Sorex_araneus Locus ENSSARG00000013004
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000013004
Sorex_araneus
ENSSARG00000013004
GeneScaffold_356
SNORD70, SNORD70
7921..8005, 8843..8929
31571
TAATTAGTATAATCAGCCATCAGTCACTAAATTTCCTTATCTCTGAACTTTCCCCCACT
TCCATCTTTTCTGTTCTTCAGTCCAGGATTTTGGTGCCGCTGGATCGCGGGTTGCAGACC
TGCTGGAGGAAATTGTTACTTATTGTTCATAAACTCCAGCAGGCTGCAACTTCAGATACA
GATAATCGGTAGATAGAGCCCTGGACCAGAGGGAGAAAGGTTTCATCCCCCATTCAGAAG
CCAGATTTGTGAAAGAACTGAAGCATCACAGTGACCAAGACAAAGAACATAAAATCTAAG
TGCATACTCTCTAACTGCAGCACATATAGACATTTGAAGGACATCTTCTTAAGCCAATCC
GTTTGGCCAGGAGCAGAGCTGCCAGGAACGGTCACCTGCACGGCCACTGGCCTACTGTCC
TTAGGAAAACATCTCAACAAGGTGAAGCATGGCTGCCCAGGGAGGTGTCTAGCCCGAGGT
TAGCAGCTTCCAAAGACCTGATGGAGAGGCAGACAACGAGACAGCGACACTCTTCTAGCA
TGTTAAATATATGATAAACGGGAGGGTTTTTGGTAGTTTATTTATTCATTTATTTGTTTG
TAAATGACAGTCCGTGATGGAAAGCCACGCCCACTCGAGTTTCTCGGCACAGCTTCATCG
CATAAAGGCTTGCCTCTGCTCTCGCGAGAGCCTAGGTGCTCTCCCTACTCGCCCCGCCTC
CCCCGGTGGCGGGAACATCTCGGAAGTGACGCCCAACTCTGAGGCGCCGTAGCTGTCGGA
AGTGACGTCATGTCCCAGAATCCTTGGAGAAGAAGCCCGTTCACGCGTTCTGCATAGTCT
AGCGTGGAACGCTTAGCAACGTGGTTCGGTTCTTTGCGGGAGGCGGGCGCCGTGTTCTTG
GCCCGCCCGGGTCGTGCGGGCCTCTGGGGGCCGCAGCCTTGTTTTCCCCCCACCGGTCTA
AGTTCGTGCCGGGCGGCGCAGCGCCCTGACCCAGCCTGACCATGCTGGTGCTGTTTGAAA
CGTCCGTCGGCTACGCCATCTTTAAGGTAGTGGGGGCGATGGAGCCCGCGGAGGGGGAGG
TGGGGAGGGCGGGTTGTAGGGCAGGCGAGAAGAGGGAGAAGACCCACCACCCGGAGGAGT
GTTGGGGGTCCTCCCCGCGGTGCCCTGAAGGCGGGGGGGGGTGGCCTGGAACCTGGGAGA
GGCATTTTTCCGGAGAGCACGTGGCCCTGCCGAATGGGGCGTGGGTTTGAGTTAAGAGCG
TTTGCTGCGTTCGAAAGCTCAGAGGGACTGTTCGATTGTTACAGGTCGTGTAGAGGACTT
GGGGCTCTATTGTGAGGGCTTTAAGGAATTACCGGAAGGTTTTTTAATAGAATGGATAGA
TAATGCGTTCTTCAGTGAAGTTACTTTGCTTCCGGGGCGCGGGTAGGAAGCAGAACCCCC
CCCCCGCATTCATTGCTTTATTTGGGGGCCCCAACATGGCGTTGAAGTAGAGAGAAAGAT
CCAGAGGATTTTTTGGGGGGGGCGCAACACTGGGCAGTGGGTAAGGCTTGCCCCCGACTA
CTGCTCAGGGATCACGCCTTGGGGGGAGACGGGGGAACACCTGGGGGTGGCTGGCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAAGGTAGAACTGAC
AGGATTGGCTAATGGGTTGAAAGTGGATTTTGGCTTTTAAGAAATTAGTGCGATGATCAT
AGTGAAGAGAAGAGAAACGGGATGTGGAATGTTTGCAGGGAGACGAAAGAGTTGGTCCGG
TGTGATGCGTTCCGTGTTGCTTACCTGTGGGCCGGACCGTTACTGATTGCCTTTTTGACT
TTGAAGCCCTGGGGAAAGTTGCTGGCTGGTGGTGATTCACTTAAGAATTAACTGTCTTGT
CTGTGCAGGGAAAGTTGGCGATGAAAAAGTTAAAGAGCAGGGAACCGCTTGATAGCGGGA
CTTCAGTGATGGGGGTGAAAGGAGAAGTGCTAGAAAAAACGTGTAGTATTCTAGTTGTGA
ACCCAGAAATCTGGCACAGAAAATCCGGATCAATACTTGATGTATCGAATTTAGTGAAAT
GTTGATTTGAGGACCTTCCTCCCTCCCTCCCTCCCTCCCTCACTCCCTCCCATATGGCGA
TGCACAGGGGTTATTGAGGACCTTCCTCCCTCCCTCCCTCCCTCCCTCACTCCCTCCCAT
ATGGCGATGCACAGGGGTTACTGCTGGCTTTGCATTCAGGAATTACCCCTGGCGGTGCTC
AGGGAACCATATGACATGCTGGGAATCGAACCTGGGTCTCCTGCATGCAGGGCAAACGCC
CTACCTGCTGTGCTATCGCTCCAGTCCCCTGGGAGCTTTTCTTTTTTTTTCTCCCAATTT
TCTCTGACATTTGGAAATAAGAGTGTTTTCACTTGTTGCATTCAATATTTGGGCCTTAAG
AAAAAAAAAACTGTTGCAACAGTTATTTGGAAACAACCTGGTGACTTTATTTTTTCTCTC
ATGGGAATTGTCTGAATGGCAATGTTAGTAATTTTAAGAGACTTTTTTTTTCTTTCCTTC
TTTATTGGTCACACCTGGCGATGCACAGGGGTCACTCCTGGCTCTGCACTCAGAAATTAC
TCCTGGGGGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAAACCGGGTCTGCCGAGT
GCAAGGCAAACGCCCTACCCGCTGTGCTATAGCTCCAGCCCCGAGACTTTTTTTTCATTG
TGTAATTATTTTGGAATAAAATAAATATTCTGAAGTTAAGGGCAGTTGCACACAATTTTT
TTTTCTTTTTGGGTCACACCTGGCAATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGA
ATTATCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCCGGGTCGGT
CGAGTGCAAGGCAAATGCCTTACCCGCTGTGCTATCGCTCCAGCCCCTAAGTTGCACACA
ATTTTGTGAATAAATATCACAAGATAATGTAATCTTATAGATACCCAAGTACAAATATTT
TGAATTACTAACTCGAATAGAAATGTTAATCTGTCAGTTAATTGATTATTTTAGAATAAA
AATATTCTGGAGCTAATAGTAGTTGCTCACTTTTTGTAAATATATGTTGCACATTAGTGT
GTTTTAAATCTAATAAAGATAAAAATTCTGCCATTTGCGTGTGGTTCCCTGAGCACCACC
AGGAAGTGATTCCTGAGTGTAGAGTCTAGAGTAAGCTCCAAGTGCTAGGCTTGGCCTCCA
AAAGCAAAAAGAAAGGGGAAAAATATAAAAATGAATAATGGTCATGGAGAGATAGCGTTT
GCCTTTCATATGGTAGACTGGGTTCAACCTTTGGCACTCCTTCATCCCGCCAAGGAATTA
GCCTGAGAGCAGAGCCAGGAATAAGTATTGAACACAGCTGGGTTTGAGGTTCCATCCCTG
CAGTGTATAAAGATGTAGATTTATATAGCTATACCACTGAAGCTTATATAATGTTACAAA
CCAGTTTTGTATAAGTTAAAAATACATCACTGTCATCCCGTTGCTCATCGATTTGCTCGA
GCAGGCACCAGTAATGTCTCCATTGTGAGACTTGTTACTGTTTTTGGCATATCGAACAAG
CCACGGGTAGCTTGCCGGGCTCTCTGAGAGGGGCAGAGGAAAAAATACATACACAACTTC
TTATTTATTTATTTTGGTGTTCTGGGTCACATCCGGCGATGTTCAGGGGTTACATCTGGC
TCTGAATTCAGGAATTACTCCTGGCTCTGCACAGAGGGACCATATTCCCATATGCCGAGG
ATCGAACCATGGTCGACCGCAGGCAAGACAAATACCCAACCACTGTACTATCACTCTGGC
CCCCGCCTCGTACACAACTTACTAATCTTTTCCCATAGTCTTTCCAGTGTTGGAATTCGG
ACTTATGAGCAATTTTATGTTGTACAAAATTTGTGCGTGTTTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCCCTCATTCTCTCCCTCCCTTCCATGATTTTGCAGTG
GAAGGGGGATTGTTGCAGTTTCTGGAGTGGCTCTTAGTAAACCCTGTCTGTGACTGTTAG
TGTGAAGTGATGTGGATGCTGCGCCAACCTAGCAGTGCTTGCAGCCCATCAGTGTTGGGA
TTGAATTTGGGGCCTAGCACTGCCTTGTATGCACTCTGATTTTCCAGCCTTGTTTTTTAT
GTTTAACTTTTCCCACATAGGCTCCTAGTAGCCAGGCCAGAGGTTCAGGGACTATGTGCT
TGGAGATAGAATAGGGTCAGCTACTTTGTCCTAATCCCTATACTATCTCTCTAGCCCCTT
AGGCAACAAAGCCCTAAATAACCAATGCAAAGTGAGATAGGAAGATAAATGGAGTGATGT
AGTATGCCCTTGTTCAAAAATTCATTCCTTTCTGGTATAGAGGTGGGTGATCTAGGTATA
CCTGTTATACTGTTAAATGTGCTTGGGTTTTTCACAGTGGAAAAATTTCAAAGACAAATA
GATTTTAATGAGTCGTCATTTTTGTACAGCATTTACAAAGGTCCGTTTTGTGTCTAGTCT
CCCATTTCCCCACACCCACTATAATATAATTTCAATGTTTTTTTGGGGGAGTTGGGGGCA
AATCTGGTTTTACTCCTTGCTCTGCACCCAGGGATTGAACCACAATGCAAGGCAAGCCTT
ATTGTACTATTATGTACCATCTCCAACCCCCTGGTACTTTAAATTTTAAATTTAATCGAC
ATGACTAAAATATAATTAAAATTACAAAGGTTATTAAGACTGAAGCATTATAACATCAGG
AAAGGTTAATGATATTGTTAGCTATGTGCTGTACTTGGTTGTGGACTCAATTAAAAATAT
TCATCAAAGATCTCAAGTAGATCTGAGTTTCACATTCAGTTACTAAATGGGCTGTAAAAC
AACCACAGATGGATGCAGGATAAGAAAACTGATATGTTAAGGATTGGGGGGGCTGTATAC
TAGTGGTAGAGTACATATCTAAAGTATATGAGTCCCCAGGTTTGATTCCAAGTGCCTAAA
GAAGGAAAAGAATGCTAGTTTAGGGGCCGGAGCAAGTACAGCAAGTAGGATGCTTGCTGA
ACCCTGCCAGGAGTGGCCTTTGAAGAGCCAGGAGTAAGTTCTCAGCACTGCTGGATGTAA
CCCCCCTTCATGATGGTTTATGATTTTAGAGAGAAAAATAGCTTCCGTTGTTTTACATGT
ATGGTTTTTTTGTTTTGTTTTTTTGGGGGGCCGCACCCAGCAATAAGTTATGGTTACTCC
TGGCTCTGCACTGAGGAATCACTCCTGGCAGTGCTCGGGACACCCGGGATTGAACCTGCG
TCAGCTGCATGCAGGGCAAGCACCCTACCTGCTGTACTGTCACTCCAGCCTCAATTTTAC
GTGGATAGTTGTGTCGGAAATACATAGTCATTTTAAATATTTATTACAGGTTCTCAATGA
AAAGAAACTTCAAGAGGTTGATAGTTTATGGAAAGAATTTGAAACTCCGGAGAAAGCAAA
TAAAATGTAAGTAATTTTGAAACTAATTTAGCAGTTAACATTTAAGATTTTTTGACCATT
GTTAGTTTTGTTTTTAATATGCCCCCCCTTCCCTAGGTGGGTCATTTTAAGTTTTTAATC
TACTTCAGAAATAATAAATGTGTGAGCCTAATTATTAGATGATGTATTTGAAGCATAGTT
CATCTCAGCTAATTTATCAGCTGAAGACTAGGTTGGACAGCACCCTAAAACAACTATTTT
ATAAAGTAATTGGAGATACATAGTGGTTGTGAATTAAGTATAATTTTATTAAAAGTAGTA
AATGTCAGGGCTGGCCAGATAGCTGCATGGGCTAGTTTACATGCTGTGTGTGCATCAAGG
ATTCCTGGGTTTGAGCCCTAGCACTGCATCATTCCCAGAACACCACCAGGAGGAATCCTT
ATGTGGTGTTGGAGTAGCCATTGAGCACTATCAGCAGTGGCCCCAAAACATGGACTGCAG
TCTCTTTGTTTTCATTTTTTACTATTCTTGACTGTGTTCAGGGTTTACTCCAGGTTTTGT
GCTCAAGGATCACTTCTGGCAGTGTTTGTGGGGCCTTACATGCATCAAACCAGGGTCAAT
TGAGGGTCAGAAAAGTCTCTTACTCCAATTGCTTTGAGGGGGGGAGTGCACACCTGGCTC
TGCTCAGGGATTACTGCTGGCAGAACTTTGGAAAACATTGGTGATGGCTGTCGGGGATTG
AGCCATGTGCACTTGCCCTACCCATTAAACTCTCTGGTCTTACTGATTTATTTTTAACTT
TATTTCTTTAAGTGATGGTCAAATGTTTATAGATTCTTTGTGACATCTACTTATGAGCTC
CTTAGTGATTGAAGCTATTAGCTAATAAATTCTCAAAAGTGTGCTTGCATTCTCCAAGTT
CTCTGGCCCAGAAAGAGTAACTTTGATTGCCAAATTAAGAATAATGAATAAATAGTCAGA
GATGTTGACTGTTTCTCAACTACCTGGTTATTTCACCACCTGTGAATTCCTTGGTGAAAC
CGAATGCATTTGGTGATTGGGATCCAGAAAGGAGCTAAAGATTTGTTGATATATTTGAAT
TACATCTATAGATGCCAAGAAGCCCTTTAAAATTTGTTAGAGCTAAAAGCAGAACACAGA
TAGATACAAGGAAACTACTTATGTTGGCCCTGGGAAACTTACCATTTCCAAATGATTTTC
TCTTTAAATAATTAGAGAAACAGTATCATTGCTGGAGCCAGGAAGATAGCTCAAGTATTA
GTTGTTTGAGTTCTTGTGTTCAATTCCTATTGCCTCCTTCCCTTTCTCTCCTCATCATTA
TCAAATGTCTCTATAAGAAATAAGGTGTTGGGGCTGGAGTGATAGCACAGCGGATGGGGC
GTTTGCCTTGCATGCGGCCGATCCAGGTTAGATTCCCAGCATCCCATATGGTTCTCCTGG
AGGATTATACCTCCAGGAGTAATTCCTGAGTGCATGAGCCAGGAGTAACCTCTGTGCATC
ACTGGGTATGACCCAAAAATGAAAAAAATAGGAAGGAAGGAAGGAAGGAAGGAAGTGTTG
CAGCATTTGCGGTTGCAAAAATCCAAATTTTGAGGCAAATGTTCATCAATGGTAAAATTG
TTGAATAAACTGTAATACGTCTATAAATCTCTTGGAGAAGAGTTGGTACAAAACTGCTTC
AGAGTAATTTATATGATGCAATCCTGTTTTTGCGTTGTCCTTGATGCATATAATTGTGGG
GTTTTTGTTTTGTTTTGTTTTGTTTTCTTTTTGGGTCACACCTGGGCTATACACAGGGGT
TACTCCTGGCTCTGCACTCAGGAATTACCCCTGGCAGTGCTCAAGGAACCATATGGGGTG
GTGGGATCGAACCCACGTTGGCCGCGTGCAAGGCAAATGCCCTACACGCTGTGCTGTCGC
TCCAGCCTCGATGCATGTAGTTTTATGCAAAGTGTAGAAAGAGAGAAACAGATGCCACTT
TAGAAGGTTGGAAAAGAGGTTGAAGTAAAGTGGAATAAATAGAAATTATTCTTAAATCAT
TGCATTTTGTGTTTGTGGGAATGGACAGGTTGTGCTCTGGTGAGTTGAGAAAATCTTGAT
TACGGTAACACTTAGAATACCACGGAAAAGTAGTTTGACTCAGTTTGCTGAGCAAATGTG
ATCCATTGTTGTCAATGATGTATTGTTGGAACTGAATTAAAGTGATCGACTGCATAATTC
GTCACTACCACTGAGACAACAATGAATTGAGCATTTGTTTTAATGCAGAACTGGAACTGG
GTAGTAGTACAGGGGTTACCATGCTTTGTGTATAATCAACCCTGATTTGATCTCTGGCAC
CATTATGGAACCTTGAACACCACTGGGTGAGGCCTGAAAGCTTAAATTATTATGTTGTCC
TGCATTATCTTGCACATATGCAGAGGAAGGGATAAATAAGTATAACAGGAATAAGAACTG
AGAACAAGTTTTTTTGTTAATTTTGGCCATCCCTGGCTCAGTACCTGAATTGAACCCAGG
TCTTCTGCATGCAAAGCATACCCTTAACCCATTGAGCTATTTTTCTGATCCTAGCAAGCT
ATTTTTAAACAGCATTTGTGCTGGATATACAAGTGAATGTGTGAGATTCCTGACCTAAGA
GGAACTCTTAAGTCTTTTTTCAGGTCACTTCTTATGCCATATAGTAAAAGTCATCTGTGT
CCTGCTTTAAACAGAATTTATGTGTTCTAAAGTTTCTTTTGGTCTGCAACTTTCTGTTAG
TAATCCAACATTGTTAGCTTAACATTTAGAGAAACACATAAAGAATACCTAACTTTGTAC
CCTGAAACAAAAATTAAAGCAAAATTTTTGGTGTGTGCTTTGGAAACAAATTCAGTCTCT
TTACTCATTATAAGATACTTGCTAACTTTTTTCCCCCGTTTTTTCAATTGTAGAGTAAAG
CTGAAACATTTTGAAAAATTTCAGGATACAGCAGAAGCACTAGCAGGTAAAGTCAAGGAT
TTAATTTTTTAATCTGTTTTTAGTCTTGGTTATTTATTTTCTTTATTGAAAATTGTTTCC
TTCAGTTGCCTGAGTTAACCTTACTCAATGTTGTCAATGATGTATTCTTTTTGGAACTGA
ATTTAAGTGATCTAACTCAAATTCGTCACTACCACTGAGACAGCATTGAGTTAGCTTTTT
TCACCGTAGGCCTGTTTTTTTTCCCCTGAGAGGTGAGAAGTGTTTAAATTGATCTGTGGA
AGCCAACAGCACAATGCTGAAGCACAATTCAGTAAAAGCTATTCTACAAGGGCCTAAGGT
AATGCAGTCTAGAACAGTGTTTCTCAGCCTTTTTCCCACTATGGCCCCCTTCTGACCTTA
TTTCCGTTCTTTGATGCAACTGTACTTCCTAATCTACTGATTGACCCTAGTCCTGTATTA
CTACGACCTTCCCTTCCCCCATTAAAGCAGTTTTTACTTGTGACCCTCTTGGAGTAGTCT
GGTTCCCATCAAGAGCAATGTGTCCTTGGGCTGAGAAATGCTGGGTTAGTACACAGCTTT
TTTAGCATTTTGATAAAAGTAGCGGTAAGACTAGCCAGGATTCACAGTTGAAGTTATAAT
AAAATTAAGCTATTCAACAGTTTTGTTTTATTTTGAAAAGGCACCATGTTATTAAAGATA
TTGGGGGGGGGAAGTTTCTATTTGTGTGACAGGATTTTTTCTTTATTCTTAAAACTGTAG
TTTATCAAAATGGGCCTGGTTTGTAATGATTTCATATGGATGGTTTATGTTCTTTGACTA
CTCAGTTAACTGATATAGTTTATTAACTTGTTTCAGTAGGCACTTCACTTAGTTATAATG
ATTTTTTTAATGTTAAAATAAGATTCAATATAAAATTCTATCATAGATTTTTCAGTTGTT
TAGATTTTGTGTCACAAAGCTGCCAGCTACTTTGTGATATGATTTCAAAGTGAAGATCTG
TAGGGTGTCACTGAAATTGGCTAGGACTTGATAGACCCAAATAATGTTGGTTATCAGCCA
CAGATGAAAGGTGCAATTTCTCTTGTGGAAATTGAAGGACAAGCTAAGTAATGGCGGGTT
GATACTGGATGCTCTCTCACTGTTGCTAGAGAGATGAGCTGAAGGAAGATCCAAAAATGA
CCTGGATTACTAGTGTTCAAAAATAGTCTAGGGTTGTTTTTATCAACACAATAGTAATTA
AAGACTTTTAGAGTCATAAAGAAAAACTAGTAATGTTTTGGTGGCAGAGGGGTGGTTGAT
GGAGCCACACCCAGTGATGCTCAGGGCTTCCTCTTGGCTCTATGCTTAGCCAATCATATG
TAGTGATCAGACACATGCAATAAGTACCTATGTTCAATATTTAGCTTTTCTAGTAATGTT
TGCCTGGGTAGTTTTTCACAGTTTTAAAATTAAAATCAGGTGGGCAGAGAGATGACTCAA
AGGGCTGGAGCTTGGAGCTTTGCTTGCAAGTGTTCCAGTTTTAATTCCTGGTGCTTTCAC
ATCCCCTTGACCATTGACAGGAAGTGACCCTCAAGTACAGTGGGCTGTGAGAACCCCCTT
GAAAAAATAAAAAGAAAAATATTTTAATATAGGTAGGATTTTATTTTGGCAAGCGTTGTT
GTTTTAACTTTACTTCCCACTCTGAGGGGTATTTTTCACATAGATTGTGATTTGAACAAT
TTCTCCTGGAATTATATGTGAAAAGATGCAACCCTGATTCTAGGGGTCTTTTTAGAAATT
CCTTTTGTGGATCTGGAATGGTAGTACAGCAAGTTGGGCCATTGCCTTTCACACTACCAG
CCTCAGTTCAATCCCGGGCATCATCTGTGGTTTTCTGAGCCCTGCCAGGAGTAAGTCCTG
AGCACAACTGAGTGTTGCCTCCCAAACCAAAGAAAAGTAAAGAGAACTTAGATGCGTTAG
AAGTAGGTCCAAAAGAGTAGGTCTAAGCAAGGTTAGGAGTTACTGAGCAGACTTAGAGCT
TGCCAGAAGTGAAAGCAATCCCAAAATTTTGTAGGCTGAACTTTAAATACAAACTTTATG
ATCTAGATCTGAATCAAATGAAGGTTCGTGTGACATAGGGAAAGGACAGCTGCATTTGGC
TTAACATCTGGTTCTGTAGCAGAAGTAAGGTGGAAGGGTCAAATGAGATTATAAAATACG
TAATTTGTAAAACATTTTTGTCATTTGACAAGCAAGTAATATTTAGTTCTCTTTGGAGGA
AGTACTTATTTCGCAAATTTTTGAAGCTGAAGAGTTTACTGTTTGAGTTAAATTTTTTAG
AGTTGACCCTTGTTTTTGTTTTTCCTGAAAAGCATTCACAGCTCTGATGGAGGGCAAAAT
CAATAAGCAGCTGAAGAAAGTTCTGAAGAAAATAGTAAAAGAAGCCCAGGAACCCTTGGC
GGTCGCTGATGCTAAACTAGGAGGGGTTATAAAGGTAAAGTTAGGGTTTTCTTTATTGCC
TCCTATAGGAGTTCGCCAGAAGGCATAGTGACTACAAAGTCATGCCACAAATTGTTTGTC
ACAAGTTCTCATACTTGGTCTATTCTTGGCTATATAATTGGCTTCCCAAACTAAGCATAT
ATTAAGATAACGACAGATACACCACCAAATTATTATTATTATTGTTATTATTATTTTTGG
GTCACACCTGGCGATGCACAGGGGTTACTCCTGGCTCTGTACTCAGGAATTACCCCTGGT
GGTGCTCAGGGGACCATACGGGATGCTGGGAATAGAACCCAGGTCGTCTGCATGCAAGGC
AAATGCCCTCCCCGCTGTGCTATTGCTCCAGTCCACACACCACCAAATTATTTTAAGTAC
CATTTTAACTCTGACCCACACCGCCCAGGATTAGGGCATTTATATATATTTTTGTATATG
AAGGGTATATAATAGCTCGATATTAAAATTTAAAGTGAATGTGCAGGGTCAGACTGGAAG
AGTAAGCTCCCCAACATGAGAAAAAGAATAATTTGACAGTTCTGGAAGTTCAGTCTTTTT
TTTTTTTTTCCTTTTTGTGAGCCTGGGTCTGCACTCAGGAATCACCCCTGGCAGTGCTCA
GAGCTCAGAGGACCTTATGGGATGCTGGGAATCGAACCTGGGTCGGCTGTGTGCCAAGCA
AACGCCCTACCCACTGTGCTATTGCTCCAGCCCCTGGGAGTTTAATCTTTAGTTATAATA
GATACTACATGTAATCACTGTATTCATGAACATTCTCCTAAAACTTGAAATTATAGTATT
GTATTATAGGCCTTCCTTTGTGCTCTGCACTTAGGAATCCATCCTGGCACAGGGCTCAGG
GGACTGTATGTGGTGCCAGGGATTGAACCCAGGTTTGCTGCATGCAAGGCAAAGCCCCTG
AATGCTGTAATATTGCTTCAGCTTACCATTTATGGTGTTTTTTTTTTTTAAAAAAATAAG
TTTTGGGTCACAACTGGCTGCGCAGGGGTTATTTCTACCTTCACACTCAGGGATTCCTCC
TGGCTGTATTCGGCCGGGAGGGGGGGGCGGCGGAAATAAGGGATGTTTTAAGGCTTTTGA
GTCAGATTGAAACTGTAGAGTACTTAGATCAATTATACTATTATTTTCAACAAACACTGA
AAATTGCTTTTTATGAAACTATGTGTTTAAATCAGTCATTGTAATATTTTAGTTCAAGGC
AGTTTGTATTTCTAATCCACTTGTATGTGTTATAGGAAAAGCTGAATCTCAGTTGTATCC
ACAGTCCTGTTGTTAATGAGCTTATGAGAGGAATTCGTTCTCAGATGGATGGTTTAATTC
CTGGGGTAGAGCCACGAGAAATGGCAGCTATGTGTCTTGGATTGGCACACAGGTAAATAT
ACTGAAAGATGCATCACCTTATATGTTTAATAAGCAACTGTATAGCATTATTTTAAGCAT
ACTATAATAGGTCAAAGTCCTCATTTAATCCTCAGACAGGTATTAGGAAGCGAATTGTAT
ACTAACTTTACAGATGAGGAATCTGGTGTCCAAAGTTAATATAGCTAGTAAATGAACAAG
CTGGGATTTGAGGACCCAGGCAGTTTTGACTTCATTACCCAGACTCTAAACTTCATATCA
TCGTAGGTGTTCTCTTTTTGTTGAGGCAAAGGGGATATTTGTGGCAGTGCTCAGGGGACA
TGTGCCAGCTATAGAGAACAGTGTTTGCTCATGTAGAGCATGCCCTCCAGCCTTGCAAGT
ATCTCCCAGTCACTCTTAATAGTCATTTTCTACTCTGTAGCGTTAGCTCCTACAATTCTT
GAGGTCTTTGCTCTTTTCTTTGCTAAGTAAATCATTTGCTGCTCTACCATGCATGCCCTC
AGGTTTTCTTCTGGCCATGCTGCGTGGTACTCAGGCTTACTTTTGGCTTTGTGTTTAGAG
ATAGCTCCATATGTTGTGCCAAGGATCAAATCCAAGTTGGCCGTGCAAGCACCTTACCTC
GTATGCTATCACTTTTTTCCCCTCAGATTTTCTTACCTGCACTGGTTTCTTTGCTTTGTG
TGGGTATGCCTTTGCTGCCTGCTTTATTCTAGTTATAATGCTAATATGCATTTTTAAAAA
GAAAAACAATAGCTAATACTAAATTAAGACTTAAATGTCTGAATAGTGTGTATAGCACTG
CTTTTTTCTTTTTGTTTGTTTGGGAGCCATACCTGGAGGTGATCGGGACTTACTTCTGGC
TCTGTGCTCAGGGTTATTCTTGGCAGGCTCTGAGAACCATATAGGGTACCAGGGATCTAA
CCCAGGTCAGCTGTGTGCAAGGCAAGCACCTTACATGCTGTATTATAGTTACAGCCCTTA
GCACTGTTTATTTTTTATTTTAAAATTTTTAAATTGTTATGTGTTTGTTAGGGGGCCATA
CTAGTCAGTGCTCTGGTGACCTTGCAGTGTTAGATTTCAGGATGCCAGTAGATTGTGCCA
GCCCTAGGAGTGATTTTTTTTTTTCCTTTTGGTGTTTGGGCCACACATAGCAATGTTGCG
TTACTCCTGGCTCTGTACTTATGAATCACTCCTGGTGATGCTCAGGGGACCAGGGATCAA
ACCCATGTGCAAGGCCCTATCTGCCGTACTCTGTCTGCCGCCTGGACAGTGATTCTTAAT
CTGAAATAGTCTGATATCACTTAGAATTTAGCTTATATGGATCGGGTTCTTATATGGGGC
TATGTAACTTTTCAAAGGTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTCCCTTTTGGGT
CGCACCTGGCTCTGCATTCAGGAATTACTCCTGGCGGTGCCCAGACGACTATATGGGATG
CTGGGAATCAACCCAGGATGGCTGCGTTGTGCTGTTGCCCAGCCCCTAAGGGGTTTTTTT
TTTTTAAATTTTTAAATTTTACTTATTTTTTTTAACTTTTCAAAGTTTTAAAATAAATTT
CTTCATGATTTTGTTGTTTTCTTTTGGGGCACACCTGTTGGTGTTCAGAGCTTACTCCTG
GCTGCGCTCATTGATCTGGTGATGCTTAGGGGACCATATAGGTGCTGGGGTTTAAACCCG
GGTCTGCCATGTGCAAGGCAAAAATGCCCTGCCTGCTTTACTGTCACTTCGACACCCCGA
TTTTTTCTTTATGACTTATAATCACTAAATTTGTGTACATGTTTTATATTGCTGTGGACT
CAGGATCACATGAAAATTTCTTGAGTAAAGAGGCACATGGAAAGAACTCTGATTTGCACT
TTTGGCAGACCTCTAGAGACACGAGTTAGTTACCAAATAGAGTTGGATCCACCTACTAAC
TAGAATCATTACGCGCCGTGGATATGGCAATGTACGGAAAGCTCTCCCAACACTGAGTAA
CAAGTCCAAAGTTTATAAGGCCCAGTTAAAAACCTTGAACGTGCGTTAAGCCCAAAGCCA
AGTCATGAGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCAGT
TTAAAGAACCTTTTAGGTGGCCTGGAAGCTATAGTCTAGGTGGATAGGGCATTTGCCTTG
CATGTGGCTGACCTGGGTTTGATCCTCTGCTTCCCATATGGACCCCCGCCTCCCCAAACG
GAGTAATTCCCAAGTGCATAGTTAGGAATCGCTGGGCATGAGCCAAAAAAGCAAGAAACC
TTGAGGAGTGTCAGGGACACACAGCTTCGGCTGGAGTGCATGCTGGAATCCCGGGTTTTA
TCCCCCAGCACCACATGGTCCTCAAAGCATCGCTTGTGACCCCACAAAAGGAAAGCTTAT
AATACAGAGCTTATGTATTCAAGGTAGATACCCCAAAAGGCTGGAGTACTTGCCGTGTAT
TTGCTTATGTATACCAAAACTTCAGATTCATTCTCGTACATAACAAATACTGCTGAGAGT
GTCCTGGGGCCTTTAAGTGCTCCTTATTTAGGAGTACAGCTTACACACACACAACAAAAT
ATAACATTTTTCAGATATTGAGATGTTGCACTTTTGGGGCTAGATAGAACAGTGGGTAAG
GCTCTTGCCTTCCTTGTGGCTGAATGAGGTTTCATCTCTGGCATCCCATATGGTTCCCCG
AGCCACCACCAGGAGTGATTCCTGAGTGCAGAGCCTGGAGTAAGCCCCTGAGCATCATTG
GGTGTGTAAAAAAATTTGTTTTTAAATAAAGTTTTGCACATTTTTTCCTCCAGCAGTGGG
TATAAAAATACTAATACGGGGGCTGTAGCAATAGCACAGTGGGTAGGGTGTTTGCCTTGC
ATGCGGCTGACCCCGGGTTCGATTCCCAGCATCCCATATAGTCCCCTGAGCACCGCCAGG
GGTGATTCCTGAGTACAGAGTCAGGAGTAACCCCTGTGCATCGCCAGGTGTGACCCAAAA
AAGCAAAAAAAAAAAAAAAAAACTAATATGTTGTAAAAGTCATATTGAGCCTTTTTAAAT
TTTATCACATGGTAGTTACTGTTTGTCATTCCTAATACAGGAGGATAGCAGGCGAAGAAG
TATTTTCTTTTTTAATGTATGCTTTCTAGTTTGCATATTGTATTCCTTTTAAGTTTATTT
CCCAGTGTAGAAAAGAGTATTATGGAAAGTGATTTAGGTAAAAGTAATTTTAAGATGCTA
ATAATATGCTTTTCCTGAATTTTATAGTGATTTATTTCCTCCTTTTACCCAGTTTGTCCC
GATACCGATTGAAATTCAGTGCAGATAAAGTGGACACAATGATTGTTCAGGCAATTTGTA
AGTATGGTTCATTCCAGACTTATCCTATTATATTCCTCTTCCTACTATTAAAACCTAAGT
TAATAGGTCATTATCCCATGTCATCGAGTGGCTTTCTTAAAAACTTGACAGAAGCATAAC
AGTTTTACATTTTTAAATATTTAAGTAGCAGTTGTATTTCTAGAAGAACTGACAGCAGGT
ACTCAAATACTCAAGATTACTATCAGCCTTAGCTACAAAAATCACTACTAAATTAATACT
CATTAGCAGATGAATAGATAAAATATGTCATGAGTAAATATATATGCATGAATATAATAG
AATATTATGGAGTCCTGGGGCTGGAGCTATAGTACAGCGGGTAGGGCATTTCCCTTGCAT
GGGGCTCACCTGAGTTCTATCCCCAGCATCCCATATAGTACTCCGAGCACCGCCAGGAGT
AATTCCTGAGTGCAGAGCCAAGAGTAACTCCTGTGCGTTGCCTTTAAAAGGAGTGAAATT
CTTATAAAGGCTGGAAGCATGTTTGAAGTTTGAGATCATGTTCAGTCAATAGGTCAGATT
TAGAAAGCCAATACGGAGGTATTGTGTGTTTCTACTTAAAAGTTACTAGAATAGACAGAA
TCACAGGAATATAAAACAGAGGAGGATCAGAGAGATAATACAGTGAGTAAGGCATGTGTT
AACGACAGGACCCAGGTTTTTCTTGGTCTTTTATATATAGTCCCCTTAACTCTGTAGATA
TGGTCCCAACCCAACCATTTCCCCCCACCGCAACCCAAGAATACAAAACAGGTTACAAGA
ACTTTAGGTCAGATGTGAACGTATTGTTTAATGAAGACATGGTTTCAGTTTGTGGTGGTG
AAAATTCTAAAATGGATAGTGTAATAGCTCTACAATACTGTGAAAGTGTTTGAAGCCACT
GAAACATACACTTGAACAATACTGTGAAAGTGTTTGATGCCACTGAAACATACACTTGAA
AATGGCCAAAGTGGTAAATTTTATGTATACTTTACCATAATTTAAACTCCTTTTAAGATG
CTTTTTTATTTGTTTGAAATCTGTTGCAGCCTTGTTGGATGATTTAGATAAAGAATTAAA
CAACTACATTATGCGGTGTAGAGAATGGTATGGCTGGCATTTTCCTGAATTAGGAAAGAT
TATTTCAGATAATTTGACATACTGCAAATGTCTACAGAAAGTTGGTAAGTTACTTTATAG
ATTATTTGTGCCTATGTATTGTAATGTAATGTATTTGTCTCTTTTGTTTACAGTAATTCT
TTTCCTTAAATACTTCATGAAGATTTTTTATGACTTAGCTTTTTTTTAAATAACACTATC
ATTGTCATCATGCTGTGCATTGATTTACTCAAGCTGGTGCCAGTAAAGTCTTCATTCGTC
CTAACCCTGAGATTTTAACAGCCCCTCTACTTGTCCTTCCCAATTGTGCCGCGTTGGAGG
CTCTTTCAGGGGAATGACCCTCTTTCCCCTTTTTAAAATATAGGTATCCTAATGTCTCTT
AGATTTTAGAAGCAATAATTACTTTAACTTGAATTTTTATAGACCAGAAAACATTTTTTG
GGGGTGAGATCACACCTGACAGTGCTCAGGGGTTACTCCTGGCTCAGGAATTACTCTTAG
TGGTGCTTATGGGAACATATGAGATGACAAGGATTGAATCCAGGTTGCTCGTGCTCAAAG
CAGGTACTGTAACCACTGCACTATCTCTCCAGCTCCTAGAAAATCATTTAATTTGTTTTT
TCTTAAAATGGTTTATTTAGAGGTTGGAGATATGATATGACAGTTAAGGCACTTGCTTTG
CATGTGACTGACTCAATTTTGAGTCTTGGTACCATATAAAATTCTGAGCATCGAGCCAGG
AGAAAGCCCTGAGGATAGTCAAGTATTGTCCCAAAACTTAAAAAAAAAAACAAAGATTTA
TTTATGGTAAATATATTTCATAGTGAAAATGTCATTAACAGGGCAACAGACTTGTGGGGG
TTCCTAGAATATTGAAAGTAGTACTGTTTTCCATATTACTAGTCTTGTTAGTAGTAATAA
TAGAGAAATCTAGGATTGTTAATGATGTCCTTAACTTGTTACATTGCCCTTTTAAATTTC
TCCCTAGCTTTAGTATAACTGTAATTATAGAATCTTAAACATGTTAAGATATCATGAATC
CTATTTCATCACGTAACTTTTCTAAATGTAATTTGCTATTTGTAGGGAAATAGCACTGTT
GTCCCATCGTTCACTGATTTGCTTGAGCGGGCACCTGTAACGTCTTCTTGATGAGACTTG
TTGCTGTTTTTGGCATATTGAATATGCCACTGGTAGCTTGCCAGGCTCTGCCATGTAGGT
GGGATGCTCTCAGTAGTTTGCCAGGCTCTCCGATAGGGACGGAGAAATCAAACCCGGGTT
GTAGTGGGGAGATTATCATCAAAGATCAATTTTTTACATTAGGAAAATTACTAGGGGGCT
GCAGCAATAGCATAGAGGGTAGGTCGTTTGCCTCGTATGTGACTGACCCAGGTTCGATTC
TCAACATCCCATATGGTCCTCCAAGCACTTCCAGGAATAACCCCTGTGCATTGCCAGGTG
TGATCCAAAAAAAACAAAAAGAAAAAATAAGAAAATTACTAGGTCTGACTTGTTCACTTT
TTGTTTTGTTTGGGCACCCTTTTCTTGGTTTATTTGGCTTTTTCTTTTGATTGGTGGATT
TTATATAATTTGTTGAAGAGTGATTCTCCTTCAATGCAAACATTCCATAGGCGATAGGAG
GAATTATGCCTCGGCCACACTTTCTGAATTACTACCTGAGGAAGTTGAAGCAGAGGTGAA
GGCGGCTGCAGAGATATCTATGGGAACAGAGGTTTCAGAAGAAGATATTTGTAACATTTT
GCATCTGTGCACTCAGGTAAAATGTACACATTGAGTTGTAGTTGTGATGGTAGTGGTGCT
ATAATCTGATGGCTATGATGATTTTAAAATTTACACTTGCCTGATAAGTAAATATGAGGG
TGTTCAGTCACTACCTCATCTGATGCCATCTTGATTTATATGCACAGGGAATATACACTA
GTGTGTAATATTTTGTTAGCATTGTCGTAATAATAAGTTACACATTCAGTGAAAAGACAG
ATATATCTGTTTTTTAGATTTAATCCAGAGCCTCATAGATAATGAATCATGCTGTCCACC
CCTAAGCAATATGTGCTACCCTGTAAAAAATATGCACGCGGTAGGGTGTTCGAAGGCTTT
CTGGGTGGCTCTCCCTTGCTGCCCGCGTTCAGTGCTCTTGAGCCACTGTGTGTGGACTGG
ATCAGGACAGCTATTGGCGATGGCCAAGAGAAGGAAGAACAAGGGCCAAGCTGGTTGCTG
ATTAGTTGCCATTTATTCAATCTCTGTCTCTCCCATCTCACATACTCTTCATCCTCCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTAAGGGCAACTGAGTCGAGAAAGCAGATGCCCAGGA
GTGAACTATTATTTGGAGTCAATTAACTCCCAAGTTACAAAAGCATAATATTAACTGTCT
TCCTGTGTCCATATAGAAAGGACATTACTTTGAGATAGACTATGCAAAAGACATACCGTA
CAGTGCAAGTTTAGTCTTCTTCGAAGGATCTGATCTTACAAGCTAACAGAATCTGAGTAG
GGAAAAAGGTAATTAACTGGTTGGGAAGGAGAGCACAGAGAAGAGTTTACAGATACACAA
AGGAATGGGAAAGACTCGAGAGCAGTGTGATGGGTGTAATCCAGTAAACCTAACTTCCCT
GGGCACGGCTGAAAGGACAAACCAATGTTATCCTGCACTACCCCCTGGAGGTTTTTTGCT
AGTTTGGTTTTGAGGTCATATTTAGTGCTATACAGGGGACCCTGAATTGCTAGGGATTGA
TCACGGGCTTTCCAAATGGAAGACAAGTGCTCCATTATACTGACCTACATTCCCAGTTTC
CTTTAAGTATTTGGTTTTTGTTTGTTTGGTTTTGTTTCATTTGGAGACCATACTCAGTAG
AGCTAGGGCTGCTCCTAGCTCTGTTTGGAGATCAATACCAGCAGTGTTTATGGGGTACCA
TGTGGTGCCAGGAATCAATATTTGAGCGTCCTGCAGCAAAGCATGCAGTATCTCTCCAGC
CCCTCTTAGAATGATTTTGTTGTTTGATTGTATTTTTTAAAATTTTTATTGGGCAGGGCT
TATTTGTGCCACACTCAGTGGTGCTCAGAGATTACTACCGGTGATAACTCCAGACCATAT
ATGCAGTGCCACGGATCAAATCTCCTTTGGCTGCATGCAAAAACAAATAACTGCTTTACT
ATCTTTCTGGCTCTAAAGTGGATTTTTTTTGGGGGGGGGGTTTGTTTTTGTCTTTTGGGT
CACATCCAGCAATGCACACTCAGCAATGCACAAAGAACCTGGATCTGCCATCAAGGAGTC
ATTCGTGGCAGGCTCAGGGGACCATTTGGGATACTAGGCTCAAACCTGGGTCAGTTGCAT
GCAGGACAAGCATCCTACCCGAAGTGTTATTGATCAGATACTTTGGAGTGTTTTAATATG
ATATAGGTAACATGTTAGGTAGTGTAATTATTTGTTTATATTGTCTGTTAAATCTTTATA
ACAGCTGATTTATAGGAAATAAAGTAAAGGGTGTTTTTTGAGTTGAACAGCTGCTCTGTA
ACAGTATAGGATTCTGGTGATGTGAGATATCTTAAGGCATTGGTGATTTGCTCAACTTTG
TTCTTTATGCTAGGTGATTGAAATCTCAGAATATCGAACCCAGCTCTACGAATATCTACA
AAATCGAATGATGGCCATTGCACCCAATGTCACAGTCATGGTTGGTGAATTAGTTGGAGC
ACGACTTATTGCCCATGCAGGTGATGGTTTCAATGTAATTTGTAAACATGAGTAGACTTA
GTGTATCTTATTTAGGAAATAAGAGACACAAGTACTTACTAATCTTTAAACTATAGTTAT
TAAAGAAATTTTAGTTAGTAAGTAGAAATAGGTGGTTGATGGTAAGGACAAAGGACCAAG
TGTTCAATGATGATTTTTGTTTGCATGCCTGATTCCTTTTGGTTAATGAAGGCATCTATA
GTCACTACCTCTTCTGAGACACTGATGATGGTCCATTGTCAGGTTTTTGTGGTGGTGGGG
GAGAAGCTTCCAAAGCCATGCTCAGGGTCATTTTTGGCAATTCTGGTTTAATGGGAGGCT
CCCAGAATCATGGGCCATTCCCAGTGTGGTCAGGGCACCGTGTAATGGAAATCAGACGGG
GGTCAGGAAGCCACACGTGTGCCCTAACTCCTCTGTTTCTCCATCTGGTTGAACTATATT
TTAATGCTAGATTTGAGTAATGAGATGAAAACCAAAGTATTAAATCACTACTATAAATGA
TTTGTAATATAATTTAATACCTGTGTATAATAATAATGTTACTTTGCTGTGCTACTAAAA
GTTATTTAATTGAATACTTCGAATGAAGTTTTACAGAAGATTTTCTTGTTTTTGAATCGC
ATCCAGTGGGTGCTTGGGAGACCTTGGGATCAAAACCAAGGCTCCTCCTACATTCATAAT
TTTTTATTTTATAAAGTAGTTCACAATATTTGATTTCATTTAATACTCAAACACCAATCC
CACAACCATTACACCTTTCCACTACCATATTTTAAATATTTCCATCGCGAACCCCAAAAC
CCTGCCTCAAAGCAGAATGAAATAATATATTTTGTATTGATACGAAAAACGGCTGAGAAT
GCTACAAAAAAAGTATCATTAGAGCAAAGAGGGTGAGCATTGTTATATTCCACTGAGGGG
CCATTAAGTCCCTCTATAAGAGATCACTAACGTTGTTAGAAGTGGAGCCTTGTGAGCTTT
TATGTATATATCTAAAGAAAATATTTTTTCCCCTGAGATTTGTTGCCTCCTGCTTTGAAC
TCCATCAGATGTGTTGCGGTAGAGTGTGGGTAGTGTATGAAATGTTCAGGAATAGGTTCC
CTCGTGGGTGAGGGTTAGCCTGAGTATGTGGAGAGTGGCCGTGAGCATGGCGGTGGTTGA
GTTCTGGAGGTTTTCGGCTGTTGGGGCTGGATCCTTTGGGGGGAGGGAGGGCTCTCACCT
GCCCCCTCTGGGGCACCCCGAATGAAACAGCCTGGCATGGGGTCTGGCAGCATGGTTATG
GCGTAAGGCTCCTACATTTAAAGTATGTGCTCTAGCTCTATTTTGAGCCATCTCCTCTAT
TCCCTATCACATTGACTACTCCAAAGTGTTCAGAAGAGCTCCTTTAGTTGGATCACTAAT
CAGACATATATTCCCTTCAGATACCCTCAGTTGCAAGATTCAGATCACTGGGACTAGTTT
GTCTGCATCCAAAACCTCAGAGTTTAGGTAGATTTATAGCTCTAAGAGATAAAGGGTTTT
TAGGGCACATACTTGGCAGAATTTAGGCTATCCCTGACCGCCCCTCTCCCCATTTAGCGA
TCACTAGTCCCTAGAGTTGAACTTTTCACATCTGGTGAGCACTTTTTTTATAAATTTATT
TATTTTATAATTAGTGAATCACTGAGGATACAGTTACAGAGTTACACATTTTTGTGCTTG
TGTTTCCCTCATACAATGTTTGAGAACCCATCCCTCCATCAGTGTCCATTCTCCACTACC
AGTGAACTCAGTATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTT
TGCAATAGGGGTATTTAGTGGCCATCGTGTTCAGTCTCTAGTCTACTTTCAGCACGCATC
TCTGTTCCTGAGCAGGATCTCCATCCACATTTTACTTGGTGTTCCCTTCTCTATCTGAGC
TGCCTTTCCCCCAGCATGTGAGGCCAGCTTCTAAGCCATGGTGGTGAGCACTTTTAGCAG
ATCTCCTGAGCATGTCTTCCTTAGGACAAACAAAATGCGAGAATTTTTTCACATGGTTGG
TTCTTTTTTTTTTTTTTTCATAAGGTTGTTCCTATTAATTGACTACATTCAGCATTTCAA
CACCAATTCCACCACCATTTTGAATTTTTCCACCACCATTCAAGCCTGCCTGCCAGGGGC
ATATATTAGATAATGTATTTTCTATTGCTTGTGAATATCATGAGAAGTCGTGCGGCCACA
AAAGTCGCCATGCGTTTCTGGAATTCTAAAGTTGTAAATGGTAAATGGTTGGGGTCCAAA
AACATCTCTGTAAGGAACTAATCATTCTCAACCATTTTGAGATTCATTTGGGAGTCTCTG
GATCAAGGCTGCTGATGTGCTGAGATGGTGCCCAGAGGTAGATTGTGGGTGTGACAGCCA
GGACCCCAAGCTGGTGGGGAGACGGGAAGGGATGGCCTCCGCTGCTACCAGGTGGCCTGG
AGCTGTAGTCCTTGAACCCTTGTACCTGAATTTTGCTTCTGGAAGTTTGTGGTCACTGTG
GTTTTGTCTGGAATAGGTGGAGAGGGCACACCCGCTCCATCTGAGGTGCCCCGGTAGAAT
TGGCTCAGTATGAGGTCCAGAGAGATCTCCAGCGAGCTGCTGTCTTTCAACGTGTTTGGT
TCTACAAAGATGTCCTGATTGTTTGGTTCTTTTGTTTTCTGTATCTAAAGTAGAATATTT
GGTATCAAAAATAAATGTCAACAAATGGTGGCTTTATGGGGCTCTTGCCCTGCATGTGGC
CAACTTGAGTTCCATCCCTGACATCCTGTATGGTGTGTCCCATCTCACCCCCAAACACAC
TAGAAGTGATTCCTGAGTGTGGGCCCAGAAGTAACTCCTGAGCAACGCCAGGTGTGGCCT
CATCCCCCAAAAATGGAGACATGCGAAATATATATAGGGACTAGGCTGTCTGAGTGATAG
TACAGGCGATATAGATAGGTGCTTGCCTTGTGTATATGTATGACCAAGGTTCAAATCCTC
AGGGGAAAGAATATTATTGCCCACACATTGAGCCATTAGTAGCCTCTGAGGACCATTGTG
TGTGGCTATCCAAAAACTGCAGGGCTAGTGATTGAGTGGTGTTTCTCAGCATAGCCATGG
GATCTTGCTGTGACATGTTGCTAACAAGCTTAACCTTTGATTTGTTATAGATGCTCATCT
GAAATCTCTGCCTGGGTTGCTAAGGGAAAGCCCAGTGTTTTAAATATATGCATTCCCTTC
TAATTACGTCTTTTCTTTTAAGGTTCTCTCTTGAATTTGGCCAAACATGCCGCTTCTACC
GTACAGATTCTTGGAGCAGAAAAGGCACTCTTCAGAGCCCTCAAGTCTAGACGAGATACT
CCTAAATACGGGCTCATTTATCATGCTTCACTTGTAGGCCAGTCAAGTCCCAAACACAAA
GGAAAGGTGAGTTAGTTATTTATAGTAGGCCAATTTTTTTTTCTCTTCCAAACAGCTTAT
TTTTTCTCCTTTGTTTTATGTAATAAGTAGTTTTAATAATTGGTAAGTCCTTTAAATAAA
AAGCACTTTGTACACTGAGATTGTTATTGCAAAGCTAGAGAGATGAAGCAGAGGGTAAGG
CACTTGTCTTTGACCCTGGTTCAGATCTTTGCCCCATGAAAGGTCTTCTGAGCACTGCTG
GGTGTGACCCAGAAAAAAACTAGGGCGGGGGGATAGTACCATGAGTAGGGTACTTAGCCT
TGCATGCTGCTGACCCAGGTTCAATCCTCAGCCCCTTTTTAATAGCCCTATGAAACAATA
GGTTCCTCTCTACAAATGAGGAAATTGTGAATTAGATAAAATAGTAAATTTTAAAGTGAC
GTGAGAAAGAACAGGTTCTTTTAGTTAGCTAAAATTAAATCAGCTTGAAAAATAAACTTC
AAATACTTGAAAGAAGTTTTTTCCCCCCCGCACATCCCGCAGTGCTCAGGGCTTACTCTT
GTCAGGCTCAGGGGCTCAAATGGGATACTAGGGATAAAACCCAGGTCTGATTGTTGCAAG
ACAAACACCCTAGTCACTGCACTATTTCTCTGGCCCAGTATTTGAAAGTATGTTATAAGA
GAAAGGGATGGCTACACTTTTTTGCAGGAGTGACCTCATGAGTCTAGAAATAATGTCAGT
CTACCAGAAACTTAAGAAAAGTGTTGGGATAGTCGTGTGGACCAACTTTAGATGAGCTAC
TTAAGATCTTTTTGTCCACCAAAATTATGTTATGGTAAGGCACTATACCGTGATTTAAAT
ATAAAATAGGTGACTTGAATTGTTCAATTCATAATACTTTGTAATTCTTCAGTTTGAAAA
CACTAGAATGAATAGCAGAGTGATTTTCTGATAAAATCATGAGATTTTTATATCCCAATT
TGGAATGTAATTTGAGTACCTTTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGATGCTTTCGGTGAGATTCCAGTTCTGCCATGGGAGTTGAGAACA
GAGCGTTAATTAGAGGCCAGGTTAAGGAGCTTGGAAGATAGAGGGGTTAGAAACATTCTG
CCTATTGCAGAATTGCTCTGTATTAAAAGCTCAGCAGTTTATATGTGCAGAGGGATTTTA
TTTCGTAAAAACTTTTGTGAAACATTTATATACTTGTATATTATATATTGTATTGTTTTT
GTGCTTGCTCTTTGGTTTTCCTTATCATCACCAAAACTTGATGTGAGATAGAGTATTTGC
AATTAAGCTGCTTTCTGGATCAGTTGATAAACTACTATAAGGAGATTTAGAAAATCATTT
ATAGCTTGCTCTTTAATCCTCTCTTGAACACATCACACTTGCTATCTCGATGTTTCTTTG
CCTGCCTATTTCTAGAGAAGCCTGTATTCCCTCAAATATGTATTTCTCTCTCACCTTACA
TCTTTCTAAATAAGTTTCAATAAAATCTTGCTTCACTTAAAAAGAAAATATTGATAATTT
TTCTTTTTTTAGATACGGAAAATTAGTGGAACAGGAAAAGCTTTAGCAAAAGCAGAAAAA
TATGAACATAAAAGGTGAGTATATTGGGGCTGGAGCAATAGCACAGCGGGTAGGGCGTTT
GCCTTGCACGCGGCCGACCCGGGTTCGATTCCCAGCATCCCATATGGTCCCCTGAGCACC
GCCAGGAGTCATTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCCAGGTGTGAC
CCAAAAGGCAAAAAAAAAAAAAAAAAAAAGTGAGTATATTTGTGGTAGATGGATGGATGG
TGTTTCTAATTAAAACATTAATTATTGACATTCTGGAGATGTCCACCAGGGAATTGAGGC
TCTTGAAGTGGTTCAGGCTCATGAAGAGAGGGAGGGCCCTGAGTATGTTTTATTGCTCCT
TTGGGAGACCATGTCACACCCTAATCACTGTCATATCTCCCATCCCCTAAATATTGCACA
AAATTTTACAAAGATCTTTCTTCTCCCACTGGAGTCCCATCGGGGAGATGCATACGGGAT
ACTCCTGGCTCTGCACTCAAATTACTCCTGGCAGTGCTCAGGAGACCATGTAGGATGCCA
GGGATTAAACCCAGGTTGGCTCAGTGCATGGCAAATATACTGTCACTCCGATTCCTGCTG
ACAGTTTTAAACCTCACAATTGTGAGGTTTTGAGTTGGATTTTAGCAGTACCTGGGCCCC
TGAGCACTCCCAGGTATAATTCCTATATAAATGAAAGGGAGTTTAACAAGAGATCAGTAC
TAGACTGTAGAGAAAGCTGTAGCCCCAATGTTTTTTCTCATTTTATAAATTTTCCATTGT
AAATATGTAGTGACCACGTATTATGTGATTAGAAGGGCTACTCCTGGCACAGTGGTCGGC
ACATTTATGACAGTGATCAGGAGACCATGTGGTGCTGGGTGCTGAACTGGGGGTCCCACC
ATATGTAAAGCAGCACTCCAGCTCTTTGATCCATTTCCCCTAACCTGTAGTTGTGTTTTT
ATTTTTATTTACATTTTTAACTTCTAAACTAAAGATCCGTGAGTCTAATAGTCAGCTTAG
AAGGTAGAATATTCCTTTGTATAGAATAATTGTTTCAGATAATTCTGTGATGTCATACTT
CAAACTTTTTTAACACATTCAGTTAAAGCTAGTTAAAAAATTAAATTCACATTTACATAC
TTGTTATCTTGATTTTTTATTTTTTGCCTTGTTAACAATTAAGCAGCCTGGTTTTTCACT
GAATCCAGTACAGTCAAGAGGAATAACCAGTATGCATCTGTTGTTTAACTGCCTCTTCAG
AAGGTTATTTTATTTGATTTTTTTAAGTTAAATTTTACAATGTTCTAACATTAGGATATG
AGATTTTCTCTTCTTCCCATTAAAAATTTCTTTTACCATAATCACCATTTTGATTAATCA
ATTTACCTAGCTTATCTCTTTAAGTTTCAAACATGAAACTCGAAACATGAAACATTAATC
CTCTTTGCCTTGGAAACTGTTAGTATTCATAAAGTAGTATTCATAAGTTGTCATTAAGGA
TAGCAATTTAGAAAAGCTGAGGGAGAATACGAGGTAGAGGTTTTGGACTTGCTTGCCACG
TACATGGGTTTGATCCTCAATATCATGTATGGCTGGTCCCCTGAGCACTGTGGATGTGAC
CTAATAAAATCCAAAACAACATTGTATATTAATGAGATATCGAATGCTGTTTGCCTTAGA
TTTTAGTGGTAGATGTTAAGATCTTTTTAAACTTTTGGCTCTTTCAGTGAAGTGAAGACT
TATGATCCATCTGGTGACTCTACACTGCCAACCTGTTCTAAAAAACGCAAGATAGAACAA
GTAGATACAGAAGAAGTTACTGAAAAGAAAGCTAAAAAACCCAAGATTAAAATTAAAGGT
TAGTTTTTAATTTTAAAGTGTTGCTTTACATTCCCTAATTTAATAAATGTGTGTTATTTA
TGTAGAAGTCTTTTTTTTTTCCATTTTGGGTCACACCTGGTGATGCACAGGGGTTTACTC
CTGGCTCTGCACTCAGGAATTACTCCTGGCGGTACTCAGGGGACCATATGGGATGCTGGG
AATCAAACCCGGGTCAACGCCCTACCCGCTGTAGTATCGCTCCAGCCCCTTACGTAGAAG
TCTTTAGCCTTTCCCCTCCCCACTTGTTTGGGGGCCTTACCCAGTGGTACCCAGGGGGAT
CATGTACAATTTTTCTTACCCTTCTTTTAATTGTTTCTTCATGTTATGTTGGTAAGTATG
ACTGGAGGTCACATGCCAGGTTGTAATGCTTTTTGAGCGTAGCATTCCACATTGGATGCT
TAATCAGAATGAAAGGATTTTTACATCTAGTTTTTCTTTGTGAGCAACACCCAGTGGTGC
TTAAGGATCAGTCCTGATGGGCTCAAGAGACCGGATGGGGTATTGGAGAGCAAACCTGGA
TCATCCACATACAAGGCAAGAGAGCCTTAACTTGCTGTACTCACATTGGTCCCAGGAAAT
TTTTTTTTTAATTGAACAGATTTTATAGTTTGCTGCAGGTTGACTTTAGGTTGACCTTGT
GGCTACTCACTATAGCATAGCGGGTAGGGCGTTTGCCTTGTACACAGCTGACCTGGTTTC
AATTCCTCCGCCCCTCAGAGAGCCCAGCAAGATACCAAGAGTATCTTGCTTGCATGGCAG
AGCCTGGCAAGCTACCCATGGTGTATTAAACAGTAACAAGTCTCACAATGGAGACGTTAC
TGGTGCCCGCTCAAGCAAATCGATGAGCCACGGGATGACAGTGACAGTGAACAGATTTTG
GCAATTAAAGTGATAACATTGTTAATTGTGTCTTTTACGTTTATCCTATTCAGTTGAAGT
GGAGGAGGAGGAAGAGGAGGAAGCAGCAATGGTAGTGGAAGAAGAACAGGAAACATCTGT
GAAAAAGAAGAAGAAAAAAGACAAAAAGAAACACATAAAAGAAGAACCAGTTTCTGATGA
GGAGCCATGCACCAGCACAACTGTTATTGTATGTTTGCTTTTAATGCTAATACATTTGCT
CAGACTGGAATTTTGTCTTTTATGTAGATGAAACTGACCAGGTGGATTATTTTTTCTTAT
TGTGAGCCCATGTTAATGTCTGTTAGCTTTTCTTGTTTTTTAATTTTTATTGAATCACCA
TGTGGAAAGTTACAAAGTTCTCAGGTTTATGTCTCAGTTATACAATATTCAAACACCCAT
CCATTCACCAGTGCCCATATTCCACCACCAAAAACCCCAGTATACCCCCCGCCTCCCCCA
CCCCCAACTGTAAAACTGATGAATTTCACTTCATTTTCTCTTTACCTTGATTACGCTCCA
TATTTCAACACAAAACTCACTATTATTGTTGGAGATTCCCCCCAAGAAAGACAGCCCTAC
TACCAAGGTAGCATTTGATAGTTTTCCATTAAAAGATTATATGTTTTCAGTTTTTAGAAA
AGGTCGCGCGCGGTTCGGAGTTGTCCCCAGTCTGGCATCCCATAGCCATGTTAGTTGCTG
CTCAGTGTCGCCGGGGCTCCATCTGGAGAGGTTGTGGTGGCTGCACCTCATCCGTCTGGA
TCCCCGGTGTTGCTGGCCCGGTTTCGGGTCCGGAGCATTCTCCGGCCGCGTTGCTCGCCA
GAACGCCCTGACCAGGTGGATTTTATTAAAACAATTTTTATTGAGGGACTGGACCCAGGG
CCACCTGTGCTCTTATACGGTTATATCTCAGACCCCTTATATTTCTAAATTTTAGTTTTA
TTTCCAGAGTTTGTCTCAAGAGAACAGATACCATTTACTTTTTCATAAGGAAAAGTTACT
TTTCACAGTTCTTTAAAAAGCATTCTTGTGATTCTTTTCAGAGTTCAGAGAAAAAGAAGA
AAAAGAAAAAAAAGAGAGATGATGAGGACTAACGGAAGGGAACCATAATTGAATTCACCT
GGATACATCATGCTTAGGATTATCAGGAATGCACCAGAGATACTCTGCAGTAATCTAAGG
GAGACTGGAGAAAACAAAATGATTGTGTATATTTGTCACATGGCATAAACTGCTAACTTT
AATATATCATTTCTTAGAGTCTTTGTTATACAAATAAAAATATTTTCTTTGTATTTTAAG
GCAGTTCTGTGATCTCTTTATATTAGGTAGAAAATCCTCGGTCCTTTTTTTATATTTTAT
CTAGCTTTGAAGATCATTGTTTTGCTAGTTGTGAATGGTTGACTTGAAATGGCTGTTTTG
TAGGCAGTGACTCCATGAACCATTTTAAGAACCTCACTGTTTCTCTTGCCTTTTTGGACT
GCCTTTCATTTCCTCCTTAATATTTTGTGTTTACTAAATAAAACTGTTTTGTGTTTAAGA
TTTAAAAGTAAGTGAGCAAAACGTATTAGTGTATCTTCAAAAAGAAAAAACATTTGTGGA
TAAAGTTACTCTTTTTCATAGTTTTAAAACGTATCAAAATTACTATACTCTAAGCCCTGA
TTTGCTTCTAAAGAAATCCAAACTGACTTTTTAAAAGGTAATGCTTGGCTGAAGAGAGAT
AGTACAGCTGGTAGGGTGCTTGCCTTGCACACAGCTGACATGGGTTCGATCCCCAGCATC
CCTTTATGGCCCCTAAGCATAGGAGTTATTTCTGAGCGCAGAGCCAGGAGTTAGCTGTGA
ACACCACAGTGTGTGGCCCAAAAACAAACAAAAAGGCAATACAAATGATTTTTACAGTGT
AAAGATCAAGGGGGAAAAGGGAAAAGATAAGCTAGAAAAATATAGGAGTGAGGTTATAAA
CCAGTGCAGAATATAAAAGCTTTGTTACTAAAAGAAAGCTTTTATTGTGTGAACAGTTAA
TGTGATTGATCTGGTTGATAGACATCATAACATTCACAGGACTTAAATGTGGTTTTTAAA
TCATATCTGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 5689..5765, 8693..8745, 11072..11193, 12455..12591, 15952..16016, 17069..17203, 18770..18915, 21313..21439, 24802..24965, 26070..26129, 26132..26163, 26165..26165, 26169..26204, 26652..26713, 28427..28557, 29513..29534, 29553..29667, 30521..30571
1001..1045, 5689..5765, 8693..8745, 11072..11193, 12455..12591, 15952..16016, 17069..17203, 18770..18915, 21313..21439, 24802..24965, 26070..26129, 26132..26163, 26165..26165, 26169..26204, 26652..26713, 28427..28557, 29513..29534, 29553..29667, 30521..30568
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved