Sorex_araneus Locus TCP1
snOPY snoRNA Orthological Gene Database
Sorex_araneus TCP1
Sorex_araneus
TCP1
GeneScaffold_2364
SNORA20
7742..7871
10133
TACCTGGCTTGGAGAAAGTTTGTGAATGGGATAACATGGCATAGAGCAGGAGGTCAGCT
AGCAGGAGCTGTGAAGAGACGCTCGGGTTTGTGGGGGGAAAGTGTGTGTTTCCGGGCTAA
AGCAAAGAGTAGAATCTGCATCTTCAAAAATACTGAAAATTGATTGTGTGATTTTTTTTT
AATAAAATTATTGTCACTTCCAAAGAAAAATAATTTTAACTACAAAGTATTTCTGAATAT
TCAGAAGTTATTGAAAGGATTTTTTTTTTTTTTCTTTTTGGGTCACACCTGGCTCATGTA
CTCAGGAATTACTCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGATTTGAACCCG
GGTCGGCCGAGTGCAAGGCAAACGCCCTACCCGCTGTGCTATCACTCCAGCCCCAGGATT
TTTTTTTTTTTTTAAGAACCTAGATAAGTAACTATTGGACCAACGGTGCCATATCAGCCT
GAACTATTGGTGTTATTTTTGCTTCTATATAGTATATACAGAAATGTCAAGTTAGTAGCC
GTAATGATTGTTTCTCAACAGGTCATTATTGCAGCAGAACTTCTGAAAAATGCAGATGAA
CTAGTCAAACAGAAGATACATCCCACATCAGTTATTAGTGGCTATCGACTGGCTTGCAAG
TAAGAGTTTTCAAAGAGAATTTTAAGTGAACACTTGTTTATGTTCTCTTTTGAGGAGGGG
TGCTTGCCAGCTGTGCTCTGCTGGGCTAGGCAGGCTGGAAGGAGGTGGTAGAGGCTGGGG
GTGGAGGGGACAGTGCTGGTGATATCTCCCTACCCCAGCACTGTTTGGGGGCTGCTCCTG
CTGGTTGCTCAAGGAGCCCTGTGGTCTGGGGGTGACCCTGTGCTCAACCTGTTGCCTTTC
TCCGCCGCCCGGCCCGCAGACCGCGCGCTCACTCGCCGCGTTGCCCGCCGCGAAGATGGA
GGGGCCCCTGTCCGTGTTCGGGGACCGCAGCACTGGGGAGGCCATCCGCTCCCAGAACGT
TATGGCAGCAGCTTCGATTGCCAATATCGTCATAAGTTCCCTTGGTCCAGTTGGCTTGGA
TAAAATGTTGGTGGATGATATCGGGGATGTCACCATCACGAATGATGGGGCCACCATTCT
GAAGTTACTGGAGGTGGAGCATCCTGCAGCCAAGGTCCTATGTGAGCTGGCGGATCTGCA
GGACAAGGAAGTGGGAGATGGGACGACCTCAGTGGTCATTATTGCAGCAGAACTTCTGAA
AAATGCAGATGAACTAGTCAAACAGAAGATACATCCCACATCAGTTATTAGTGGCTATCG
ACTGGCTTGCAAGGAAGCGGTGCGTTACATCAATGAAAACCTGATTATTAACACGGATGA
GCTTGGAAGAGATTGCCTGATCAATGCGGCTAAGACCTCAATGTCTTCCAAAATCATTGG
GATAAATGGTGATTTCTTTGCCAATATGGTGGTAGATGCTGTGCTTGCTGTTAAATACAC
AGATGTAAGAGGCCAGCCTCGCTATCCCGTAAATTCTGTGAATATCCTCAAAGCCCACGG
AAGAAGTCAGAGCGAGAGTTTGCTCATCAATGGCTACGCGCTCAACTGTGTGGTAGGATC
CCAAGGCATGCCCAGAGATAGTCAATGCCAAAAATCGCTTGCCTCGACTTCAGTCTGCAG
AAACAAGATGAAGCTTGGAGTGCAGGTGGTTATTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTCCTCCTGGCGCGGCTCGGAACTTAGGCAGTGCTGGGGTTGAACCCGAGTTCAG
TGTATATGCAAGCGAATGCCCTTCCTGCTAGACTATTCTCTCTGGCCCTGCTCCAGCTAT
TGAAAGGGCTGGGGTTTTATTGTTTTTGTTTTTGCTTTTTGAATCACACCCAGAGATGCT
CAGGGCTTATTCCTGGCTCAGCACTCAGGAATTACTCCTGGCAGTGCTGGGGGGACCATG
TGGGCTGCTGGTTCAATTTTTTTTCTTTTTTGCTTTTATGGCTCTGGCCCCTGAAAGGGC
TGTTTGTCAATCATCTTTTTCTTAGCATAGGTGACAAAGAACAGCCACAGGGTATGTGAT
TTCCTCCCACCACAGCCATTTTCTCTGGCCAACCTACCCAGTCTGTCTGCTGTCTTTGCC
CTCAACTTTCCTTTGCTGAGTTTTAGCTGTCTTGGGCAACTAATCCTACTCTTCATTTCT
TTCCACATTTGGCTTCAGGCTTGCTTCTCTCCTAAGGCAGAAACGTTGGGGATGAGGGAG
GCAGCTTATCCCAGCGCACTGAGCAGGGGATGTTCCTGAAGGTGCTCTGGGACTGTGTGC
CAGGGATCGAATCTGGGCCTGCCACATGCAGGGCGTCTCGTCAGCCCTCCAGATCTTGTT
GCCCCGCTGGTTTTACGTTTTTTGTTTGGGGGCCACTCCCAACTGTGTTTAGTGCTCACT
CCTCACAGTGCTCGGGACCACATGTGGTGCCAAGCATTCGAGCCTGAATCAGACACAGGG
ACAGCAAGTGCCTTACCTTGTGTACTGTCTCTGACCCTCATGTTCCTGGGTTAATCGAGA
GCCCCAGCCAACGGGGCTCAGGGGACCGTAGGTGGTTCTGGGGATGAAACCCAGGTTGGC
ATGCAAGGCCAAGGGCCTTACCCACTGTACTACCTCCAGTTTGGTCTCCCTCGTGATTTA
CTGGACTCCCATTTCTGTGTGGCCAGGGCAGGAAATTGACCAGGTCACTGCCATCATCCT
TTCCGGGGCCTTTGATCGGGCCTTTGACTGCTCCCTCTGTGGGGGGGTAGGGGTGTTGTA
CCCTGCCTCTGTCTCTGACGGTGGCATCTACCATCTTGTTCTCTGTCAGATTGCTTCTTT
CTGTAGCTTCACTGCCTCTGTGGTAGAGACTCCCAAGTGTGCTTTCTTAACTCCGCACAT
ACTTGTAGAACTGATACACTATGCAGTTTAAGTATCTTACAGTCCTGGGGCTGGAGCGAT
AGCACAGTGGGTAGGGCGTTTGCCTTGCACGCAGCCGACCTGGGTTCGATTCCTAGCATC
TCATATGGTCCCCCGAGCACCGCTAGGAGTAATTCCTGAGTTCATGAGCCCTGAGCATCA
TTGGGTGTGACCCAAAAAGAAAAAAGAGAAGTGTCTTACAGTCCATGCGCTAGAGCGATA
GCACAATGGTAGGGTGTTTGCCTTTCTCGGGGCCAACCCGTGTTCGATTCCTCCGCCCCT
CTCGGAGAACCCACAAACTACCGAGAACATCCTGCCCGCATGGCAGAGCCTGGCAAGCTA
CCCGTGGATATGGATATGGATATGCCAAAAACAGTAACACACAATCAGAGACGTTACTGG
TGCCCACTCAAACAAATCGATGAGCAACGGGATGACAGTGATAGTGACAATCTATACACC
TAAAAAACTGATCTTACAATACTCACCCATTTGCTCTTGTAATTTTAGTGATGCGAGGTA
CCCCTCTTAACTCATGCAGAGAGCTAGGAAATACCTCTAATTCCCCTTTTTTTGTTTTAG
AGCCACACTTTGCACTCAGGAATTACTCCTGATGGGCTTGGGGAACCATATGGGATGCCG
GGGAATCGAACCCGGGTTGGGTGTGTGCAAAGCAGGTAGGTGTCTTGGGCTGGAGCAATA
GTACAGCTGGTAGGGGCGTTTGCCTTGCACACGGCCAACCCGGGTTCGCATCCCATATGG
TTCCCCAAGCACCGCCAGAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCTTTGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGAATTCAGAAGATCCTGGCAAC
GGGGCCCAATGTCATCCTCACCACTGGTGGCATTGATGACATGTGTCTGAAGTATTTGTG
GAGTCTGGCTCCATGGCAGTCAGGAGAGTCTTGAAAAGGGACCTGAAACGTATCGCTAAA
GCGTCTGGAGGTAGGACTTCCCCCAACGCCCGTGAACATGAACCCTGTCGGGCGCACGTG
CAGCGGTGCCCTGGGACATGGGGAACAGGATGGACCCAGACACACCAACCCATTGAGCAG
TTTCGCCCTTTTTCTTTCCCTTTTTGTAATGAGACCCTCTCATGGCAGTGTGGATGTCCT
AGGTGGGTGCTCCCGTTACCCCGGGTTACCCACCGGAGAGCTAGCAGAGTGGAGGGTCAC
ATCGTGTTAGACCTGCACGGTCTGACTGGGTGGAGAGGTCAGTCAGCAGTCTCCACTTTC
ACAGCATGGCTGGCGTGGCGCCCCTCCTGCTTCCTGAAACATGGAGATGTATAGGATGCA
GCAGTGATTGCATCCCACTCTCAGCTATATTTGCGGGCCTAACACTGAACTCTGAACCTT
AAATCATTCATACAGGACTCTCAGATATGAAAATGTTGATGGGAGGAAAATGCTTATAAG
TTTTTCCATTATATTACTAGCGGTGATTCTGTCAACCTTGGCCAATTTGGAAGGTGAAGA
AACTTTTGAATCTTCCATGTTGGGACAAGCGGAAGAGGTGGTACAGGAGAGAATCTGTGA
CGACGAGCTGATCTTGATCAAGAAGTAAGGCTACTTGAAAAAAGCTACACGGCTTCCTGC
CAAGGAACTCGAGGCTCTTCCCATTGATTTGCTGCTCTGCTCTGGCAGTGATCTGAGCAG
TTATACGCGTGGGATATAGTGACAGGAGACTTTTGTAAATGGGGGTGCAGTGTCTGTTCC
ATCCCCGGTGCATGGTCTCGACATTGCTCATATATAGCCTGTTGAGCGTCCTGTGGCGGC
GAGGTTTAGGCCGGGCACCGAGGGGGCTTCCAGTTGTGATCCTGGGTTGGGGAGAGGAGT
AACGGAACCTTACCTTTTCTGCAGCACTAAGGCTCGTTCCTCGGCATCCATTATCCTACG
TGGGGCGAACGATTTCATGTGTGACGAGATGGAGCGCTCCTTACATGACGCGCTGTGTGT
GGTGAAGAGAGTGCTGGAGTCCAAGTCTGTGGTTCCTGGTGGGGGCGCGGTGGAAGCCGC
CCTGTCCATCTACCTGGAGAACTATGCCACCAGCATGGTACGGACAGGGGCGGGCAGCAC
TCTGCACACGGCTCGGGGGCCCCATCCTTGGCTAGGGGCACAGCCTTTCTCTTCCTAAGA
ACATTGTCTTGTTTTTAGGGATCTCGGGAACAACTAGCTATCGCAGAATTTGCGAGATCT
CTTCTAGTTATTCCAAACACTTTGGCGGTCAACGCAGCTCAAGATTCTACAGATCTAGTT
GCAAAGCTGAGAGCCTTCCATAATGAGGCCCAAGTCAACCCAGAGCGCAAAAACCTGAAA
TGGTGAGCATGTCCTACCTGCCTCATCCTGGCCAGTGTGTTGTAGCTTGCTTTGGGTGCC
TGAGGGAGCAACTCGTCTCTCCTCTCCCTGCTTGTCACCTGAGGATGGTTCCAGGGAGAT
TGACTTATGGGGATCCATGTCCTTTACGTGGTTTTTCACATACAAGTTGGCCTTGTTTTT
CTATTGTGATGTAGGTGTGGAGTGGAGGTCTCTAAGATTTTGGAGACAGAAACTGGTACA
TTGACCTGTTTCCAGAGCCCTACACATGTCTCCACTGGCTCTTGTTTTGGGGGATGCAGT
GAGGCGAGCAACCCTGTTGCTGCCGTTGTTCAGTTATGTTTAGAAATTATTTTCTAGTCC
TTTCTACAATATTTCCAGTGCCAACTTTCTCCTAAACAGCTACTTCAGAAGTTTATTGTC
TGTCCCATCATTTCCCAAGTGAATTTTGAAAGACATGCGGAGAAAGAGCTACTTGCTTAT
TCCTCTTTCCCTGGTGTTCTGTTTACCCTAAATACAGGATTGGTCTTGATTTGGTCAATG
GTAAGCCTCGTGACAACAAGCAAGCCGGTGTGTTTGAACCAACCATAGTTAAGATAAAGA
GTTTGAAGTTTGCAACAGAAGCTGCTATTACCATTCTTCGGATTGATGATCTGATTAAAT
TACACCCAGAAAGCAAAGAGGATAAGCATGGAGGTTACGAAGATGCCGTCCACTCGGGCG
CCCTTGATGACTAAGCCCACTTTTATTTATGACCATATTAGACACCCCTGTCCCGTATCT
TGCGTGTTACACATTAAAAGGACAACAAGCTGACAGGCCTTGGTTCTTGACTTGGGGGGG
GGGGTGTCCATCCTCACCCGGTTCTGAGAGGTTCAGAGCAGAAGTGCACGCTGACTCAGT
GCCGTGCGGGGGCTCAGCCTCTCTGAACACACATGGCTATTCCCAACCCGCCCCCGATGC
ACAGGGTGTTGACCCTTCAATGAGCCCCCCGTGCGCTCCAGAGTGTACAGCAGGGTGACC
GGAATCCAACAGCCAGATGCACCCAGGGGGTGGCCCAAGGCAATCACTCCTTGCCTTGCA
TGTTCACCTGAGGGGGAAGCACACGAGATCCTTCTGGCCCTGCACAAAGGGATCCAGCCC
CGACTACTGTCTCCCCACACACCCCTCACACGGGAGGCAGGAAGGAGCCCCTCCAACCGT
GCCGCTCACCCTCTGGCCCTCTCACCCGCCCGTCACTGTCCTCGCTGAGGACACCTGTGT
CTTTAATGCCTTTAGCTTGCCTCCAAGTAAGGGCATATTTGGTTTTCAATGCACGAGCAT
TTTAATGACAAAGTATGAGATTTTTCTGCATTTATTACTAAAGCAACCAACTTATCAGCT
CGATCATTGCCTTGAACTAAGGGACCAGGAAGACCCATATGAGTTCACATATGAACAATG
TATAAAGGATGTTTACGGTCTCTCGCTGCAAATTTTTAAATCAAGAAACAAGCTCAGGGG
CTGGAGCAATAGCACAGTGGGTAGGGTGTTTGCCTTGCACGTGGCTGACCCAGGTTCGAT
TCCCAGCATCCCATATGGTCCCCTGAGCACCTTCCAGGGGTGATTCCTAGTGCAGATCAG
GAGTAACCCCTGGTCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1669, 1686..1693, 1695..1728, 1730..1794, 6901..7000, 7003..7075, 7566..7689, 7990..8182, 8284..8447, 8963..9179
1001..1669, 1686..1693, 1695..1728, 1730..1794, 6901..7000, 7003..7075, 7566..7689, 7990..8182, 8284..8447, 8963..9176
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved