Sorex_araneus Locus ENSSARG00000006017
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000006017
Sorex_araneus
ENSSARG00000006017
GeneScaffold_1637
SNORA67
5763..5905
7399
GCAAAGGGATTACTGCCTGCCAGATCTTGAAACTTTTTTTTTATATATATATATGTAGA
TATATATATATAAATGCCACGGTCCTGCTCTGGTCAATAAAGGATCCTTTGGAGATACAT
AGTGGTGGTCTTCCTTAAGGGGCTTCATACTAGTGAATACACATACACACACAATCACAG
GCTTTCCTCCTGCTGCTACAGTTAGCCACTATTTGGGGGGCCTTCCAGACTTTGGGGCCA
CCTTTCTGTCCCCTACTGCAGTGTGGACACTAAACCTTCATTACCTTCTTAAAAAATTCT
TCCAGACCTGGAAGCCCAGAGAGAGAATAGGTAATCTCTAAAGGAGTGTAAGATGCTTTA
AAAAAAAAAAAGGAATACAAAGAGCTGACAGTTCCAGATGCACCCAGAAGTAGATTATTC
CATCCTTCGACTCAGAATGAATTCTCCTAGGCCCTGGGATAGAACTGCTGTTGCAGTCAT
CCCTGGTACATTTGAAACATGTCGGGGTTTGGTCCTTATCCTTGCAGCAGCTGCAGAGAA
TAAAATAAAATGTGGATCCTGTGGAGACCTGGAACAGAGGTAAGAGCAAAGTGGCAATTC
CGGGATCCCGGAAGTCCCTGAATGCTGAAACCTCGCCCCCTTTGCGTGATAGGGCCTACT
AGGACACATGACTAGGGCTCCAGCGCCTCCGCACGTGTGGGGTACAGAGCCCCAAGATGG
CTGCCAGGCGTCGAGGCCTGACTCTTGTATGTCACTTCCGTGCCGGCGAGAAAGGCGGGC
CCTGTAGCCAATGAGGATACGGGGCGGGTCTTCGCTGTGATAGGCGTTAGTGTTGTCCAG
TGGTTACGGCGTGCTGGAGTTCCTACGAGCCAACGTCACGTCTAGTTGCAGCGCGTCGGC
AGGCGGGGCCGAGGCGCCCAAGCCAATGCGATGGCTGGGGCGGGGTCGGGCCCTCTATAA
GTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCGAAGGATCATGTCTGCGAGTCAGGATT
CCCGGTAAGAAAAGCATTTGCAAGAGGTAGTAGCTACCGACTCTGCCGCTCCCATCCGCG
AGCCCCGCTTGGGTGGGGGTGGGGGCAGCCGAAGCCCCCACTTCAGGCCTACAGGCGGTG
ACCAAAAAACCAAGACGGGAGAACCGAACTGGGAAAGGGAGCGGGTAGATCTATGACGCT
AGTACCAGCGCCTGGGCAGAGGCCAAGGGGAGCCCAATCTCGGGGCCTTGCGTGGAAGTT
CGTTAGTAGGCCCCGATGCGGTCTGTGAGGCCCAGGCTGAATGGCAAGATGAAGTCGCAG
TCCCGCGTGGGAAGGAAAGCTTAGGGGGCCCCTAACAGGGGGCCCGGAGCCGGCAGGTCT
GGTTGCCTCACTGCCGGAAGAGGGGCTCGGCGCGCGCTCGGGATTCCGGAGGATTCTGGC
GCTACCATTCGCCGCGGGGGGGACAGGGTGCTTAGGTCCTTAGGTCCAGTTGAGGGAGGA
GAAACCGGCCGGTTTTCTTGACGGCCAGGATACAGGCTAACCCTGAGCAGAGCCCGCCGG
GCGGGCGGGTCCATTTTGCCGCACAAGCCGGGCAATTGATAAACTGCGGATGGGCTGGTC
CACTTTCTGTCGGGGGTGAGCGGCCTGAGATACTGGAGGGCGACGCCATTTCGCGATGGG
GTGGGCGGGATGTGGATTGTTCGATGAGGTGGGGGCGCCGCTGGGTGGTCGAGGGAGTGA
GCACATGGCGGCCGGAGATTTTTTTCCCCTCCCCCAGTCCGCTTCTCTTCTAAGTGTTGT
GCAATCTCCCCCTTTGCTATTGCGGCTGGGGCTCATTGTGCGCGAGGCCGCCACCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGTACTTCC
GGCGATTTCGGGCCGCGGTGGGAGGTGCATGTGCTCTGGCTTGCAGCGGCCAGCAGGCCG
GGACACGTGGGCCCAGTGGTAGGGATTGTACTCGGGCTGGCAGCACTCTGCCGGCCTTCG
GATCTTCTAGGAGAGCTCGTTTGCGGTGGCTGGATTGAGTTGCTGCCGATAGCGAGCAGC
GGCGTGTCCAGGTGTTTTGGTAGAGGTGGGAGTGGGGGAGATTGGCAGCCAAGGCTGGGT
GCTGGAAGGATGGATTGGGCTTATATTTCTAATAGCGTGCTGATACCTTAAATCAACAGA
TCCAGAGACAATGGCCCCGATGGGATGGAGCCCGAAGGTGTCATCGAGGTGAGATTCGAC
CAATCCTATTGCCATTACTTTTTGGGAAGGGCACTATTTCCAGGTTTCTAGAATGTTAAT
TTATTGCTTTGAGTTAACAGAAATTTGAGCTGAGTTGCAAAGCAAACTGAAACTTATTAC
CCTTTCTACAAGATTCACTCCTGAGTAACTTTTCCCGTATTAATTCTGCAGCAACTTGAA
CTGCTAAAAATCACCTAGGCATTGGTGCTTGGCCCCTTAGAGTGACAGATAAACAGCTGA
CCTGGAGGGAGAATGAACTCGACTTTCGGTATATTTGCTTTGGTCTGGAATCAGCTTTAT
CTCTTGAAATTTCTTTGCACCCTTACAGAGTAATTGGAACGAAATTGTTGACAGCTTTGA
TGACATGAACCTCTCTGAATCCCTCCTCCGTGGCATCTACGCCTACGGTTTTGAGAAACC
CTCTGCCATCCAGCAGCGAGCCATTCTTCCTTGTATCAAGGGTGAGGTCAATCAGCCATC
AACCCTGGGGCTTATTTTTGGACTGTGCCTGTTGATAAGGCATTTGGTCAGTGGTATACA
TCTCCTAGCCAGGGACAAAACAATTCCTTGTTTGTCCCACTTCATTTTCCCTATCTTCAT
GTAATTTGAGCCTTCTGGATCTGTTTTCAGTGTCATCTGTGTTGTGGCAAAATGAAAATC
TTGTTAACTATAACCTGTTAGCTACCTTGAATGTACTCTGATCCCAAAATATATGCTCTT
TATCATACCGAATTTCTCCCAATTTGCTTAGGTTATGATGTGATCGCTCAAGCCCAATCT
GGGACTGGGAAAACGGCCACTTTTGCCATATCAATTCTGCAGCAAATTGAACTGGATTTA
AAAGCCACCCAGGCCTTGGTGCTGGCACCAACTAGAGAGTTGGCGCAGCAGGTGAGTGGC
TCCCAAAGGACTGATGGCACAGATTACCACATTATGAGGGGTATGCTCCAGAAAGGGCAA
AATCAATTGATGACTTTAAAATCTGTAGATTTCTAGGTTAATTATTATTACAAGTTGTCT
TCCCCAACAGAACACATAGTTTCCACAACCCATTTCTGACTTGTGTCAGATAGAAAGCTG
GGTGGGAACCTGGCTGCTTGAACAACTTTCTCTTTTTTTTTTTTTAATAGTAGATGCCTA
AACCCCCTGGCAATGGGCAAAGAGACATCTCATTGGTGGTGTTGCTCTTATATCTGTCAG
GGGCAAAGCAGTTGTCCTTTGTTCATCCTAGCTTGATGCCTGTGTTGGTGGCCAGAGCTG
TTTCATGCTTGGGGCACATAAATTTCTAACACTGAATTATATTTTGTTTCGTTAAAGGAG
AAAAGGTAAAATCAGATGTCTCTAATAGAGTATGCCTCAGTGGGTGTGCTTTTTAAATGT
TTTCTGAAGGTGGTCTCTTTCTGAAAAGTGCGCGTTCTACCTACTAAAGGTCTTTGGCAA
GAACAGGACAGGCTTAGGTCATCTACATGAAGCTGGTTGTTATACCAAATAAATGGTCAT
GCATAGCTTGGGGAAAGTTAAGTGTGTGTCTATTAAAATATTTCGGATGCTGTCACTGTG
GAATTAGTATGAAGATCAGGAGTCTTAACTGCATTCCAGTCTTAAGTCTGCCACTTACAG
GAAGTGTAATCTAAAAATAGCTTGGATGCTTGACCTGGATCTCTAAAATCACTAAAAGTG
ATTCTTAGTGATTTTTTTTTTTAATGTAGCTGGGGCTATGACTGGAGACTTTCCTTGCAT
ATGTGAGTTGCCCTGGGTTTGGTGGCTATCACCAAGAGAATAATGGTGGTATCAGAGTTG
TAAAGTGTATATAAAAGAGTGTATAGCATAAAAAATGGACTTGATACAGTACCAGCTGAT
AGAAGAGCATTTCTTTTCCTCTGGATTCAGATACAAAAGGTGGTCATGGCATTAGGAGAT
TACATGGGTGCCTCCTGCCACGCCTGCATTGGGGGTACCAACGTGCGTGCTGAGGTGCAG
AAGCTGCAGATGGAAGCGCCCCACATCATTGTGGGTACCCCAGGCCGTGTGTTTGACATG
CTTAACCGGAGATACCTGTGTGAGTATCTCAATTTTCTCATCTGCATCTTCTCCCTTTTC
TATACTTTACCAGTCATTCTATTTGACCACCCTATCACAATGATGCTAGTTAATCTTGCT
CTGTGATGAATCCCATGCGTGTCATCTGAGCCTGAAATCCCTGAGGTCTCTGCCCGGGTA
GTGTTCTACTTCCTAGGGTTAGTGTCTAACCTTGCAAGGGGTCTTCAGGCAGAGGATCAG
TCTTTGTATTCTGAGAGCAGAAAACTTGGTGTTCTACCTTGTTGACTGCATTTCCTACAT
TTTTCTGATCACTAATTTTTTTCCCCTATAGCTCCCAAATACATCAAGATGTTTGTGCTG
GATGAAGCTGATGAAATGTTGAGTCGAGGATTCAAGGATCAGATTTATGATATATTTCAA
AAGCTTAATAGCAACACCCAGGTGAGGAAGCTATTTCGATGATCCCTACAGTGAATTATG
GTTTATTTGTATTAATAGTGGGATGTCCATGTTCTTGGGAACCCAAAATCTGGAATTGTG
GGACTCTAGCAAAAGGACCTGTCTTAAGATGCATGTGGCTGCAAATTTGATCCGTTGTGC
CCACCTACACAATGATTCCCATAGTACGCATCAGAGTCAAGTGTGTACAACTCCTGTCCC
ACTGTTTGGGAGGATTCTGGTGGAATTTTACCCTAGGTCCATGCATTATGCATTTTGCTT
TAGGTGTGATATGGGAAAGTCTATACCAGGAAATACCTCTCACCTTGATTTTTCTCTCCA
GGTGGTTTTGCTGTCTGCTACAATGCCTTCTGATGTCCTTGAGGTGACCAAGAAGTTCAT
GAGGGACCCTATTCGAATTCTGGTCAAGAAAGAAGAGTTGACTTTGGAGGGTATTCGCCA
GTTCTACATCAATGTGGAGCGAGAGGTGGGGCCTGGTGCAGGAGGCGGGCCTTGGTAGTT
AAATGTTGGGTATAGCCCAACTGATTTTTCTTCCCCAACCTTACATCCAGGAGTGGAAGC
TGGACACACTGTGTGACTTATATGAAACCTTGACCATCACCCAAGCAGTCATTTTCATCA
ACACCCGAAGGAAGGTTGATTGGCTCACCGAGAAGATGCATGCCCGAGATTTCACCGTGT
CTGCCATGGTGAGTTTGCCCACTCCCTTTGATTCCCACAGAGTTGGGGATAGAACTCAGC
TTAACACTGACTTAACTACCCTACCCGGCTTTAACTAAATCTGTTTCCTCTTCTAGCATG
GAGATATGGACCAAAAGGAACGAGATGTAATCATGAGGGAATTCCGCTCTGGTTCCAGTA
GAGTATTGATTACCACTGACCTGCTGGTGAGTGGAGGGAAAGTGGGGAGAATTTTAAGGG
GGAATCCAAGGTGATTCCCTCTCCTAGGGGCTTGTTTGTGCTCCTCCTTAGGAACGTAGC
AACTTGGAATAAAATCTGGCAAGCCTCAGGTCTTTGTGGGAGAGGGGATGTTTATTTCCT
CTACCTGCCTTTGGCTGCCTACATGCCTATGGAAGTCTTTTGTTAGATTATCCTTTTAAC
ATACTGATGTCTTCTCTCTTTTACCATAGGCCAGAGGCATCGATGTACAACAGGTTTCTT
TAGTCATCAACTATGACCTTCCCACTAACAGGGAAAACTATATTCACAGGTAAGTGAGAT
CTCATCTACTTACCTGGTAATTGGGCCCAAATAGTCCCAGGCCAAAACTTTTCCTGTTCC
TGTTTGGGTGGAGAGGAGCACACAACCTTATTTAGGGCAGAAAACCAAATCTGGATCAGG
TACACATAAGGCAAGCATCTTAACCTCTGTAGGATCTGGCCGTGATTTCCCCCATTTTCT
ATTCTTGTTTTCCAGAATTGGTCGTGGTGGACGTTTTGGGCGTAAGGGTGTGGCTATCAA
CATGGTGACAGAAGAAGACAAGAGAACTCTTCGAGATATCGAGACCTTCTACAATACCTC
CATTGAGGAGATGCCTCTCAATGTTGCCGACCTCATCTGAGAGGGCTGTCCTGCTCTGAG
CTCTCGCCAGGGCTCTGTCCTGGGAGGACCTGAGAAGAGCAGGAGGGGGGAGGGGAGGGA
GCCAAGGGATGGACATCTTGTCTTTTTTTTTTTTTTTTGTCTTTTTTTTTTTCTTCCTTT
GAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGAACATTTTAGAAACCCTTTTC
TTTGGGGTAGGCTCTTGCCCCAGGCGCCGTCTCCTCCAAAAACACTAATACGTGTCCCTA
ACCTAGTCAACCTCCAACCCCCAGAGGCTCCCCACCCTAGCCAAATTCCTCTGAAACGAA
CAAGGGGCTATAATCTTCTATAATCGACGCAACCTCATTTGCCGGACCAAATCTGAAGGG
AGAACCCCTGAGCTAGGTGGCCCAGAGGATTGTCCTCAGGTGTGGGGGGAGCAGGGGAGA
GAAAATGGTAGCCATTTTTACATTGTTTTGTATAGTATTTATTGATCCAGGAAACAAACA
CAAAATTCTGAATAAAATGACTTGGAAACTGCCTGTTTGGGCTTTTCATTTCTTTCCTGC
CCTCTCCCACCTGCCACTGGACAGATCTTTGTTCCCTCTTCAGCTACTAATGGCATGTTG
CCACCTAAAATGGGTGGAGCAATAGTGCAGGGGGTGTGGTTCTTTCCTGGTACATGGTCA
ATCCTAGTTGGATCCCCAGTACCCCAGGTGATTTCCCAACCTCCACCAAGAGTGAGTGCA
GAGCTAAAGTATACCCTAATAGGGTCACCTTTCCCCCCTGAGAAGTTAACTGGTAAATAC
ATGGTTGTGTAATACTGAAAGGGCTTGTTTTTGAGCACCATCATAAGTTACCTTCAAGAC
TCAGGAAGTGATGGGCATGGGGGGGCAAGAATGATCTGTTAGCATTTACCTAGTATTTCT
CAAGATCACCTTTAATGGCCTATGGCTATGTAATCATACTCTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTGCTTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2279..2327, 2668..2800, 3091..3230, 4230..4398, 4711..4820, 5161..5304, 5390..5527, 5636..5725, 5969..6048, 6255..6399
1001..1023, 2279..2327, 2668..2800, 3091..3230, 4230..4398, 4711..4820, 5161..5304, 5390..5527, 5636..5725, 5969..6048, 6255..6396
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved