Sorex_araneus Locus ENSSARG00000011260
snOPY snoRNA Orthological Gene Database
Sorex_araneus ENSSARG00000011260
Sorex_araneus
ENSSARG00000011260
scaffold_233692
SNORA5
6300..6433
8235
GGAAGGGGAAGCCGCCTAAGGTGCCTTAGTATGTCCAGGACCAGAACACAATCTGGGAT
TTGCAATCCTTCCCGGGCAATGTAAGAGCCTGTGTATTTTTTTAAAATTTATTTCTTAAT
TTTTTTATTTTCTGGGAGATCTTATGGTGATCAAGTATCTTTGTTTCTCTGCTCTTAAGA
CACTTCTCCAGGTCTGGATTCTTAAGGAAATGATTAACGGGGCACTTAAGGAAATGCAGA
ATAAGTCCATTTGCATTTTCGTCCTTGCATTTTCCACATAGGGTGAGCAAAACCGTCTCG
AGCTAAGTTGGTTTAATTTGGGGCCCACGTGGCGGGAAAACGAAGAATCCCATTTCCCTG
CATCTACACGCGTTCACAGGTGAGCCCTACTTATCGTTCAGTTTCACCTGCAAAGGAAAC
GCCTTTTTTTAAAAAAAATTATTTTGAGGCCACACCCGTCGTTCCTCTTGGCTCTGCACT
CACGAATTAGTCCTGGCAGTGCTTGGAGGACCCTAAAGGGTGCCGGGAATTGAACCCGGG
TAGGGCACGTGCAAAGCAGACAGTTTATCTGATGTTCTACCGCTCCGGCCCCTAATACTT
TTATTTTTGACTTCCGTCTCCTTCCCTGGTTTTTCTCAGCATGCTGCCCCTAGTGGATTC
GGCTCGTTCTGCCCACTGTCAGGGAACTTCATCTTTCTCCTGCCCGCTTGCTTTTGTCTC
TCACGGATTCTGAGACAGGAACCCAGCGGGAAGGGGGAGGGGGGTGCCTGGGGATGGGGA
GGGGGGGGAGGAGCTAGAACACACTACGCATGTGCACTACCGCGCCACCGCTTTGCCTCT
TGGGTAAGGCCCCGGCCGCTTCCTTTTCCTAGAGCGGTGACTCTCGCGAGAGTTCCTGCC
GGCCGGAAGCCGCTGACGAGGTCTGGCGGGCCTTTTCAGCTTCTCCTGTCGCCGCTGCCG
CTGCTTCTGCCGCGTGTCCCGGGACTGGCGGTCGGCGAACTATGACTTCTGCCCTAGAGA
ACTACATCAACCGTATCCTCTGGTTGCCCGCGGGCCTTCCGTCGGCAACGCGGCGGCCTC
TGCGCGCCGTGCCCTAGAGCCGAGGGGCTGAGCTCGCCGGCGCACGGGGCGCACGGCCGC
TGCGGGACGCGGGTTGCGCGCGCGGGGCCGCCGCTGGGGAGGGTCCGGGGCCCGGCCCTG
GCGGTGCCTGCCTCCCCGCCTCTCTACTCCCCACCTGCAGTGTTGCAGTTAGCCCGGGTT
TCCTCTGCCGCTGGAGGTGAGCTCCTGGTAGCCGTCTCGGGGGCCCTAGGCGTGGGAGCC
TCTCGTTTGAGAACGAGACGGTCAGGTGTGTGTGAAACCATGTGCTTGTCCTACCCAAGG
GCTTTTGCTCCTTGGGCCAGGAGAGCAGGAAACTTCCTAACTTCCTAACGAGATGGGCCA
CCGTTGACTTCGTGAAAGGCGCATCCTTTTTGTTAACTACGGTGAACACGGCAGACAGGC
TTGGGAGGTCGTGGGAAATCCGAAGTAACCCGTGCAAATGTTAGCTTTTAATTTTTTTTT
TTTTTTTTTTTTGCGTTTTGGGTCACACCTGGCTATGCACGGGGTACTCCTGGCAATGTT
CAAGGACCATATCGGATGCTGGAATCGACCCGGTCGCGCGTGCCAGGCAAACGCCTTACG
CGTGCTATTTCTCCAACCCAGTAGCGTTTAGTTTTTAGTTTCTTTTTTTAAGGGTTTTGG
GCCCACCCGACAGTGCACGCTCGGTCTGCCTCTGGAGCACAGAAACGGTGCCTGGATTAA
AAGTCTTAAAACTAATTTCAGATGAGAAATAAGACTTAGGAAAGGGAGCAATGTTGTTGT
TCAAAGCCTTTTTTTTTTCTCCTTTTTTAGGGTGGCTTTCTTTAGGAAATGTTATTACCG
CAAAGAAATGACATATTTAAAACCTTTATTTAGTGCATGTCGCGACCGTCGAAAAGCTTT
TTCTTAGTTCTCCCTCCTTTTTCTAGTTGTTCAGACCATTTCCCTACCAGATCGGTAAGT
TTTGAGAGTCCAGCTCCTAAGAACTGCTTTCCTTGACTTGCCAAACAGGAACGGTTGCCG
TGATCACGTCTGACGGGAGGATGATTGTGGTAAGTGCTTGGCACTTTTCACAGGCCTGTT
CGAAAAATTTTGCCTAAAGCCTATGAATTCCTGTGCTGAGGCACCACAAAAAAAAAAAAA
TCTCTCTTGCAGTTTTCATATAACTCCCGTCTTGATCTCTTTGTTAAGCTGTAGTCAGTA
CATATGTTCTGCGTTAATAAACACTGAGTAATAAACATGCAAGGCATCTAGGCTAGTAGG
GTCTAAATTCAAGGAGTTCCTGTCCACACAAAAAAAAATACAGATGTTTGTGTTTTAAAC
TCCTTCCATTTTTAATTTTGTCTTTTGGGGCTACACTGAACGGTGTGCAGGGTTTACTCC
TGTCTACTCTCAGGGATTACTACTGGAGGTGTTCAAGGGGACCATATGGCAGGACACATG
CCAGGGATTGAACAAGGGTTGGCTGGCATGCAAGAAAGCACCTTAACCAGGTACACTACC
TGCCCCCTACCCCATTTTAAAATTTTTTCCCCATTTCCGTGTTCAGACATTCATGATATT
AAACATTTAAGTTTTCAATTTTGTTTTTGCTTCTTAGGAACTTTTATGCCCATTGTAAAA
TATGGACATTTGGAAATATTTTAGTATCTTAATGCTTCAAGAAGCCTATTGGGAGCAACA
CATATTTGCAGATAGTTATTTTGCCAAAACAGATTTATTTTATTTTTATTTTTGTTCGTG
AAAATTACTTCTGATTTTATACATTTTGATTTTCAGAACTTAGAGATTTTTAGTGAGTTA
AAGCCAGTACAAAGGTGGTGTGTATTTCTTCAGGAACCTGGATGGTATCTGAGGTTGTAG
TATAGTGACTTCCTTTATTTGAAAAAGGAGTCATAAGAACTTTCTATTGGGGCTGGAGCA
ATAGCACAGCGGATAGGGCATTTGCCTCGACCTGGCCGACCCGGGTTCAATTCCCAGCGT
CCCATATGGTCCCCAGAGCACTGCCAGGCGTAATTCCTGAGTGCAGAGCCAGGAGTGACC
CCTGTGCATTGCCGGGTGTGATGCAAAAAGCAAAAACAAAACAAACTTTCTATGATTATT
TCCTTCAAATTCTGAGTAGGGTTGGGGAAAGGAAGTTAAACTGAGTGAAAGCATTGCGTT
TGTGAGGTCCTGGACTTGGCACTGCAGAAACACTCTTGTCACACAACAAATTTTTTTTTC
TAATGATTAGACCTGCTTTACTTTGTGATTGGGAAGATTAAGTAAATACACGTGATATAG
AACACTGGCAAATAATAAATGCTCATTTAAGTGTTTAATATTTGTGTTTGTATATATTTG
TGGGGACTTGTTTGAATATCTGAGAAATGGTAATTATATTTGTTTTTTCATAGAATGGCA
AAGTTGTCTATAGACTTGAGTCTAAAGTTGTTGTCTTTGGGTGGAGAGGGGTTGCCCACC
CAGCAGTGGTCAGCAGTTTCACCTGGCACTGTAATTAAGAATTACTCCTGGTGGTGTTCT
GGGGGTCAAACTGGGTGTGCCACCTTCAAGGCAGTTGCCCTACCACTGTAGTATCACTTG
CATCTCTACAGCTAGTCTTAAAGTAGGAGTAAGTATATCTCAAAGATAGGAACTAGTTGA
AATAATCTGCAGTATGCTTAGCATAAAACCAAGTGCTAGAGTGCAGTGATAGGTACATTG
CTACAGGTAACATGTATTCCTTTACAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGGTTGTACATCGTAAGAGGTGACAATGTGTAAGTAATCAGTCTTAC
TAAGGCAAGTTAAATATGTACCATGTGCTACTGTCCTGCTATTTGGAAAGAAGGTTTTAC
TGAAAATATCTTAATGTCCTCTTCAGTTATATAAGAATTAGTGTATTCATTCGTTCAATA
AATTTTTTTCTAAATTTATTTAAAATAACAATGGATACTTTTATACATATCTTTGCTGAT
ATTTAACCACATTTCTGATATTTAAGTGGCCTGCTAGGCTCTAAAAACAGGTTTAAACTT
CATTGGAGAACTTTCTTAAAATGTTCTTCTAAAAGCCCACTAATTTTAGAGAAATAAAAA
TAAATGCAGGCTGGACCAATAGCACAGCGGGTGAGGCATTTGCTTTGCCTGCGACCCACC
CGAGTTCGATTCCCAGCATCCCATATGGTCTCCTGAGCACCGTCAAGAGAAATTCCTGAG
TGCAGAGCCAGGAGTAATCCCTGTTCATCGTGTGTGTGACCCCAAAAGCAAAATAAATAA
ATGCAATGCAGCACTCAGTTTGAGATCTCATGTGAGCAGTTCCAAATAACTCAGCAGTCT
TTATAAGCAAGTACTAAGCTGTTATTTTTCTTTTGAAAAAGAAAGGAGTAGGGCTTATTA
AATTTTATCCATTCAAAACCCATCTGCTCCTGAGAAAGTTTTATGCAGCCCTGGGTATAT
AGGCATATAAAATATATATATTAATCGAGCTATATTAATAATAAATCACAAATGTATTTT
GTATCATAGCCCAGTTTGGAGTCATGAACCACTATTTATGAAGCTAGGGTTTAGTATAAT
TGTCATAATACATAAGCTGTCCCTGGTTATACTGTAGCTTTGGATAAATTGAGACATAGT
GGTATAGCAACTTGAGATTTTAGTAGCAACTTTAAAGCCTACAGATAGTATAATACTATC
TGGTTTTTGCATTATATTTAAGATATTCTATATATAAAATACATTTCTGCATTATATATC
TGCATAGTAGTAGTTAACTAGCAATGTAAATGTTGAGTACTTGAAAAGTGACTGATAACT
TTATTGCATTTGTAATTTTAAGTCACATACAGTGAATAGCTGCTGTATTATAGCATATAG
TATACTAGAAAATGGATGGTAAGGTAGCAAAAAACATTTTAATAAAATGTTTGTGGTGGA
CAGGGTATAGAAAAGAAAGCAGTGCTTTAAGAAGTGCACTTTCGTACCACCTTTATGTGT
CCAAATTATTTGACTTTTTGTCAAGATTATACTGATAAGTATTAGAGATGAATTGTATGT
GAAGTTAATAGGTGATAGTTAAAAACAAAGTTTTTGCAGATGCAGCCCAGGAATCTAAAT
CAACTGTATCACTGTCATCCCATTGTTTGTCCATTTACTCCAGTGGGTGCCAGTAAGGAC
TCTTATTTTGTCCCAGCCCTGAGATTTTAGCAGCCTCTCCTTACTCATTTTTCACGATTG
GAAGCTGTTTTCAGGGTCAGGGAAATGAAACCTGTTATTGTTATTTGGCATATTGAATAT
GCCACGGAGAGCTTACCAGGCTCTTCTGTGTGGGCGGGATACTCTCAGCAGCTTGCCGGA
CTCAGCGCACGTGTGCCTGTGTGTGTGTCTGCACTTAGAAATTACCCCTGGCGGTGCTCA
GGGTACCATTTGGGATGACGAGAATCGAACCTGGGTCTGGCCTCATGCAAGCCAAATGCC
CAGCCCGCTGTACTATCGCTCCAGTCCCCCTCTTTAACTTTCTTAAAGCTTTAAAACAGT
TAAAAATTGCATTAGATCCACTAAGGCTAACTGGTAGACTTGAAGGTGAGTTTTGTAGTT
AATGTTATTGGTAATATTTGCTCCATTTGAGATCAATAAACTGCAAATTGGCCTTTTCTC
AACAGAGTCAATTTTTAAATCTTCTGTGAGAATTTTAAATGACACTATATTTTAAGGTTG
ACTTGAGATCTTTGTTTTATGTTTAGAAAACAGTACATACTTAGTACATACTGCCAGTTT
GTTGCTTTGCATTTATTAGAGAGCTAGATGCTTTATGTAGCTTAGGCGGGCAGTGTGTTC
TGCAGCTGTGTCAAATTCAGTGCCTGCCCAACCCATGGCAGGCACTGGCCCAAAAGGCTG
CCACAGCAACATGTGACTCATGGGCCCTGATCCCCTTCTCTGGGCCTCAGGGATAAATTT
GGTTACAGACATTAATAAAATCAGGCAGATTTCTATATTTATTTGTAGCACGTGCTCTCA
TTAAACACAAAGTTGAGCCCAACAGATAGCCAATTTCTTAAGTAATGTTTTATGTGTTTT
CCTTTCATTTGGTTGTAACAGTTACTGTAGCTGGAGTCTGGGCCCCTTGATTATTTAACA
TGGTGCTAGTAAAAGTAACTGAAAACTATAAATGTTGAATTGAAAAACGTAATGACTTTT
ACTCTGTCCGGTTCATGAAAAAGTATTTTCTGGATGGATAGCTGTTCTACTACTGCGGGG
TGAGGGATCCAAACCGGTTTGGAGTTTTTGGTTTTCTTAACCCACATGTACCATCATACA
TGTCTTTTTCTTTTTTTTTTTTTTTTAAACCTTATCCAATCACTATACTCTGTTGTGCAA
TGATGATGTTTTTAAATGTCAAATAATTTCATTCTCAAATAATGTTACCACTCTCTTGGT
TTGCGAGCCTGGCTATGATCAGAGCTTACTCTGCTTTATTGCTCAGGGATCAGCCCTAGC
AGGGCTTGGGGGACATTGTGGGGTGCCGGGATTGGACTCAGGTTGGCAAGCACCTTACTA
TACTGTCTCTGGCCACAGCTTCCCTTTATTTTAGGAATATTTTTAAATATCAGTTAAGTG
CCCTTCACTATCATGAAAATGTTTTTCACTTTTATTATTTTTTACTGTGTTCTTTCATCA
GCTTTATTCGGGATTGATGTTTTAACTTTGTTTCTCACATGACAGCGACCGTGATTGGAG
GAAACTGATGACGAAACAGATTCTGCCCTCGACTTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAAACTGAGTATTCTGAGAATGATGTG
CAGATTTTTAGGAGTCCTTTAGGAAATGCTATGCCCTTAAGATATTTCTATGTCTTGAGA
GAAGCATATTTGCCTAGTCATAGGTTTGGTAGGTTGGTTTTATTTTTATATTGAATAGTG
TGAAAAATATTTTGGAAAGGGTCAGGAATAATATCTCATATTTCAATATTTATGATAATC
TTGTAAACTTAGCCTGTTAGATCAAGCATACAAATACCAGCAGTAGTCCAAGATACATAC
ATTTCTTTCCCTCATAGTACATTCACCAGAAGGTAAGTCTTATCTTCTGCAGTTACAAAA
ACCTGCATTTTTTAACTGAATCCCAGGATATTCCAATAAGACCACAGAAAATCATGTAAT
TGGAGGTCCTGGATAGGAAATAAGGTTAGAGGAGGTTCAAAACTGGACAAGTTCAGAAAC
AGTGATCTAAAACATCCCTACTTAGGACACCGCCCTAGGGCTGCTTATCAGTTTTGAAAT
GGGTAAGAATATATTTGGACAATGGAGAAAATGTTAAGCTATTCATCATCTGGAAGAATT
GACTATACTTTTAAAATCCCATTTTAACTTTTTAATTTTAGGAATTGCAGGATTTTTTAG
AATTGCCAGTGTTTTGTTATTTATATGTGAATAAATAAACTTGTTTATATTGAGTGTGCT
TGCTGTTATTGTTGACATCCACAGCTCAAAGTTTCCATAAACCTCACTGAAAAGAAGTAA
ACATGGGTTTTTCATTGGTTTATTACTTGAATCAGTTAAGAAGCTAATATTCCCTGCCTT
CATACAGGCTTTCTAAAGTTTGTGTACAGCTTATAGAAATAATGTCTTTTAAGTTTAAAA
TGTTGTTTAGGTACGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 2088..2128, 4114..4241, 7180..7199, 7201..7235
1001..1031, 2088..2128, 4114..4241, 7180..7199, 7201..7235
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved