTAGGATATCACTAACATGTTGTTAAA
GTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAATCCGAGAGGGGGCGCA
TTCACAGCGGTCCCTAGAGACATGACGAGCTGACCCTGTTAATTCTCGCCATCTTTTATG
TGGGTTTGTTGTGTGTTCGGGGTTAAGTACTAGAGCATCTTTTAAGTGTTTTTGACCATC
TGACCTTTAGTAAAATAATTATTTGTTCTCTCATTTTGAATCAGATGTTTTCTTATATTG
AATGAATTTTTATATGAAGTTTTGATGTTATTCTCATCCAATAAATGATTCATAGAACCA
TTTACCCATTTTGTAAATTGTCTTATTACTCATTGTCCATTTACTCTACAGAAATGTTAG
AGTTGATATAGATCTAATTTTGCTCTTATTTGTGCTTTTGGTATCAATTTTAAAAATCAT
TGCCAAGACTAATACTGATATATTTCCTCCCTGTCTTCTAGGTGTTACCAGGTCTTATGT
ATAATTTTTGATGCATTTCATGTTAATTTTGTGGGTTATGTGAGTTTTGATTTCATTATA
CTGCATAGTGTCTTCTCAGACACTATGAGAGAAATGGGAGAAATGAATTCTCTGTGTTTG
TGGAGAGTGAGTGTCTTCTGGCTCTGAGTTCAGGGATCCTTCCTGGTGGGGTTTGTGGTA
ACACATAGGGTTCGAACCTGGGTCAGCCATGCAGGGTCAACCTACTGCTATACTATTGCT
CTTGCCTTCCAGCCCCTAATTCTCACAAAATTTCCTTCCAGTGTCCTGTGTAGTTCTCAG
GACAACTTTTTTATCCCTAATACCCTTTCTTTGTAAGAACTGAAAAAGGACCTTGAATGA
AATTAGATTACATGTTTGGACAGGGTTCTCCTTGATGCCCTTTAATTTTTAATATTCTTA
AAGTTCTCTTTTGTTGGACATTTTCATAGTATTCCCCTCCATATCTGTCTCTGTCTGTCT
GTCTGTCCCTCTCTCTCTCTGTCTCTCTCTCTCTCCTCTTTCTTCTTAGTTTAGTTGCTG
TTTTTTTCCTACATGATCCAGTAACTCTACTTCTGGGTCATGCAGTGTGAGGATGGAAAG
TGAATCCCTGCAGATGCATGGTACACCATAACCACCGAGATATCTGCCTGCCTGGTTTTT
ATTTTGACAAATGTCTATCCTTTAACACACACACACACACACACACACACACACACACAC
ACACACACGTACTGTTCACTTTGTTCACTTGATCCTCCAGACTGGTCATGGAAGCTTATA
CTGTTATCTCCAAGTTAGTAAGAGAGTACTTGGACATAGGCAGATTTCATTCAAATCTAG
ATCTGCCTGAGTCTGAAGACTTTGGCCCAAGAAACTAGTCACTCAGTATTTATAGAATGC
TCAGAAGAACTTATAACATCCTTGAGAAACTGTGTCTATTTATTACTAAAATATTATTGA
TATGTATATAAAAATGGAGATGTTACTGGTGCCCGCTTGAGCAAATTGATGAGCAACAGG
ATGACAGTGATCCAGTGACAGTGAGAAGCAAAGTAGTCTTCCCTGGACTGAACTGAAAGT
TAGAGTGATCTTAGATCTTACTGTCAGGGGGTTTAAGTTTCGTAGCTGCAACTGCAGCTC
AGTACCAGCAGGGGGCCAGAATAGTGCCGGACCATGAGAGCATGACATTCTCTGTTCTAA
GAACTGGCTCTGGAAGTTTAGAAATAAAGCTAGTGAGCGTAGGAACGCCAGATGTCAATT
ATACAACATTTGGAGGACATACAAGAATCCAAGAAGAAAATAATTGTCAGTATTCCAACT
AATGTGAGCTTTTCAGTATTCCATTGTAGTAGATGTGTAACTACAAGATTAATTGTAATT
CCATAGTTGTGGACTTCAAACTTACTTGTTTTGCTTTTGTTTGTGAGTAGTAATGAGGCT
TTGAAAATGCTTTCCTCTTTTTGTTTTTGGGTTTTGTTTTGGGGCCACCCCTGACTGTGT
TTAGGGGCTACTCCTGGCTTTGTGCTTGAGGATTGCTCCCAGAGGGGTTTGGAGGATTAT
GTGGTGCTGGGACTTCATCCTGGGCCAACTATATGCAAAGCATGTGCTGAGTGCAGAGAG
CTGTTTCTCTTGACTTCTTACATACGTGCTTCCTTAGGATAAATATAAAAATAGTGTAAA
ATAGAGTAAAAAATTATATTGAGAAAATATAGAGGCTGATACTATTCTATGGGGATAAGT
ACCATGGGTAGAGTAATGGATTGAATTACCAACAGAATCCTTATTATTGAGGAACAAATT
AATGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTGAAAATAAATAAAG
GGCCAAATGTAATAGCCTCTCAGTATCTGTATTGCAAACCATAATACCCAAAAGTAGAGC
GAGAGTATGGGGGTAATTGTCTGCCATGGAGGCAGGGGGAGGGGCAGAATGGGGGGGATA
CTAGGGACATTGGTGGTAGAAAATGTGCACTGGTGGAGGAATGGGTGTTCAATCATTGTA
TGACTGAAACTCAGACATGAAAGCTTTGTAACTGTATCTCACGATGATTCAATTAAAAAA
ATTTTAATGCTATCATCAAATAATAATATGAATAAAGGCCAATCAATGGAAATGCAAGTT
TTGCTTAAGATTCTACAGACGTTGCTACTATTGTGATATTTTTTCTTTGGGGGCCACACC
TGGAAGTGCTCAGGGCTTATCTCTGGCTTCTGCACTCAGGGATCACTCCTGGCAGACTCA
GAAGATCATATGGGATTCCAAGGATCAAACCCAGGTTGACTGCATGTAAAGCAAACACCC
TGCCCTTTGTACTGTCTTTCTGGCCCTCTCCCTTTGCCAGGTTTTAAAACCACACCCCCC
CTTTTTTTTAACGATGATACTGTAAGTGAGCAAAGTCACAGGTAAATATAGTGGATAATA
ATCAGAAGAAAAGCAAAAATGTTTTGCAAAGATCTGCCTGTGAAGAAATTAAGTCAAAGA
ATTTGAGATAGAAAACAGAATGAGCTTGTGGCAAACCGGAGGGAGAGCTAAACAGGCTCT
GGGTTAGAGAACTGGGTTTAATCCCCGACACTGCATGGTCCCTGAGCACTGAGGAATGAC
CTGGAATGACCCCTGAGCAGTGAGCCAGGAGTAGCTCTGAGCACTGTTGAGTAGGACCTC
AAAATTTAAAAAAATAAACATTAAGAGTAATATGGAAAAGGATAACCCAGAGAGCATATA
CACAATCAGAGACCATAAGAATTTACATCCTTTTAATCCCTGTTCTTTGCCTCTCCATGT
GGTCTCAGCCCTGAGCTAAATAAGTATGCAAAAAGCAAGGAGGTAGAATATGTGAGATCG
TGAGATTTTACTGGAAGGAAAGGCCTGGTGAGGTATGTCTTGATGACTTCATGTTTCTGC
TCTGTCTCTCTCCTGGGCAGATTTGTCTGTCAACTCCAGAATGCTTAGCAATTCTATTGG
GATGTGGGACTTATATAGAGAATTAGCTTGTCCCCAATTGTGAGGAAAACGACTAGCTTA
TCATGGGTGGTTGAGTAATGGGCAGAGAGAACTTTGGAGCATTTCAAAGACAGAAATCCT
AACAGGTTAAAAATTAACTGTGTCTTGGGGCTGGAGCGATAGCACAGCAGGTAGGGTGTT
TGCCTTGCACGCAGCGGACCCAGGTTTGATGCCCAGCATCCCATGTGGTCCCCCGAGCAC
CGCCAGGAGTGATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGAGCATCTCCAGGTGTGA
CCCAAAAAGCCAAAATAAATAAATTTTTTTAAAAAATCAACTGTCTGACTTTCACTAATA
GAAAATTAGAGGTAAAATGGCTAAAGGGACCCTATGAACAGCTGCTAAGGAAATTCAAGC
CTGAGAATTAAAGACCTGTGACTTCCTATCTCCTGACAACTTCTAGACCCATAAGTCTGA
CCCTAAAACAAACGCATTGGTTCATCAAGAAAATTTCAATCGGGGACTCCCGTTAAAGAC
ACTCACAAATAGGATTCTGGAGGATAATTGATAAGGGATGATTTACCCAGAGTGTAAAAA
GATTAGAACTAGAGGCCACCAGTTTGGTAACTAAGAGACCACTCTTCTTTAAGGACCAGG
AAGCTTGCTTTTCCTGTGAAACAATAATTCTGTATTTATAGATTGATATTTCTTCAACTT
CTCATTTCCATGTGGGAGGTTTTGTTGTCAGTGTTCTATTTTTTCCTTTCCCTTGCTTGA
TTTATTATGTCTTAGGACCAGGGCAAGTGAGGTGGGGGGAATTAAGCATATATGAATGAG
CTATAGGATGCTCAACCATAAGAAGCTACTTCCAACTTGATTGAGAAACAAATAACCAAC
AGAAATCTTGGAGCTGGATTCAGTAAAAAACAAGTTTGAGCAAGGATGAGTCCCCTGTTA
GTCACATTTGAAAAACTCGCCCCCTGTTCGGCAGGACCGTTCTTGAAAGTACAGATGTGG
TAAAGGGGCAGCTATGGGGATTGAGCAACCAGGTTGGTTTGTGGGATGGTGTGATGTGAT
GCCCAGATGTAATTGAGTGAATCCAATGATACATGCTTTGCAAGTAAATCATAATGTGGA
TAATCTCCTCCCAATGTTCCTCTTAATCACTGCAAATAAACTTGATCGAAGACTTGAGGT
TGCTCTTTCATAGCCTCTCACTTGCCCCAGGCACCCCTGACTCACTCAGAGCCAAGCTGT
CTTATGAGCGCCTCCTCCTCCCCCAACACCCTCCATCTAATGGATATGGTAACTTGTCCA
CAGTTAGTGACTTGAGTTGGATATGATTGCTCAGAGAGAGATCCAGGGGGTTCTCCCGAG
ATCGGTGGGCCAAGGCTATGCTAATCTGACAGGGGTTCTTTTTTTTGGCCATCAGTAGAG
ATTCTAACTACAAATGAAGAGAGTATCAGAAGAAAGTATTGCAGGAGAGAGAACAATGCC
CAGTGACACTGTTTAAGTGCAAGCTGAAGTCAGTTTTCATATAGGGTTTCTTGGCCTTGG
CACCTGACCTACTGGGCTGGACAGGTCTTTGCTGAAGAGATTTTCCCTGACTGGGGGATG
CTTAGCGCATCTCTGATCTCTGCCCACAAGAGAAACTAAACCGCTGCTCTTATCCTCAAC
TTTTGGTTACATGCTCCTTAATTTCTCTTTTTAGCTAAATTATTTTGTGTCGGGTCACTG
GCAATCTAAAATTTATTTTAAAAACACTAATTCTTTTGTCAATGCAATTTTATTGATTAC
ACATAAGCATCTCTGCAATATTGTGATTATATGTATATATTTTTCATCCAAAATATATTT
CTTCTTGGGGCTGGAGCAATAGCATAGTGGGTAGGGCATTTACCTTGCATGTGGCTGACC
CAGGTTCGATCCCCAAGCACCACCAGGAGTGATTCCTCAGTGCAGAGCCAGGAATAACCC
CTGAGCATCACCGGTGTGACCCAAAAAGCAAAAATAAATATATATATTATGCCTTGTTTT
GTTTTTTATACACAACTCCAGGGCAGCCAAAACCTCTTTATTTCCAAAGTGCAGAGAGTG
ATAAAGACTTCTCTCTTATGTTAAGGAGCTCGTCTTTGGGGACTCAGTAATGGAAGGGAG
CTGCTTGTCAGGGAGCCACCCCTGTGATTAGACTAGAGGATGGGAACTCCGAGCCCTAGC
CCCCAAGCCTACAGGAAGCAAAGGCTGAAGGATGCATCTGCTGCTACTAGCCAGTGAGTT
CAGTTGTGCTTTTATAATGAAACCTCTACAAAGCTCCAGAAAGAGGCTTCAGAGAGCCTC
CAGATTAGTAATCACGCCTTTCCCAGATGCCCTGCCCTCTCTTTTCTGTTTGCTGGCTAC
TGAGTTATAGCATTTTGTACAGAGTTGGTGAATGAATGATCAGGTTTCCTGAGTTCTGTG
AAGCTGTGGGGAGGGTGTTTTTGCTCCATGTTTAGTGCTCAGGGGACCAAGTGGTACTGG
GAGGTAAAACATGAGGCTTCAGCATGTGAAGCGTGTACTCCAGCCTCTTGATCCCCCCTT
GCCGCCTGTCACACTTTACTTTTGAGTTCCCTTTTTCTGCCCTGGAGGCTGCAGCAGTTG
AAAGTCGCACCTTATTTTGTTTTCCTTCTTCCAGGGATAATTGGCCGAGCTGCCTGGTGT
CCAGTGTCTGAAAACCAATGTTTTTATATATTTTGGCCATTTCTAACATTTATATAAGAC
AGAAAAGTAAAACTAGTCCCTGTTATTTCATCATACCTGAAAACAGAAGTCACCGTAATA
TACTTTTAATTCTCCATCTAAATAATTTTGAGGAAACTGTTCTCTCTGAATTTTCAAGTA
CTAAGCATTTTAAAAAGTTAATTTGCTTGTTAAAATTAAAAAAAATAGTTTCTAGTTTCA
TTGTTATGTTCGCAAAGTTTGTAGTATTTCTTTTTAGATATATGTCAATTCTGTGTTTGT
TACAGGGTTATTTTTGTGATCTCTCTGTGTGCACTTTTTTGGGGAGGAGCCACTTCTAGT
TGGTGCTCAGGGCTTACTCCTGGTTCATTGCTCAGGGATCATTCCTGACAGTGCATGAGT
AACGTGCTGTGAGGAATGAAACCGATTGGCCATGCTCAAGGCAAGCACCCTACATGATGT
GCTGTGACCCTGGCCCACTGTGTGAACACTTTTTAGATGTGTGCATCTTAGTACACATTT
AAAAAGTGTTTAGTAGGAATCAAATATTAAAGTATATACAATCTAATAACTTCTTAGTAA
GCTCTGTATTTTGGATGATTTGTCACCAAAAGATTTCATGCATTTTGACTGGAAAATGTG
GGAGACAGAAAACATAGACGTCTTTGGAGCTAAGGAGCTGAAACAGAACCTCAAAGTTTG
TGACTAACTAGCTTTCTCCCCCGGGCACACATATTCCAAGCTGAGTTCAGAGCCTCCTAA
TTTTAAAGACTCCTACAAATGTCATGCAGACTTGTTACTGACCTTCTCGCTCAGCTTTTC
TCCCAGCTCCTTCTCCCCTAAACTTTCAGAGAGATTTCTGCTCTATAAATACATTACAAT
AGTGAAAAGGTTAATGCTTTTAATAACTAACCTCTGCTCTTTTAAATTTTTCACTAAGGA
AGTATGATGCATCTTGACCGATAATACGTATGAGGGTGGGATTAAGGGTACTTTCTAAGC
AATAAAATTACTTTTTGTTTGTACATAGATGATATACGCATCTCTGATCTTTTTGATGTC
AGTATATTTTCTGTGTTTTTATAATTTAACCCTTTTTTGGTTATAAGTTTCAAGATATGC
CATATTTTAAAATCCACTAAAATTTTACAGAATTATATTTAACATTAAGTGATTAATACT
GTCATTTTAAGACCTGTACTTTTAAAAATCTCAATACTAAATATTTGAGTATGTACTCAC
CACACTTTCTTATCATTGAGAATAGCATCTTTCCTCGGGAACAGACATATTAGCAGTTGA
ACATCATTATCACTATCGCCTTTGTTTGAAACCTTTATTTACATTTTTAATCAGGCTGAG
AAAACCCCATGCATGAATAAGCATAGAATGTAAAGAGGAGAGAACGAAGTAGGAGGAAAA
GTATTTTATCTTGGACTTTTTCTTTTGTTAAGCCAAGAATTAAATTAGTCCCAGCTTAAT
TGGTCTCCACACATTCCTGTGACGTTGGCAGGGTGGAGGAAGCGTTGGTGCGGTGACTGT
ATAGTATGTATCTAAGTATGTGCTGGAGAGGGAGAAAACTCATAAGCAAGCTGGTTTGAC
CAGAAACAGAACTGCCTGTGACAGATTAAAAGACAAGCAAGGCTTGGAATCCGAGCGCAG
GCAAAGAGAGTGGAAATTTACAGCTGCTCTGTGTGAGCGTTCAAGTGGTCATTTTCTGCT
AACGTTTTCCCGTGGTAACTGTTACTCTTCAAAGAGAGACAGAAAGTCAAGTCCGGATTG
TGGAAACTTTTTCTCATGCGGTGGTGATAGGAGGTCCCTTCTATTAAATGGGAGATACAG
GCTGCTTCATCTAAAGAGCGTTGAGCTAAGGAGAGAGCTGTCTTCAGCACCTCACCATGT
ATCAACTTTTTGTTGCTTAGACAAGTCTGGACTGTGTAACAGTTGGTGAGTAGCAATCAG
GTTACCGGTACTGATTCATAGAACTAGAATAAAAATGGTTGACTGTAGTTTTAGTTGGGA
TTTTACAGTTAATGCTTGTGTATCCATTTTAAACTGTGCTAATACCTTGTTTCTTTTTGC
ATGATGAAATGCTGTTACTAGGAGAGATTTTTTTTATATAAAAAAAACAACTACAAAACA
ATACTTCTCTGTGGCCTGAGGCACTTGAACCATTACCAACTATTTTCTGTCCACCAAATA
ATCTTATTTTGGAAATGGTTTTTTATTTACAAAGAATTTCTGAAAATATGATAGCAGTGT
ACTATTTTTCATGGTTTTCTTTCAACTGAAAATTCAAACATTATCTATTATCAGTACATT
AAAAATGATGTTTTGTATTATCAAGTACCGCATTCCCCCACAATGTAAATATTAAGGGTA
CCATTAAATTAAAGATTTACAATGCATGTTTTGTAAGATACAGTTATACATACTTTATAT
TTTTTTCAGTTATGGGAATTTTAAAAATTAGATAATTGAGCAAATTAAAATGAGTTCATG
TGGGTTTCAAGTTAATTAAGTAGTGATTTTGACAAAACTCTCACATAATTTTTTTATTGA
AGAATTTTATGGCCAGATGTCTATATTTATGTAAGTGACAGGACAGAACAGCTCCTTTAA
TTTGTATTCATATTCTAATAAGGCCTTCATTTGTATTATCTTAACATAGAGTGAATGCTA
ATTTTATATCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAAAAAAAAAATTTTGAGTAGTAGTTCT
CAATGAACAGGCAAAGTGATGGCGGGGTAGAGGGCATTTCCTAGCTAGGAATCTGGAGCT
CATGGGAAATTTTAATGTAAAGTATCATTTTTTCTCAAAAGAAATATTTGTTTACATATG
TGTCCTAGGATCCATAGGAAGAAATGAAGTCTGTTAGAAAATTCAGATTAAGCGCTACCC
AAATTTAGTTTATACTGGCTTCCAAGGGTGTGTGTGTGTGTGTGTGTGTGTGATACAATT
AAAACTGGTGTAGTATATATATAGGTATTTACATTTTTTTTCTTTTTGGGTCACACCCTA
CAATGTACAGGGGTCACTCCTGGCTCTACACTCAGAAATTACCCCTGGCGGTGCTCAGGG
GACCATATGGCATGCTGGGAATCGAACTCGGGTCGGCCACATGCAAGGGAAATGCCCTAC
CCGCTGTGCTATCACTCCAGCTCCTATATATAGATATTTAATAAGTATCTGTTTAATTAT
AGGAATAGGATGAAATAATTCGGACAAAGTTCTGTATGAGATATGAATGTCTGTGGTTAC
TGTATATATGTGGTTATAATGCAGCGAAAGATAATATTTAGCTGATATTCCCTTAACAAG
GAAAAACTATTTAAGCTATGTTAGCATGTACTTAAATTATATTTGTTTTGTTTTGATGCC
ACACTCACCTGTACACAGGATTTACTACTCCTGGCTCTGTGCTTAGGGGTCACTCCAGGT
AGCACTTTGAGGACCATATGTGGGGCAGGGATTGAAACTGGGTTAGCCACATGCAAGACG
AGCACCCCACCTGCTGTACTACCCTCCAGCCCTAAATTATGTTCATAGTGTTTGAGTGCT
ACTACTGAAACTTTCACTTTGCCACTTGTAAATGAAATAAGAGACTAGTTTTATGACTTT
ACATGTCTTACATTTCTAGCAGAAAGTCATTTAGTCCCTTCCAATTTTGGAAAGATGCAA
TATTATATGAACCTCCAAATCAGAATATATACAAACCCAGAAGTCTTGTAGGTGAAGATG
TAACCTCAGCTAAATCACTTTCATCTTTTCTCTTCTAAATCTATTTAATAGACTGACAGT
TTGTAGGTACATGGTATTGCTACCCAGTCATGATTTGGTTACTATATAATAAGTACTCAT
AGGGAAAACCAGTAAATTTTGAGTTTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGCCACCAAGTATCTTCTGTGGTGAAGT
ATCTGTTCACGCAGCTTTTTCCCTCTCTTGTTTGGTACTTGAATTTTGAGACTCTTGACA
GAGTCTGTAGGTATGTCAATGATTACAATTGATTTTAGTTTAATTCATTTTATTGGCTTC
TTGAGTTAACTTGGCAGTGCTCACAGATTGCTCTCAGCTCAATACTTGGGGGTTGTTCCT
GGCAGTGCTCAGAGCATGTGCTCCAGCTCATTGAACTGTCTTCTGCCCAGTAGTTGCAAT
TTCCACTTGGGCATTTTCTTTTCCAGCGCCTACCTTTCAGTCTCTCACTTCGATAACCAG
TGAAGGATGTTCTTTATCAGCAGTTACTTTTGACTCCTGTGACTGCTGTCCACCACTTCT
TTGCTTCCCCCCTTTTTCTATTTTTATATTTGATTCCAGTTGATGTTTCCATAATTATTG
CTTATTCAGCAAATAAACTTTGGGTGCCAAGTTCTGTGGTTTTAGTTAAATCTTCTGTGG
TCCATGTTGCTGAGTCTTTACTTTGGATATATAGTCATACATTCTTCCATATCTCTATTG
TACCCAAGGCTCTTGACCCCTCTTGCCATATTACTTCCCTTTTTTCCTCTTCTTACTCAC
CTTGATTTCTTTCCTTCTCTGTCCTTCTTCCTATACCATGGGATCAAGGGTGATCTGGGG
TGGGGCTGAGGTCTTCGGCAACCTTGTGGGGTTGATGAGGATGCAGATGCTACATCTAGC
ACCAGAGTGTAAGATCTGAATCCAAGGGTATCAGAAACAGATTTTGAAACATTAAGGTTT
GGATTTCAAAACAGTTAAGGTTTTACCCAATTAGATGTAGTGTGGATTTGAGATCTGCCT
TCGTAATGGACCTGGAGAGACCCATCATTCACTGTCTTGTACTTGTTCGAATTTTACTTT
CATTCTTTCCCTTCTGGACTTTGTTTTGGAAGCTGTCCTTGGTAGCAGAACTTGTTTGAG
TTATTTGCAGGGGGGCTCCCTTTGCCTTTGTACACATTTGCTAATGAACTAGAAGAATGT
TTTCCTCTGTGTAAAAGTTGGATAGAGTTCTGTGGAGATTCATTTCTGCTGTTCATTGGA
ATGTTACATGGAAATGTTCTTGTGGCATTTGACTGAGGGGTATGAGGAAACAGGCCCTCA
TGACATTTTGAAGATAATTACGATTCGGCAGTATTACTAAGTCTGGGAAGGTTGGAACAA
AACAGAAAGTTTCTGTCACTTTAAAGTCCTTTTGTGTTTATAAGCTGAACTTCTTTTTAA
TAAATATATTCTTTAACATTTGTACAGTGAAATTTATGTAGTATGAATGTTTCTTTTAAT
TAGGAGAGCAACAGATCCATAACGACCCTTTTAAAATGAAGTCTTATTTCTTAATTTCTA
ATCAAAATTTGAATTTGGTGGCCAGAGTGATAAGACGGTGGGTAAGATTCTTGCCTTGCC
CATGGTAAACCTGAGTTCAATCCCCAGCACCATATATGGTTACCTGAGAACTGCTATGGA
CCCCCAAGTCCCACTGAGCAAAAGCCAGTAGTGAGTCTGAGCCTTGCTGAGTGTGTCCCC
CCAAACTCCATACATATAAATCATGGATTTTATGTAGAGTTTTTCCTTATGTACCTGTAT
CTGTTTCCTATGTATTTGTTTCCTATATCCCCATCTCCCTTTTTTCCTTAAGCCTTTCTT
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCCTTCTTTCTT
TCTTTCTTTTTCTTTTTAATTTATTTTATTGAATCACCATGTGGAAAGTTACAAAGCTTT
TCAGGCTTATGTCTCAGTTATACAATGCTCGAACACCCATCCTTTCACCAGTGCACATAT
TCCACCACCAAAAACCCCAGTATACCTCCCCACTCCCACCTGCATAGCTGATAAATTTCA
ATTTCCCTTCACTTTATCGTTACGTGATACATCATATTCAACACAAAACTCACTATTGTT
GGAGTTTCCCCCCAAATGACAGCCCTGCTAACAAGGAAGTATTTGATAATTAGTTTTCCA
TTGCTGAGAATGAAGAGATATGAAGTCTCTTTGGTTTAGGAGTTCTGTATTTTAGTATTT
TTAGTAACTAAGTCCAGGGAGATTTATGTTAGAAACTGCATCATTTCCCCTTCCTGAGGC
AGCATGGGGCTATGACTTAGTTCACAGTCTAGAGACATTTCTGCAAACAGCTTCTGGTAC
CAAAAGTAGTCTAGCTGGCCTCTGGATCATGGTTGATCAGCAGTGGAGCGGCCACAGAAA
CGTGTGGCCACTAGGGTCACATCTTGGAGGACAGCATGCCGGTTTTGCCCCTGTCACAAG
ATCGCCCACTCGTCCCGCTGTTGCAAGTTCATACCTCTTTTTTTTTTTCTTCCCATGCCA
CCAAGTTCGTACCTCCTTAATGGTCCTTATAAAATGATGGACATTACGCCGTCTTTCCAG
AAAAGAGAAAAAAAGCCGAGAAAGAAAGATATTTTCCCTACTCGGCCGGCATGGGGTTAT
GGCTTAGTTCACAGCCTAGAGACATTTCTGCAAGCAGCTACTGGTGCCAAAAGTAGTCTA
GCTGGCCTCTGGATTCTGTCCAATCAGCAGCAGAGCGGCCACACAAACGTGTGGCCACCC
AGGTCGCATCTTGGCAGAGAGCCAATCTTGTTTATTTTCTCAAAGAACCAGCCATTGGTT
TCATTGATCTTTCGGATTATATTTTGGGTTTCCATTTCATTAATTCTGCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCTTCCTGC
TTTCATTGAATGTACTGTTACAGGAGTGACTCCCCCGTTAGAGCAACTCTTTCCAGTGAG
CAACAGAGGAAATACCCACATTGAATCTGGTAGGAGAGGCTGAGACAAACGCTTGGCAAA
ATCTCCATCTTAAGCTATGTCTTGGGAGTGAACCCCTAGTCACCACTCCCTCCACCACCC
AAACTCCCAGCTTCTCCTTAAGGAGGGAAGGGTTTGGACCACACATCTTACTTTCCCAAA
TTTTAGGACTACTAATTGAAGGCTGGCCCCCACATCACCCATTTTTGAAAACTATCAGTG
CTTGCGTTCTTGCAGAGTGTAGGAAACAAAGACGCTGTTGTTCCTGGGCATGTTAGCACT
TATTACAGCCTCCTCCACCCCTCCAGGGCCTCATGAACAGACCCAAAAAGGAGAAGAAGA
AAAAAAAAACAAAAACACCCAGCTCTAGCCTTTGCCTGGAAGGGTTTGACTAGGTACTTT
ATAAGCTGCTAACTTGAGGGTCCAGCTTCTAGCTGGCTGGACTCCTCCCAAGAGTGCCAA
AAGGCTGATGAGTACGTCTCCTGCCTCCTTCCTTCAGCCTGTTCCAACAAGAACATTAAA
TCTTCAGTATTTCCATGGAAAGGGCTTGTTCACACATCTCACAGTCCAAAGGTTTCCAAA
GTCAGAGAACTTTGATTACCCCTGGAGCATGCGTTCTTTGGACTCATAGCACTGTCATAG
ACAAAGAAATCAGTTTTTCCTCTAACCCCATCAAAAAATGGGGAGAAGAAATTAGCAGAA
ACTTCCACAAAAAAAGAAATTCAAATGACCAAAAGGCACATGAAAAAATGCTCTACATCA
CTAATCATCAGGGAGATGCAAATCAAAACAACAATGACGTATCATCTTACACCACAGAAA
CTGGCACACGTCAAAAAAGAACAACCAGTGCTGGCGCGGATGTGGGGAGAAAAGGACTCT
CATTCGTTATTAGTGGGAATGCCAGTTGGTCCAGCCTTTTTGGAAAACAATATGAACATT
CCTCCAAAAACTAGAAAATGAGCTTCATATGACCCAGCAATATCACTCTTGGAAATATAT
CCCAGGAATGCAGAAAAATACAGTAGAAATTACATCTGCACTTGTATATTTAATTGCAGC
ACAGTTTACAATAGTCAGAATCTGGAAAAAACCCAAGTGCCCGAGAACAGATGACTGAAT
AAACTCTGGTACATCTAGACAACGGAATACTATGCAGCTGTTAGAAGAGATGAAATCATG
AAATTCTCTTATAAGTGTATGGACATGGAAAGTATCATGCTAAGTGAAATTAGTCAGAAA
GAGAAGAACAGAGAATGACTGCACTCATGTGTGGAATATAAAATAGCATAATATGAGACT
AACACCTAAGGACAGTAGAAATATGGGCCAGGAGAATCACAACATGGTTTGGAAGCTGGT
CCCAGGTGCTGGGGGGAAGGCAGTTAGGAGGGAGAGGGAACCACTAAGTAAATGATGATT
GGAGGAATTGCCCAGGTTGGGAGATGTGTGCTGAAAATAGACCAAGGACCAAACACGATG
AGCTCTTAGTATCTGTATTGCAAATTATAATGCCCCAAATGAGAGAGTAAGAAGGACTGT
ACCTGCCACAGAAGCAGGGAGTGTGGTCGGGTGGGGGTGGCAGGTAGGACACTGGTAACA
ATGGTGGGGGAAATGGGCACTGGTGAAGGGATGGGTGCTTGAGCATTGTTCGAATGAAAC
GAAATCATGCAAATTTGTAATTGTATTTCACAGTGATCCAATAAAACTTATTTTTTAAAA
AAACAAACAACAGAGAAGTCAGTTTTCAAATAGGCACCAGAATATTACCATAGCCAGGTG
TGAGTTCACAAAATGTGTGAGCACTATGACGATGCCTGTGTTTGGCTGAGAGCTGCGTCC
CAGTGCTACCTCATGCCCCCCCCCCAGGCATCCCCAGAAGAGAGACAGAGAGATGAGGGA
CAACAGCCTAATGGTGAAAGTGACCTGTTTAATGCAGAACTGCTGGCATATTATAGAACA
TCTAAGGGAAGTTGAGGTAGGACATAGGTGTGATTTATCATTTACAGAGATAAAACTTTT
TTTTTTTAGTTTGAAACCATATTTTAAAATAAATCATAATACTAATGGAGATAAAACATT
TGGCTGGGACAGTTCTCTTGAGATTAATGAGTTAGAGGCAATTCTCTTGGGAAATTAACA
CAAAGAGGCACTCTGTCTCCTAGGGACATCCACATTGCTTTTGTCTTTCCTTCTAGTTGT
ATATGTTAAACATTAAGCTTTCTTCTTATCAATACTTGCAGTTGTTTGGATAAATACAGT
AATAGACAAAGATCCCAACACTTAGTTCTCTGGACTCTGAGACCAAGCAAGGCTTTTACT
GTAAATCCCAGACTAGGTCTTCTCAGGCCAGTTCAGCTTGTCCTTCCCCATGGGGGTCCT
GTCTCTTAAGTCATACAGCTTGCATCAAGACCATGCATTTATGCTTTCTAGATTGTCCCA
TTTAGATGCCGGGGTAGCTTTGCCACTTGCCCCAGGTCTGTCCCATCCCACAGTGGGACC
TCCCTTTTGGGGTGTTAGCAACTGAAGCCTGAGTCAAGTAATTATGACCAGTGCCCAAAA
GTAGATAGATTTGAGAGTCAATCAACTCCCAAATATTAGATACATAGCATTAATGGTTTT
TCTGTGTTTAACCAAAGAACATTGCTATAGGACGGCTATAGGGGAAATAAAACAGGCACG
AATACACAACACTTCAAATACAAAGTCCAATAGTACAAATACAAAGTCCAGAATTACCAG
AAAGTTTGGCTTATAAGTAATCAAGACTTACTCAGGGAACTGAGACAATGAGAGGTAAAA
CTCAAAGGAAAGGTTAAAAATAAACTTCACCTAAATTAGGGATGATAGCAAGAGCATAGT
AAGCTTCTCTGGGAGGAAAAAAGGGCCAATTCACTGATGACCCTAAAGCACTTAGGGTTA
ATATCGAACATCTCCCCCTTTTCTGTTTACAAAATGCAAAAAAATGAAATAGAGAAACAA
TTCCATCACAAAATAGTCTTATTTTTTGGTCTAAAACTTCAACCCTAGCCGGGACCCAGA
GCAATACTTGTTGTGAAGTGTCTAGTCCGTCTTGCACTGTCCAGAGGTGGTCAGAGTCGT
TTAGTCACATTTTGATGAAATATGCAGGATCAAGGTTTGAAGAGTTGTTCCTGCAAGAGT
AGCAGTAGTGTCACAGCAAGAGTCCCAGGAGAGTAGCAATCAAGAGTCTGATGAATCACA
GGGAGCACTGGAGCAGGAGCATCACTATGTCAGGAGTCCTTCAGCAGGGTAACGCAGCCA
TTTTCTGGTCAGAATCACTGGGAGTCATACATGTAACCTAGCTCATATGTGAGGAAAAAA
ACTTTTTATTTATTGAATCACCATGAGAACAGTTACGAAGCTTTCCAGTCCAAGTCTTGG
TCATACAATGATCAAACACCCATCCCCTCACCAGTGCACACCCTCCACCACCAAGAACCC
CAGTATACCCCCCATTCCACCCCTCCCCCGCCTATGTGGCAGATGATTTCCATCTTACTC
TTTTTCCACTTTGATCACATTCAATATTTCAACAAAAGATCCATCATTATTATTTGAAAT
TTTCCCCAACAATCAGACCTGCCGAAAAGGCATCATTAGATAATTTGTTTTCTATTGCTG
GTATGAAGAGCATTTTGGATTTCTAATATTTTAGTAATAAGTCCGGAGGGATTTCTGCCA
AAAGCCACTGGGTTCTGAGATTGGTTTATGTGCCTCTGGGATCATGGCCGTTCAGGAGCC
AGGAGCTGTTCATGGGTGGCAACTCAGGGCCTCAATGAGGCAGGGAGAGGGGCCAGTTCC
ATCCCCCATCCCGTGAGGCCCCACGTGTCACATCACTGCAGTCTCGTATCGGGCTGTCCA
ATAGACTCTGAAAAGGTGGCGGCCACTGTGCCACCAGGGAGAAAAGGCGGAAGGGACAAA
CACCTTTCCCCACCCCGGGTGGCACGGCACCGTAGTTTAGTGCTCAGTCTGGCATTTCTG
CCAGAAGCCGCTGGGTTCCGAGATTGTTCTGTGTGCCTCTGGGATCATGGCTGTTTAAAA
GCCAGGAGCAGTTCGTGGGCAGCAACTTGGGACCTCACGGGGGCCGGTTCCATCTCCCAT
CCCAGGAAACACTTTTTTTAAAAAAAAGTTTTCAGAGACTTTGAGCATCAGGGGCTTGTA
TGAATCCATGTGTGCAGGTGGAGAGAGAGACAGAAACTCCAATACAAACAGGCACCCTAG
AGAGAATTAGAAAGTGTTTCTATCAGAAGCTGTTCCTCTTTCGTTCTGGAGCTGAGGCAT
CTGTGAATTCCAATGAGGGGGTAAAAGAAAGCAACTGCTAACCCAAGCACGGGTCCTGGC
ATCGTCCATACAACCTGTAAGAGAGGGATATAAGGAATGCAGTTCATGTGACCTCATGAT
ATGTTGAAGTGAGCTAGAGGCCTTTGTCTGGCGTCCTTGTGTTTCAGCTCTTCCTCCAGT
TTCCTTGAGACTTCAGCTGAGATCTGTATGGCAAGGGCTCGCATGGAAGTTTGGAGGGCT
GTGGAGTCGCAGGCGGTCTCGGGGCCCAATCAGTCCTATGAATTTTACTCCAGATGAGGT
GTAGCAGGACCCAGAGTTTATTAGTAGGTCTTTCATCTGTTAAAATCTAAGTACAGACTT
TTCCTCCCAGAAAGAGGTTTCCCATTATCTTTTTGTCAGTTCCAGTGCAAATATAATAAT
TGTTTCCTGAGCCCTTTCTCATTTACAAAGTTGCAAGAGCCTGATACCTGGAAGAGTGAA
CAAACCAATTTAGCAAGTTTTATTTGCTGGACTGATGTAATTAGAATTCACAGTTGAGGT
TAGGGAGAGTCTGACAATCTAGTCTTTAACTGAGGCAGAGCTGACTAAGCTGGGAATGGG
CGGGGGAGGGGCAGGAGAGCTGGGCAGATGCAGCGAAAATCATTGAAAACCATTAAGAAA
GTCTCCTTGAGATAAATTTTTAAAATGTAAGGAAAATAATATCAAAAACCAGAGGTCAAG
TCTATTTTTTAATAACTGCAACAAAAGCCATAATTTTTCCTCAGGAGCAAACCAAGAAAA
TTGGAATTTCTAAAATTGGTCTGGAAAAAATTCAACTGCTTCTGAACCTCAGGGGTTAAT
TGCCTTGGGCTATTGAGGGCAGTGTCCTCTAGGGTGAGATTTGAGTCTGAGATGCTGAGA
GAGGGATGAATCCAATCAGTGTAAACCAATGGGGCGAGTTATAGCCTGCATTGGAAGCCT
TTTTCTGATATCAGAAGTAACCTGTTTCATAACTGCGCACACACACAGCAGGTATCCTAG
CGACAGTGCCTTCCGCCCCTCACCAGACTCGGCATCTGTAATGATGTAGTGATGTAATGT
AACTCACCCACGAATGAGGCGTCTCTGTGCCTCCTGGGTCAGTACACAATTGACGAGTGG
GAGAATCACCACGTACCTTGTTATTCTGGCCCTGAAGCCATTTTCCCAGAAGTGGCATCT
CATGAACTAGAAGTGGAAGTTCACTTCCCCTAAAGTAAAACTGTACCAGCCTGAGCCTTT
GAATAATCTTCCTTGGAACTGGCACATCACCACAGGTTCTGAGAAAAAGCCTGAGAGTCA
GTTGTCCAGGCTGAGTTCCTGGCAGATGATCTTGAGAATCAATTCTAGAAACTAGGGAAG
GCTTTCCCCACCTCTGACCTGTCTGGCGGCTCCCTGGATAGCTGAGCCCCTTTACACAAA
GTTCTGCTGAGTTTGCCAGCACAAATTCATCAATTGACACAACTTTTTGATTCCAAAGTT
CCTCACTTTTGTCCTGGCTCAAAACCCATTAGGTGCAGAACTCAGCTTACCCCTACACAA
AATCGCTCTTTGTTCCCTGAGTTTAGCCACTTGTCTGTGAGCCTCTAGATAGATGCTCTT
CATGAGTGTTGGGGTCAGGGCTCGGAAGTGCTTTTACCTTTGCTGTCAGGGAATCCTCCA
GACAACCATGAAAACCTGATGTGCTGCTTGTAAGACTCACCTGAGAAAACCCCCTTTCCA
CCTGGGGATTCAAGTCTTGTCCCCTTATACTAGAATTTAGTTTGTAATTTAGTCTGGGCA
GGTGTTATTGTAACTGTGTCAGGGCAGGGAACATCCAAGGCGGTGCTCCCTGTCGTGGCT
GGCTGCAGTGAAATTACTGATCAGAGCTCTGGAACTTCACATCGGGGGGAAGGGCCGAGG
CTGGGTTGCCCCCCTTGTTTAATGGGGCCTAAGGCTGGCCCCCTTGCTGGTTCCCGAGAT
TGAGTTATCTGTAGCAGCAAATCTGATGTGGCAGTCGCTAGCCCAGTGTTTTCCTCTTTT
ATATTGTGGACAGGGCCAGGGTGGGGCTTTCAAAGAAGCAGGCCTGGGGGGCGGGGGTGG
GGGGTCCCTGCAGTCCCTTTGAAAGTGGCCTGATTTCCTGCTTTAATTGCATTTATTTCT
ACATTTATTTCTACAATTCAAACATTTATCCTTGTCTCTGTATTGCACAGACCTCAACAG
CATTCACCTGTGCCTGATGTTTAGCAGAACCAACATAAGGGCACCTCTTCGTGTACCCCA
TTATGTCTTCTCTCTCCATAATGGGGCGCAGAACACAGAACAGCCTGACAATCCTTATTA
GCATTTTCAAAGGCCAATTGTTTGGATAGGTTTGGTTCAGTCACTTTACACTTAACCTGC
CTCTCAGTTGCATCTCTCAACCATCCTATAAAGTCTGCATATGGTTCTGAGACTCTGCGG
ACAATTTTTGTATAGCTTCCCTTAAATCCAGCATCTGCATCAATCTTTTTCCAGGCCCAC
AGGGAGGCCACTCAGACATGAGCAAAAAACAGCATGAAGCAAGGTGACTTGCTTGTTTGG
GTCGCGCCATTTCTCTTCGCCTATTAACATCTCATGAGTCAATTTGATCCCTGAAAATTT
CACCCAGAATGACCTAGTTCATGAAGTTTTGCCCTGGCCTCATCACTGAACCACATCCTC
CATTCCATGTACTGGGAAGGACTTAAGCATATTTTAGTGACCACATCAAAATCTTGTGGC
ACCCAACAGGCACCTTTACTCCAGCTATTAAGATATTCCTTGCGGTATGGAGATGTGGGT
GCATATGAGGCAGAGGACTTTTTTAAATGACTGAGGGAATCCATTCTTAACCCTTTATAA
GACGGGGCTGATCTACCTCCAGCCGAATGGGGGAAAATGGTAGAGCTCGTGTGTTCTGGG
TGGAATCAACCACTTACCACCTGATAAAGGTCTTAATTGTGAACTTCTACTGGGGACATG
TCTCGAGGTCCGGAGCCCGCTTGCCTGAGGAGCAGTGGCTTATATGGGGGTTTCTCTGCT
GGGTCGCTCTCAGACTCAGAGTCTGAGGAAGTGGCAGCTAGCTCGTCACCCACATCCCTT
CCATCTGATGTGCTGGAAGCGGAATCATATGGAGATGAGGGTCTCTGGTTTGCTGTCAGT
AGTAGGGAATATTAAGTCAGAAGAATTCCTGTCCCGAGAGTGCATTTTCACGGGGAAAGC
ACTTATCTTCTTGTGAACTTTGGGTAGGGAAGAAGTCAAAGGCATAACTCTCAGAGTTAA
GAAACAGAAAGCAGAGGAAACTTTGCTTCATCTTTAAAGGTCTGTTTGCTAAAATCCTAT
TCCTGAGAATAATCTTCTATCTTATCCTTAATATTTTCTTCCTTCTCAATTGTACTTTTC
CAAGACTGGAGAGTGAAATTAACAATCTCTCATGTAACCCAGAATTCCATGGGGATCCAA
GTCCCCTTCTTAGATAGACATTTTCCCTAACTTTTTTCCAAATCCTGACTTCTAGAGTCC
CTTGGTCCGGGAACGATGGGTTTATTTTGTAGATAGTTTTAAGGCAGGCCCAGAATTGGT
CCCAGGAAAGACAGTCTCCTGTTCTGCAGGAGAGATACTGAATCAAATCCATAAGTGTCT
CTGCACTTCCAGTCTGGCTTGAGATGCACTGGAAGAGCCTGGGGCGGCCCTGTTTCTGTC
CCGTTTTAGTGGGAGTGTAAGCCTGCTGTTCTAACTCCCCAGCACCCCAAAAACCTCAAA
ATCTAACTATCCTATTCTCCTCTGATATGGCTAGGATTCTTCATCCCCCAGTACCCCAAA
AACCGGTTCTCCCACTCACTAAAATACTTAGGGTTAATATCCAGCGGCCAGGCACTTAGG
CCAGTTCGGTGAGAGCAGCTAAAACATCCATTTCCCAGTTTCTCCCAGTTTGATGTTGAT
ATATTTTCCCAATGTCTGTCAGAAGGTCCAGCGCCAGTCAGTGTGCATCTAGGTACACCC
TGAAGCCATCCCCCATTTTTTTTCAGCCCCAGCAAGAAAGTTTTTATTGAAATTTACTTA
GAAAGATGGGGGGGGGCGGGGATCGAGGGAGAGGTACATTTGAGAGAGAACACAGTCTTC
TCCAGAGTGGAAACAGGCAAAGAAACAGACAAGCAAGCAAGGTAATATGTAAAGAATAGC
CACAAAGATACTTTGTCGGGGATAAGGAGAACAATGCATTAACCGTGTGGAGGTTCCCAC
AGAGAGAAGGTATTTTAAAGTAGCAGACAGAAATCACGAAGGGGGCTGGAGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCTTTTCCCCTCTCTCCCCCCTCCCTCTCCCTCTCTCTCTACTGCTTCAACCCTT
TGAGTGACCTCCATACCTCATATTCTGTGTCTTTTGCTTACTACCATGAAGAATTAGCCT
TCTAGTTTTGAAATATCCTACAGAGCGCATTTATGGAAAAGAGGTGTGTTCGTTTCATAG
ATTCTGTGCTTGAATGTTTGAAGGCACAACTGATTAAAGATACTTGGAAATAGTAGATTT
GTGTGTCTACATGTCACAAAGAACTGTGTTTTATGTTTGGGCGTGTGGATGTATGAACAG
GCTTCGAATGTGATTCACATGCTGTACCACTCACCTGCTATGATTGTTTCTCTGACAGGG
AAAAAAAGATGTGACACAGATATTTAACAACATCCTGAGAAGACAGATTGGCACTCGGAG
CCCGACGGTGGAGTACATTAGTGCTCACCCTCACATCCTCTTCATGCTCCTCAAAGGGTA
GGTGCATGGCTTCTTCCCAGGTGGTTGGAATATAGGGGCCTGGTGAAAAGTGTGTCTCAT
CTTTTGAAGATATGACAGGGTTTCATGCAGGGAGTTTTTGTCATGCTTGAGGCCAGTTTT
CCAAAGCCGATTCCCTGGTTACTCAAGCCACAGCAAAACGGTGTCTTTGATCCCTTCTAT
TTATGTGCCTCTACTTTCTCCTCTTCTCTGCTTCTTCTGTTTTGTTAGTGTTTATACTTC
CCAATCTGCCATTTTTTTTTTTTGGATAGCTGCTCAATTATCCTGTTGTTTGAGACAACC
CCATTACACATAACACACACAAACTCTAGCATGGAGCTAGAATAAATATTATTGTACAAA
TTGTCATATTGTTCTTATGTGGGCTTGAACGATAGCCCAATGGGTAGGGCTTTTGCCTTG
CACGCGGCCAACCCGGGTTCGATTCCTCCGCCCCTCTCAGAGAGCCTGGCAAGCTACCCA
TAGCGAGTTCAATATGCCAAAAACAGTAACAAGAAGTCTCACAGTAGAGACGTTACTGGT
GCCCGCTCGAACAAATCGATGAGCAACAGAATGACAGTGACAGACAGACAGTTCTTATAT
TATTGCACATGTGGAAAGGAGAGCCAAAATGCCAAATGTCTAGAATTCTATAGTTAATGA
ATTCTAATAAATATTTTGGGGCAATGTAGTCTACTCTTACCTCCTAAAGACTATAGAGAT
TCTACTGCAAAGTTAAGTGTTTCTCACGTGACAGGATGGCCCGAAAATTCTAGGTCAGCT
GGGCTTTCTTCTTTCTTCAACATGGATTCCCAAGCATATATATCTGTCAAGGGAGCAAAA
AACAAATTATAATTTTAAATAATAAATAAATAGTATTTAGTTATAATTAAATTATTTTTA
AATAATAAAATAAAATGAAGCACAGCACATAACACATGGTACTCAAACTATTTTCCCTAT
TCTTCTTAAGAGCCACTGTTCTTGTTGAAATATGTGTATGATTTTAAACAAATATAATTA
AGACATAGAGCCAGAGAGATAGTACAGATAGTACATTGCATTGGGCACATGCCTTGCACA
TTGCTGAACCAGATTTGATCCCTGGCATCTCATACAGTTTTCCAAGCTTCACCAGGAGTG
ATCCCAGAGCACTGAGCCAGGAGTATGCCCCGAGCAAAGCTATATATATGTAGCTAATAA
TAATACCATATAAAAGTATAATAATAGAATTATTATATGGAAAGCCCTAATTTCCAGTTT
AATCCAAAAAATATAATGGATCCCTTCAGGATATGATCGGATATAATCTGCCTCATTGAT
CGTGAGGATTAGTTCAAATGATTGATTTGTATGTACCTCTAGAGAGTCTAAAGGTTGAAA
ACATTTTACGTTATTTTGCAAGAAATGGTAGCCATAAAGAATTTTAGGAGAGGAAGAATA
GCCTGTTTCAGTAAGTGACGTTAAACTGAGGTGTAAGACAGACTATAAACAAGAGATCGC
TGAGCTGCTGAAATGCCCTGAGTATGCAGTAAAGGAGATGCCGGCTGATGGGAACCACTG
TGGCGGATGGCCTGGCCTCTTCCCTTCCACTCTGGATCCCAGCAGGAAGGGATGCCGTGT
CCCCTCACACGTGGAGCCTGTCCTGTAGCTGCTATCATTGAAATGCCGGGGCATGACCAA
CTGGTGCCTTTCATTTGTTTTTGTGTAAAGAAACACCACAGATATAGATGCTTCTGCTAA
AGATCCTTGGTATCTTCTCACCATGAAAATGATAAATATATGGAAATAAATACTCCAGAA
TTACAAATTATGGGTTGTAGGTGATTTTAATGAATTTTAGGACCAGGGAGATAGAGTGAG
TGTAGAGCATATGCCTAGTGTATCAGGCCCCGAGATCAGTCCTCTGCATAGTTTGAGTGC
TTCCTCCTCCTCCACTTCAGGCCTTAGGGGGGACGCTGGCACCCCCCCTACGGGATTGTA
ATGGGTTAAACTCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCAC
TACGGGTTGTATATTGGTTAAACTCAACCTTGTTTGACCAAGCTTCTGTTGGACGAAACT
CTGTCCAGAGAGCTTCTGCACGTGTCCCCAGACCTACCATGGTGGGTCCTAGAAAACTTA
AATAAAAAAAATTAATAGTTGGGGCATGCCTCTAGACTTTGCCTTACTGTTCATGGACAG
GCAGGGGACAGTGTATGCGAGAGTAATGTGGAGTTTATGCCAGCTTCAGTCAGATTAACC
CATGCTGAATAAATAGCAGTACTCCTACATTAAAAATAATGTAATTAATCATATTTTGTG
TATGGCAGAATACATATATACATATTCATGTTATGTTTTATAAAGATATATGAAATTTAT
GAAGTAGTCTTCGGTCATCAGAAAGGTTCAAGTAGGTCCTGAAGGGTGATGTTTTGGTCG
AACTCTCATAAGTACAATTTGTGTCTCCATTAAAAACGGTATTTTAAAAAAGAATAATAT
TGAACTTATTTTTAAAAAGAATTCTATTGAACTTGTTCTTTTGATATCATTAGTATTGGG
TTATGCTGAGGATGAAAGGATTCTCTGTTCCTCTCCCATTCCTGCTTTAGGTACGAAGCC
CCCCAGATTGCCTTGCGCTGTGGGATTATGCTGAGAGAATGTATTCGATACGAACCACTC
GCCAAAATCATCCTCTTTTCTAATCAGTTCAGAGATTTCTTTAAGTACGTGGAGTTGTTA
ACATTTGATATTGCTTCAGATGCCTTTGCTACTTTTAAGGTAATTTAAATTTTTTCTGTA
TCAGCTAAATGTTGTGCATTTAGTTTTAAAATCAGGAATGACTCCTTAGGGGCAAGTTGA
TTTTCTTTTTTAATTGAATCACTATGAGGTACAGTTACAGACTTACAAACTTTCATGATT
ACGTTTTGGTCTACAGTGATCCAGCACCCATCCCTCCACCAGTGCCCATTCTCCACCACC
AGTGTTCCCTCCCCCCACCCCCCTCGGAGGGGGTGGGTTGAGTTTCCCTCCCCACCCCAA
GCAGAACCCCAGCAGCCGAAGACATCCAGAACCCAGCCACAGCCATCCTCAAGGCCCCTC
TCCACATGTTCCGACTAGTCTCACGCATAAAGGAACCGGCAGAGGAACCCAGGTGTGTGG
GATTTGGGGTTGAGATCTTCAAGACTGCTCGGATCAGGACTGGGCCTCTTCCACCCAGAT
CCTCCAATCTCCAGTAGCTAGGTGCTCAGACTCAAAACTGCCTCCCCGTAGCGTGTAATC
TCATAAATGACCAACATACAGAGCCTATAAAACCACGCTCCTGGAAGCTTATAGACATCT
TAGTTCTACTTCTCTCTCTTGGAGAACATGGCAAGTTACTGAGAGTTTCCTGCCCACATG
GGAGAGATTTGGCCAGGATCTCCATGGGATATTCATATGCCCAAACCTAGTAACAATGAT
GGGTCCCATTTCTCTGACCCTGAAAGAGCTCCAAATGTAGCACTTGTTGGGAAGGATGGA
GTAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATA
TTTTAATAATTTGGTCTGGAAGAGATTTCTGCCAAAATCCTCCTGGGTTCCAAGATTCAT
TTGTGTGCCTCTGGGATCATGGCCGTTAAGGAGCTCAATAAGTAGCCAGAGGAGCCTTTT
GTGGGCAGCACCTAAGGGTCTCGTCACGGCGGGGGAGAAGGAATATTCAAGTTTTTTTAA
TTTGAATTTTTTCTTACAGGTTTTTTCCCTTGGCAAAAGGTGGGGGTGGGGGTTAGAATT
CTAGCTATTTTTTTATTTTCTCCTCATTCAGTTACATGAACTAATACTATAGCAATTATA
TTTCTGTATTCATATGTGTATATTATCTGGTATAATCCCTTCAGCTTTATGCATATACCT
ATTATTGATGTATGCATATCTCAATACATGCTCAGTGTAGGAGCATGCACACCTTAAAGA
GAGCAAACCACTTATTGCTGTTTTCACTTGTATGTGCTAAAGGAATTTGAATCCTATCCT
CTTTTCGTTGTTGTTGCTTTTTTTTTTTTTAAATCCATTTTCAAATAGTTTGTTTTTGAC
TTGGGGACCTTCATCGGTGGTGCTCTGGGGAAACTCCTGTCTCTACTCTCAGGATTCCCT
CCTGAAGGTACTCAGGGAACCATTTGTGGTACCCGGAATTGAACTCCAGCCAGCCATGTG
CAAGACAAGCACCTTTGCTGTCTCCCTGACACCCCAGGTCCCCTTACCGCTTGCAGGAGC
TGTGTCTCCAGGTGCTCCTGAGTGTCATATGCTGCTGAGTGGATAGGAACCTTTCAGGGA
AACCCTCATCTGCTGGCTGCACTGCTGTACCAACTTGAGGACTGCCCACTAACAGCCATC
CACGCCCCTTTATAGCCAGGGCCACACGCTCAGAAGTTGAGGAGAAGGATGGTCTGAAAA
CTGGGTATCCCAGATGGCCACTTAGAAAAACTTAGGGTCCCCACTGTAGATGTGGAGTTT
ATTCAGGGGTTTCCTGCTAGAGGATCAGGTTTGCAGTTTGACTTTAGAAGATGCCAGGTG
GGGCTGGAGCAATAGCACAGCGGGTAGGGTGTTTGCCTTGCACATGTCCGATTCGGGTTC
AATTCCCAGCATCCCATTTGGTCTCCCAAGCACTGCCAGGAGTAAATACTGAGTGCATGA
GCCAGGAGTAACCCCTGTGCATCGCTAGTGTGACCCAAAAAGAAAAAAAAAAAAGAAGAT
GCCAGGAATGTACCCCTATAGAGGGCTTTCCACTTTTTAATTCCAGTTCCAGAATTGTCC
ATCCCACTGGGAATGAGGAGGGGGCAGCAAGGCAGAAGTTCCCTTTAGGGGCTGGAGAGA
GGTGGTCCAAAAGATAAGGCAGCTGCCTGTGTGTGGCCATGCACCTGGCCCTCCACTATA
TGCCTGAAACTCAGTAATAAACTTGAGTCCCACCAGGAGTATCTCGTGAGCACAGAGCCA
GGAGAAATCCCTGAGCCTACCCGAGTACAACCCTACCCCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGGGTCATATGGAGCTCAATTTCTAGTTTTTGGAGGACTGTCC
ATATTGTTTTCCAAAAAGGCTGGACCACTCGTCATTCCCACCAACAGTGAAAGAGAGTCC
CTTTCTCCCCACAGCACTGGTTATTATTCTTCTTTTTGATGTGTGCCAGTCTCTGTGGTA
TAAGATGATATCTCATAGTTGTTTTGATTTGCATCTCCCTGAATATTAGTGATGTAGAAC
ATTTTTTTCATGTGCCTTTTGGCCATTTGTATTTCTTTTTTGAGGAAACCTTGATTCTTT
GGAGAAGATAAGAGCTTAAGAAACAAAAAACTTTGACATCTAGATTAGTAGATACAGTGG
CAGTGGGTGGTTAAGTTATCGAGCTGTTTTTATTTTGGTATAGTGAGTAAAAATATACCT
TTTGAAATGACAGTACATTTTTTTGTATCAATTAAATTGATTTTGTGGGTCATTTTATTT
TCTGGACCATCAGTTTTTATTTAAATTTTTTTAATTCTATTTTTAAACACTGTAGTTTAC
AATATTGATAATGACAGGACTTCGTGCAGAAAGCTTTCCAATACCACATGGTCCGCAAGT
GCCAGCTTCCCTCCACCAGGTGCTGCTGTCCCCGCACCCCGCTCTCCACCACAGCCCCCA
ACCCACTACAGTGAGACACTTCCTATTCAAAACCAGTTCTCAGTTTCTGCTGCCTTTGAG
TATCTGTTGTTTCTTCACTATGTTGCTTTGTATGCTAAATATGATGGATATCATCCTGAA
TTTGTCCCTCTCCTTCTGACTAACTTCACTCAAAATGATACTCCCCGGATTCATCCATGT
AGCAGCACATTGCGTGACTTCATCTTTTCTTACAGCCAACTAGTATTCCACTGTGCATCT
GTACCACAGTTTCTCATCCAGTCATCTGTTGTTGGACACTTGGACTGTTCCCAGATTTTA
GCTATTGAGAATCGTCCTGCAGTAAATATCAGAGAGCAGATATATTTTCTGAGGAGAGTT
TTTGGAACCTTGGGGTAAATGCCTAGAAGTGGAATTTCTAGATCATAAGGGAGATCAATT
CCTGTTTTTTTGAGAAGTGTCCATATTATTTTCCAAAAACTTTGAACCAGTCAACATTCC
ACTGTTTTCTTTTCTAATAAAAAATGGCTTCAAGGGGCTTTGTTTGGTCATACTAGACTT
AACCTTTTGTTGTTTAACATCCTGGATATTTTTGTTTTGAGTGCCAAGATAAGACTATTA
GCAGATATACTCATTAATGTCTTAACATTGTTAGTGTGTGGTTCTGTTATGGTATTGTCT
AAAAATTGTCCTTTCCAAAAAATAGATTTCTTATTTTGGCACTAAAAATAGTGCCACAGT
TTCTGATGTTCCCCTCTCCAACAATCCACTGGGTAGAACTGACTTGAATTTCATCCCTTG
CTGTCTCCTGAATAGCTCTATGCCTTGAGCAAGTTCATTTCGCCTTTGGGCTTTATTTTC
CTCATCTGTGGCATGAAGAAAATAATCCCTGCATAGTTTTGAAGCTTGGGGAAAAGGTAC
TGATGGAGCAGAGCAGGTTTACCACGCACAGTAGACCTGCAGGAAGGGACAGTGGCAGTC
CACCACCCCACTGCGTCTCCATGCCACTGAGCCTCTGTCATGCCACCCTCCGTGGCTCCC
ACGTGGCACAGAAGCGTTCGAACAGCAGGATCTGAATTTTTTAGCATGCTATTTAGGCTG
CATAGAACTTAAAACTTACAACAGAATGGTGAAAACGTAGGGTGGCAAAGGAAGATTATT
TTGCAAGTAATTTTTAAACTTGCTTAATATAAATTCTTTAATATTCAGGGTTTTTTCTTT
AATTTTTTATTTATTGAATCACCGTGAAAATGGTTACAAAGCTTTCGGGTTTAAGTCTCG
GTCATACAATGATCAAACACTCATCCCTTCACCAGGGCACATTTTCTGTCACCAAGAACC
CCAGTATACCCTCCATCACCGCCCCCCCTCCCCTGGCCTGTGTGGCAGATGATTTCCACT
TTACTCTCTCTCTACTTTGATCACATTCAATATTTCAACAAAAGCACCCACCACTATTAT
TTGGAATTTCCCCCCAACAGACCTGTCGAACAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGAAAAAAAAAAAAGAAGATGCCAGGAA
TGTACCCCTATAGAGGGCTTTCCACTTTTTAATTCCAGTTCCAGAATTGTCCATCCCACT
GGGAATGAGGAGGGGGCAGCAAGGCAGAAGTTCCCTTTAGGGGCTGGAGAGAGGTGGTCC
AAAAGATAAGGCAGCTGCCTGTGTGTGGCCATGCACCTGGCCCTCCACTATATGCCTGAA
ACTCAGTAATAAACTTGAGTCCCACCAGGAGTATCTCGTGAGCACAGAGCCAGGAGAAAT
CCCTGAGCCTACCCGAGTACACCCTACCCCTGTGCTTTAAATATTTTGCTTTATATTGAA
AGAGAGTGGTTTGACCATTGCTTCTACCTTTTCTCTACAACATTATGTTATATATATATA
AGCTTATAGGAGGTTTTAATTAAATATGTATTAAAGTTTAAGAATTTCTTTTGGAGAACT
TGAAGAAAAACGTTCTTGTTCTGGTTTTTTAATTAAATTCTGCATGGTACCTCGACAGGG
TATCGGCGCCTAAGCATCTCAGAAAGGATTAGGAAAGGCTTGTTTTCTTTCAGCATTAGG
GTGAATTAAGGGTATAATTGAGGTGTGAGTTGAAGACAGTTCAAACGCTTCTGTGTTTGT
GCAGTTTCTGTGTTCATGTCTGTAATAAGATAGAGCTGCTTGTGTCAGCTATGAACGGCC
TCATTGTGCTCCTGCTAGGCCCTCGCTGTCCATTAGCCCCTGAGCACGACCTGCTTGAGG
TGACCCTGTGAAATGTCACTCCTGCTCCTCCTTCGCTAAGCTGGAGACACTGGTGGAGAG
AGTTAACATTGGTGGTACAATTGGTGCTGGAACATTATATGCCTGAAACTCAACTCTAAA
TAATTTTGTAAACCACAGTGCCTTAGTAAACAACTTTTAAAAATAAAATAATACAAAGAA
AACAGTTAAGAAACAACTTTTTGTGCGAGAGACGGGTTGAGGCTATGTAAAATTATTTTA
AGTTTATCATCAACTTTGTTTTTTTTATTTTATCGTAATCACAATGTAGAGTTATGTTTT
TCAAAATACACTGTAAGCTCATCGCTCAGGAATCATTTGTTTCACTACCGTCAGTCCAGC
CATAGTAAGAAAAAAATTAAAACGCAATGGGGTATTTTGTTTTTGTTTTTGAGCCACAGC
TGGCAATGCTGAGAGGTTATTTCTGGCTTTGTGCTCGAGAATCACTCCTGGTGGGGCACA
GGGTGTCAGGAGGGTTCCTGGGGAAGAAACTTGTATTTGCCAGGTGCAGGGCAAGTACCT
TAACCTTTGTTCTATCACTCCCACTGCAGAATGCTGTGTTTTTAACATGAAGCAAACTTG
TCTTTCCATCTTATCTAAGAGTGGAAATTATATTGTGTTAGAGATAAAAAAAAATATTAA
GCTGCAACTTTTGTACGTTTCAAATTAATTGCCTTTTAAACCTTTGGAGAAAAAGGCAGA
TTTGTAAACATTTATTACCTTGAATTGCTTTAACTTGATTTTCTTTTTCAGGATTTATTA
ACCAGACATAAAGTGTTGGTAGCAGACTTCTTGGAACAAAATTATGACACTGTAAGTAAA
AGTCATTTAAAACTTGATTTCATTTTCTCTTTATCTGCCATCCCTCTCCCCTTAGACCTA
TGAGCACTTCTATTTGTGATCCAGAATGCAAATCAACCATCCGCAGTCATACACCAACTT
TTTTTTAATTTTCTGGAAGCTAGGTCACCTGGAAACATTATGGGAAAGTGCAGATGGCAG
GCAGCCAGGCTTTCTCCTTTTCCACATCTCCACTGTTCTCTAACGCCCCAGTTAACAGCA
CTCTCAAGAGTGCTGTGCTCAGACTCAGACTCTCTGATGACTTGGAGAGCACTTTACCCT
TCCCGAAATACTCTCACTTAGCTGGTAGTTGTTTACTGACTAGTAAAATACCAAACTTTC
CCCACTCCCCGCTTTAATAGTGAGCCCAACTCAGCCTTTTGAAGTCTGACTAAAATATTT
CCCTCTTGGAAGTTTTCCGCAATCTCATGTCCCCCTTCCCAGCACTCTCTCTCCTCGCCC
TATCCTCCTTTCCCCACGTCTATCATCCCCTCTCTCCTCTCTGACATATCAGTGTTCAGG
TCAACAACCAGCTCATGCTGGCCTTGCACACAGTAAGTCCTCACCCACTGCTCTCTGAAG
TTGAAACAAAGCTTGATGTGCAGATCACACGACCCTGACAACATACACCAGCTATCTCCT
CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGCTTGGATTTCCCTCTGAACAAGAG
CAGAGCAAACCTACTGAGAGACCTCACTGCTGGCTGTGCCATTAATGTGTGTTTTCTTTT
CATTAGATTTTTGAAGACTATGAGAAATTGCTTCAGTCTGAAAATTATGTGACTAAGAGA
CAATCTTTAAAGGTAATATACGTGGGGAGGGATACTGGGGACATTGGTGGTGGAAAATGT
ACACAGGTGGAGGGATGGGTGTTCAATTATTGTATGTCAGAAACTCAAAACATGGAATTT
TTAATTGTAGTCCACGGTGATTCAACAAAAAAAGATTAATTAGAACTTAAAAAAATTAAT
TTTGAAACAGGTAATATCAAATTTCTTTTATAAGTATCAGTCAGTGGATAAGAAAACCGG
GAGAAATGAAATCATGAAATTTGCTTGCACATGAATGGACATGGAGAATATCATACCAAA
TGAAATAAGTCAGAAGGAGAGGGACAGACATAGAATACTTGCACTCATTTGTGAGATATC
ACTATCACTATCACTATCATCCCATTGATCATCAATTTGCTCAAGCGGGTGCCAGTAACG
TCCCCATTTGTCCCCGCCCTGAGATTTTAGCAGCCTCTCTTTACTCGTTCTTCCCATCGG
TGTCACATTGGAGGCTGTTTCAGGGTAAGGGAAATGAGACCCATCATTTTTACTGTATTT
GGCATATCAAATACGCCACGGAGAGCTGGGTAGGCTCTGCCGTGTGGGCAGGATGCTCTC
GATACTTTGCCAGGTTCTCTGAGAGGGAGAACTAGGCTATAAGAGGTCTTCTGGGAGCTT
TGTCTCCAAGAGGGAGAACTAGGCTATCGTGAGGAAGCTTCCAGGAGCTTGATTTTATAG
TCTCTGGATGTTGGCTGTTGATTGGATTACACAGTGCCAGGGGCAGTTTCTGGGTGTGGC
TGCCTAGCTGCTGGAAAATTGGGGATCTGGGTGGAAGAGCCCCAGTCCCGATCTGAGCAG
GCTTGGAAATCTCAGCCCCAGTCCCGCTGGTTCCTCTGAGTTCCTCTACTGGTTCCTCAT
GCACGAGGCTTGTCCGAACATGTGAAGAGTGACCTTGAGCATGACTGTGGCTGGGTTCCT
GGCTGGGTTCCGGAGGTCTTTGGCTGACGGGGCTCTGCTCTGGGAGGAAACGGAAACTCC
CCGTACGGGCCATTTGTGAGATATAAAAAACATATTATGAGCGCAGAGCCAGGAGTGAGC
CCTGAGTACCCTGGGTGTGGCTCAAACCCCTCTCCTTAAATAAGTTGTCTGACAGTCAGT
TTTCTGATTGCAAAGTACCTGCTACTTGCTGCATTTTGTTAGGAATGCTTAGATTTTTAG
TAACAATAAAAAATGGTATATAGATAAATTCCTTCCCATCTTGCAATTAGGCTTAACAAT
TTACTTTCTTTAGAAGCCAGACATTAAATTACTATCAAGAATTATTGCATTTCAAGAGAA
ACAGTAGAATTTGGTGGGGACTTGGGGGTGTGCTTATCAGTTTCATTAACATTCCAAGGT
TTTAAAAAAAAATTAGGCCCTCAAAAGGCACATGAAAAAGTGCTCTACATCACTAATCAT
CAGAGAGATGCAGATCAAAACAACCACAAGATACCACCTCACACCACAGAGACTAGCGCA
CATCCAAAAGAACAAAAGCAACCGCTGTTGGAGAGGATGTGGCGTGAAAGGGACCCTTCT
ACACTGCTGGTGGGAATGCCGACTGGTTCAGCCCTTCTGGAAAACAATATGGACGATTCT
CAAAAAATTAGAAATTGAGCTCCCATTTGACCCAGCAATACCACTGCTGGGAATATATCC
CAGAGAGGCAAAAAAGTACAATCGAAACAACATCTGCACATGTATGTTCATCGCAGCACT
GTTTACAATAGCCAGAATCTGGAAAAAACCCGAATGCCCTAGAATGGATGACTGGTTGAG
GAAACTTTGGTACATCCATACAATGGAATACTATGCAGCTGTTAGAAAAAAGGAGGTCAC
AAATTTTTTATTTAAGTGGATCGGCATGAAAAGTTTCATGCTAAGTGAAATGAGTCAGAA
AGAGAGAGACAGACATAGAAAGATTGCACTCATCTATGACATATAGAATAACAGAGTGGG
AGACTAACATCCAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
GTCACCTTAAAAAATTTAGTCTCAGGCCATGTGGGTGACAGGAGTAGCGGGTTGAATTTT
CATGCGGCCGACCCATCAGTGATTCCTCCACCCCTCTCGGGCAACCCACCATAGCTAATT
AGAGGGAGAGAACAGAAGGGGAATGCCCTGCCACAGTGACAGGGTGGGGTGGGGGGAGAT
GGGATTGGGGAGGATGGGAGGGATGCTGGGTTTACTGGTGGTGGAGTATGGGCACTGGTG
AAGGGATGGGTTCCCGAACTTTGTATGGGGGAAGCATAAGCACAGATGTGTATAAATCCG
TAACTGTACCCTCATGGTGATTCATTAATTAAAAATAAATAAATTTATTTAAAAAAAAAA
TTAGGCCCTGAGAATGGTGCAGTGGGTAGGGCGTTTGCCTTGCATGTAGCCCCCTGGGTT
CAATTCCCAACACCCCATATAGTCCCCAAGCCTACCAGGAGTGATCCCTGAGGGCAGAGC
CAGGAGTAAACCCTGATCACTGCCAAGTTTGGCCCAAAACCAAAGCAAAACAAAACAAAT
AGAGGGAATTTCTCCAAAAGTATTGGAGAAATGTCTGAAGCATTCTCTCCGTTAGAAAAC
AGGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATAAAGCATGGACATTGCCTGCCTTTCTAGTGCAAAAGGGAGTCATAAGACAAG
AATGCAATGGCCTGAAATCGAGAGCAGAGAGTTTCCAGGTGCACAGAGACATTAGGGAAG
ATGAGTCCGTCTTGGCGGCTGGTCGCTGCGGCTTGAGAGGGGACACAGTGGCGGGGCACG
GGGTAGTGCTCCTGCTCTCAGTGGTGCTCCCCGAGGATGCTCCACTTCTCGGACTTAGAT
CTTTGTGTTTTGCTTTTAAATACCCTTCTTTCTTCAGGCTACTATATTTTTTGAAATGTC
ACAGATGTGGGTGACATCTATATTTATATCTCCTATCTTCACTCTGGGAAGTCCAGGATG
AAGGTGCCAGCAGCAACAAAGCTCCCCGGGGGGCCGATGGGGACAGTGGTCACAGTCATG
CGCAGACAGCCTCCACGTGGGCAGACATCAGCACTCAGCCTGGGTCCTGCAGCAGTGCTG
CTTTGGGGGAAATATTCATTTTGCAGCTGAAAAACTTCTGCTTTAGTGCTTTATAAGACT
TTTTTTTTCTAAATGTAGGTCAGGTTTTATAAGAAATATAATAAATAAAGAAGCTATTTT
TTTTTCCTAGTAAGCAACTTAAGCACATTTATTCAATAAGGGATGTGTAGCTGTGATTAG
TTTTGTGGTCTTTGTTGTTTTCTGGTGCTGGGGGTCAATAACTGTTGCAGGAAGGCTGGG
GGGGGCACACTTGTGCTGGAGATCACCCCTGGCTGTGATGGAGGTAATGCTCAAGACCAC
ACACTTTGTAAGACATGTCTTACGCAACTGAGCCCCGTGCCCTAATCTCCTCTTATCCTA
CTTCAATGCACAAGAAAGCCATTTCCCCCTAAGAAAGGGAATCAAGAAAATGAAAGGAGC
AAAAATAAATTCATTTTCTGGCTAGCTCTTTATGAGAGCTATAGAGACACTTTTTGAAAC
TTCAATAGGGACTGGCCTTAAAAATGAAAAATGAAAACAAAAACATGAAAAAATGCTCTA
CATTGTTAATCATCAGGGAGATGCAAATCAAAACAACAATGAGATATCATCTCACACCAC
AGGGACTGGCACACATCAAAAAGAAGAAGAAGAACCAGTGCTGGTGTGGATGTGGGGAGA
AAGGGACTCTCATTCATTGTTGGTGGGAATGCCAACTGGTCCAGTCTTTCTGGAAAACAA
TATGGACTTTCCTTAAAAAACTAGAAATTGAGCTTCCATATGACCCTGCAATACCACTTC
TGGGAATATATCCTGAGGCTGAAAAAAAAGCACAGTACAAATAACATCTGCACCTGTATG
TTCATTGCAGCACTGTTCACAATAGCCAGAATCTGGAAACAACAGACAACTGGCTAAAGA
AACTTTGGTACATCTACACAGTGGAATACTATGCAGCTGTTAGGAAAGATGAAGTCATGA
AATTTGCTTATAAATGGATGGTCATGGAGAGTATCATGCTAAGTGCAGTGAGTCAGAAAG
AGAGGGACAGACATAGAATGACTGCACTCATTTGTGGAATATAAGATAGCATAATATAAA
AGCTAACACTCATAATATGAGACAGTAGAGACAGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGCTCTTAACTTATAGTTAAGAAATAAGCACTTTGGCCAGGCCCA
TCTCGATGCCAGGGTAGCATATAACTCACCGCTTGCCTTGGGTCCGTCCTGTCCCTTGTC
AGGACCCTGCTTTTGGGGTGATAGGAACTGAGGGCAACTGAGGCTTAAGTCAAGAAAGCA
GATGCCTGGGAGGGAATAATATTCAAGGCCAGTTAAATCCCAAGTTGCAAAAGCATAATA
TTGTCTTCTTGTGTCTATACAAAAAGGACATTGCTTTAAAGTAAATTATTCAAAAGACAT
AAGGAGAGGAGAAAGGCAGTATCAACTCATAATATAAGTTCAATGTCCTAGAAAGGTCTG
ACTTTACAAATTAACAGAGTCAGATTTGGGGGAAAGCTGATTAACTGTTTGGGGGAAGAG
AGCATAGAGAAGTAGTTAAAGATAAACAAAGAAATGGGAGTGACTCAGGAGCACCTTAAT
GGGTGTGACCGGGATGAACCTACTCCTTGTGGCGGGGGTGGGGGGGGGGGGAAGGACAAA
GCAATGTCATCCTACAACCCCTGTTCACATTTCTGAGAGAGGTGAGATGCATTTTGTCCA
GGATGACTCCCAGGCACAGTGTAACGCGGCCGTCTGTTTCTGTGCAGCTGCTAGGGGAAC
TGATCCTGGACCGCCACAACTTTGCCATCATGACCAAGTATATCAGCAAACCGGAGAACC
TCAAGCTGATGATGAACCTCCTTCGAGACAGAGTCCCAACATTCAATTTGGAAGCCTTCC
ACGTCTTCAAAGTAAAAGCCCAAGTGGCGGAGACAGTGTCATTGGGTTTCCTGCTGTCCG
GTTTCAAGAGCAAATTACCCTGAGTTTTACTCTCCTCCAAACTTGAGAAAAATTAAAGAC
ACATAGGCATTTTGTTTTGCATGACTTAGATGAAATTTTAGAGTCCATTTAATGAATGCC
CTTTTGTTGTAGGTTTGCAAACTACTCCCTATCTCTAAATATTTTCACTGAGAAAACAGA
CGGATGCCATTTCCCAAGTGGCTAAAACAGTCCGAGACGGAGCCTGGACCTGACTCCAAG
TGTTGGGATTTGCAGACCTTGTTTTCTGCCCATCTCTCTCTCTAAACATTGAAGGAAGTC
CTGAAGGAATGTTTCGGTACTCACGCCCGCTCCTCTCTTAGAGGGGAGAATGAGAGAAGG
GCAAGGGTGTCACATGACCTGCCAGCCACTCCTGCTAAGTCTCGGCCAACCAAGTCAATG
GGACTTCGATGGTGCTGGGAACGTCGGCCGCCCCTCAGTCCCCAGGGGACTCCATACACC
TGGTGGCACTTGGGGAGCCTCTCAGGCTACACCCAGAGATGCTTGATGCTTCAGGTTGGG
GGAGTCATGTCAGGGATTGAACCAGAGATCCACCCAGGTGCAAGGCAAGAACCTAACCTC
TGTCCTAGTCTCAGGCCCAGGCGATGCCGACCTTCCAAGCTCTTATTTAAGTTTGGAAAC
ACTATGTATGGATCCCATGTGAGCCACTATAGTATAAAAATCTGCCAGGAGATAATGATA
CCAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTATCATGTTG
AGTTTTGGTTTCTGTTATAATTGCTACCTGCTGTCCTTGGCAGTGTAGCTGAGTTTTCAA
TCTGGGACTATGGTGTCAGTATGGACCTTTATGAGACTAGACTGCTGAATGGGAAGCAAT
GGGAGCTGGGCCCTGGGCAGTTGGAGCAAAATCTGTACTTTAGATCCCCGAAGGAAAGGT
GCCAGGGAAGGTGATAAGAACTTTTTACCACTGTCATTCTGTACTTTGAGTCAGGTGAAT
ATGTTAAATATTAAATACATTAGCTCTTAGATTGTCGTTAATATATCATAATATAGTAAT
ATATCACTCATAACTAAATGTTTATTTTTAAAGTGTTTTATAATCTCTCATTCTAAGTAT
ATATATAAAGTACATTCATGGGACCTGAAAGATAGGACAGAAGGCAGGTTTACCTTGCAT
GTGGCTGACATAGGTTTGATCCCTGGCACCACATGTCACCCCGCCAAGCCTTACCAGTAG
TTGATCCCTGAGTGCAGATCCAGGAGTAAGCTCTGAGCACAGCGGAATGTGGCTCCCAAA
TCAAGTGAATGTATTAAAACATTTAAGTCTGTTTCTATATTATAGTTTGTGTGTGGAAAA
TGGATACTGAGGAATTGCTGATTTTTCTCAGTAAGGACGATAGCCTTGGGCTTTGTGGTT
ATTAGTAACAAAAGTGACACAAGTGAGACACTGACCACATGTTGTCCCCGGCTGGCCAGT
GCGCCTCATCCCATGTACTTGTTTCTTTATGTTTCAGGTGTTCGTGGCCAGTCCTCACAA
GACACAGCCCATTGTGGAGATCCTGCTGAAGAACCAGCCCAAGCTCATTGAGTTTCTGAG
CAGCTTCCAGAAGGAGAGGACAGACGATGAGCAGTTCACCGACGAGAAGAACTACTTGAT
CAAGCAGATTCGAGACTTGAAGAAAACAGCCCCGTGAAGACCTCGCCTCGTTTCTTGCAA
CACTCACTGTCTCATTTGTTGTTTGTACAAAAAAGTGTCATTTCAAAAAAGTGATCATTT
GGGGGAAGGCTTAGGAGGTGCCTATATTTGCTCAATTCATTGTTCGTGGTAGATGAAATA
TAAAAACGTTTGAATGAAAACAAATTAACCTAGAATAATATATTCATTTTAATCAAGTCT
GTGATGATTTATGTGAAATCAGAACAATTGTGTTAGACGTTGATGAAAGAAGTTGTAACC
CTGTGCTGGCAGGAGGCGGCAGGGCTGTGGGCTCATATAGCTGCGTTCTCAGGCCAGGTG
GAAGTGTCACTGGGGCCCCTGAGAGGAAGCAGACCTCAGAGAACTGCCTGGGGGATTGGT
ACAAAATTGCTTTGCACGTTTGCACTTTAGAGAAATTTATTTAAGGCTCTTGCTTCCCAG
TCATAGTCTTGTGTCCTGCCCATCTCTTTGTGCTGTAGCTGATTTCCTAGGAAATCAATG
GCCCACCTTCCATTGCTCAGCCTTTCCTTTTTGATCTCTTTCCCCAGGTTTAGGTACAAG
TGGATCTTTTTCAGCCTTACCTAAGTGTGCACCACCACCACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1033..1110, 2052..2216, 58807..58925, 62399..62567, 72900..72959, 74595..74660, 80636..80737, 80740..80757, 80759..80779, 82426..82605
1001..1030, 1033..1110, 2052..2216, 58807..58925, 62399..62567, 72900..72959, 74595..74660, 80636..80737, 80740..80757, 80759..80779, 82426..82602
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved