Sorex_araneus Locus DIMT1L
snOPY snoRNA Orthological Gene Database
Sorex_araneus DIMT1L
Sorex_araneus
DIMT1L
scaffold_229041
SNORA36
5267..5400
11057
TCCCCTTTCCTACGGAGTCCGGGAGTCCCGGAGCGCTGCAGCGGGGAGGCGTGGGGTGA
CGGGCCCGCACGTGGTGCCGCGGCTCCGGATTTGGCTTCCTGCTCCCCTGTCGGGTCTGC
GGGGCGCCCCGCAGCCTGCGGAGATGCCGAAGGTCAAGTCTGGGGCGAGCGGTCGCCGCC
GCGAGCGACTAGAACAACGCCGGGAGCTGAAGAGCGCGGGAGGTGCGGACCGCGGAGGGT
CTGGGCACTGCTGGGTCACCGGGATCGAGGCCCGCGGGCGGACCGTCTTTTTGTTTGCGG
GGGGCTACTCCCGGATGAGCTCAGTCAAGGCTTCCTCCTGACCCTATGCTCAGGGATCAC
TCCTGGAGGAGTCGGGGGACCCTAGGGATGCCACCGGGGATCGAACCCTGACGAGCAGCA
GTCCCAGCTGTGCTATCCCTCCGGCCCGCCGACCAGGTTCTGCTCTGGGGTACCGAGACC
CGTAGGGTCTCAGCCGTGGGGCTCCCGGGTCGCGCACCCCATGTGGGACCGACTTAGAGC
TGTCACCAAATGTGACGTTTCCGGACTCTGGAGAAATCATGTTCCCAACCACGCCGCGTC
CCTGCGTCCGCACTCCAAGAACCGCTTTGACTTGCTGGATTCAGGCTGTTTTCTTGTTTT
TCTTCTAGGACTTATGTTCAACACCGGGCTTGGGCAGCACATCTTGAAGAACCCTCTCAT
TGTTAACAGCATCATCGATAAGGTGGGTGTGGAAGAGGAGAGGGATGCTGTCGATTTGTT
TTTAGTTTTGTTATTTTATTTTGTTTGGGGGCGACGCCTGGTGGTGTTCGGGGGTTACTT
TGGGCTCTAATGCTTAAGGATCTCTCTGGGGGCTTCAGGAAAAGGGATGCAGGAAAACAT
ACCTGGTGCCGGAGATCCATCCGGGGGCAGTCTCATTCAAGGCAAGAGCCCTACCTGCTC
TACTATCGCTCCAGCCTCCTGCTAGTCCCTTTTTGACTTCTAAAATTTTCTGACTTTTTA
CTATTGTCCTCATATTACAAGAAAGAGATAGTACATCTACCATTAATGAGATCATTTTAT
TAACCACATGGGTCATTTTAGGAATGTCCGAAAAAATGGGGTTAGAATAAGACATTTTAG
TTTTTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTAAAGTTACTCGAAAAGGCAAAAAAGGTAAAAGAGATTTAGTTTTTGATACCA
GAAATAAGTATGTGAGCCAGTTCACATGGTTTACAAAATGTGAATTTGCTTTGTTACGTG
TTATTTAACAGTAACTCTAAATGCTTTGTCAGAAGGTTTGTCTTAGAAAATTTATGATGT
ATCTGTGAGAACAGAAACCTCATTATAGATCCTTCCACATAGAAATTTTAATATGGTTTC
TCTGTACATTGCCTTGAGAAGTGATTCCCTGCTGTGTATCCTGGACCTTAGTGATGAGAA
AAGTGATATCCTCCTCAGAACAGTTGCTTTTTTGTCATTGCTTTTGTTTTTGTACCACAT
CTGGCAGCGATTTAATCAGATTTGGTTGGAGGCTAGTCCGGGCTCTGCTCTGGCAGAGCT
GGCAGTTGTTCTTGGCAGTACTTAGGGAACCACGCAGTGCAGGGGTTCCAGTCTGGGTCT
TCTGCATGCAACATTTGCTCTCGTCGTATTGAATTATGTACTCTTAGGTTGGGATGAAGA
GTCAGCTCAAAAATTCGTGTTTTCTGTGATTCTTAGTATATCTTTACGGTATTTTTTGTT
TCATCATCTCCTCAGTTGAGTGTGGTGATAAGAAAAGATTAAACTTATAACTATCTTTTT
AAAAAATTAATGGGGAGGAGGGCCGTGGCAGAGTATAGTAAGTAAGATGCTTGCGCTGGG
TTTGATTTCCTACACCTCATACCCACCAGGAGTGACCGCTGAGCACAGAGCAAAGAGAAT
GGCCTGAGTACCACCTGGTGTGGCCCAAAACCAAAATAAATATTTTTAAAAACTTTATTT
TTGTTTTTGGGTTCTGGGCTATATTGCTGTTCAGGAGTGATCCCTGGTAGTGCTCGAGGG
AATCATATGTGGTACCAAGAATTGCAACCAGTCTTAGCAGATTCTAGAGCTTAGTCGCTC
TCTGGCCTCAAAACTTGTACTTTTGGTATTTTCAAATTGTTGTTTGAACTTGCTTCAGTG
TGTATTTTAGGCACCATGGTTTCCAGTACTTTTCATAGTGATGCTTCAGGCATTCTGTGT
TCCAGCACCAGACTTATCACTAGAGTGTCAGCATCCTTCCACTGTTGTTTCTAGGCTCCT
CTTACACCCAACTTAGTTCTGTAGGTCAGCTCTCAGAGTCTGTTACCATTGTTTGTTTTT
AAATTTAGGTAATTGCCTGTGAACTTGACCCAAGGCTTATAGCTGAGCTTCATAAAAGAG
TTCAGGGCACGTGAGTATATATATTAGAGTTAAAATTCATTTTAGTCTCATGAAACAGTG
TTATTTTTTAATTACTTTTTTTTTTTAATCAGGCCTGTGGCCAGCAAACTTCAAGTAATG
GTGGGTGATGTATTAAAAACTGATTTGCCATTCTTCGATGCTTGTGTGGCAAATTTTGCC
TTATCAGGTATGGTTTCAAATTATTGGGGGCATTATACTGAGCCATTACATTAATGTATA
TACCGTAGCACATATTTTTTATGATAACTACTTAATTCTCCTAACAGATCTCTTCTCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGGGTTCCATATGGTTATACTTTCGACCAAAACCCTTGCATGAATTTATG
CAACGTTATAAATGTTTGTGGCCTAGATTACACAGGGGCCTGGAGAGATAGTATAATTAC
TTCTTCCCCACTGAAGAAAATACATTTATGGTTGAAAGTGACCATTTATTTTCTCTCTTT
CTACTTTCTTTTCAGATGTGCTATACTTATGTTTCAGAGAGAATTTGCTCTCCGACTAGT
TGCAAAACCCGGAGACAAGTTATATTGCAGACTCTCGATTAATACACAGTTGTTAGCTCG
TGTAGACCATCTAATGAAAGTAAGTGATCATTATTGAAGTAGTGTAACTAAACTCATCTT
TGAACATCTGGCTTGTATTACTCATGAAGAGCGTTTGATTATTAAAGTTATTTTTGACAG
ACTCTTTAATCTTTGTGATGAACAGGTTGGTAAGAATAACTTCAGACCTCCACCTAAGGT
AGAGTCCAGTGTTGTACGAATAGAGCCAAAGAATCCACCACCACCTATCAATTTTCAGGT
GAGATCAAAATACTGAGCTTTTGTACTGGAGAGATAGTATAGCAGGAAGAGCACTTGCCT
TACACACCCTGCTTCAGTCCCTGGCATCCCATGTGGCCCCCAAAAATAATTTCTAAGTGC
AGAGTCAGGAGTAAGTTATCTCTGAGCATCATTGGGTGTAGCCCAAAAAAACAAGAAAAA
AAATCCTGAACCTTGAAATAAAGGTGGGGCACCAAAGTGTTGAGCCTTATCCAGGGCAGC
TTCCCTGTTCTAGTAATTAAACTTTGGGACACTAAGGTATCAGCTGGGGAAGTTGATTGG
GTAGAAGGTATTTCTCTATGCATTTCCCTCTTAGCCTACACAAAATAAAAATGGGGGAGG
CCATCCCAGAGTATGTGCATCTGAACATTGTGTGCACACATATGGCCAAGCAACATAAAA
ATGAACCTGAATGTTCAAGCAGGAAAATGCTAATTATGATACATCCCTGTGGAGGAGTAG
ATGGAATAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACACATGAAATG
TGAGACCCCACACAGCTGACTGGTCCCCAGGATTGGAGTACTACTTGAGAAGGCGCCTCC
TAAAAATACATACAAGTGAAGTGTGCACATGTGTGTCAGCTGAATCACGATCTGGAACAT
TGTGCTTACTCTAGAAGGTTCCTTCCAGTTTTCTATGTTAAAAGACAATAATTCCTAACA
ACCCTGGGTGAGAAGTTAGTATTTTGTAAGAAAAGAGTCACCTTCTCTTTCAGGAATGGG
ATGGCCTTGTTAGGATCACCTTTGTTCGGAAGAATAAGACTCTGTCTGCTGCATTTAAGT
AAGTATTTTAAGAATTTATAATGTATAAAGGACATTGTCATAGAAAGGACTGTGGTAATT
GTTAGAATTTTCTTTTTCTGGATAGACACCGAAATCTATTTAGGATTTAGAATCTAAATT
ATAAAGATTATCTATGGCTAGACACGCTTGAAAAAAACTTTTGAACTAACTTTGAACTTT
GCGTGGCAGGAGAGTTTAATGACAAAAGTTCCCATTTGAGGAGGAGATTAGACTTTTGAG
CCAAATAGGGGTGCTGATCACACATCACCTGCCTGATTTTCCTTTGAAGAGGTGGTGTGA
TGATGAACCTCTTCCACACTTGTGCAAGATTCATGATAGTCATTTGGGACCTAAGTGTAT
ACAAGCTGATGGCTTCAAAGCTGAGGGCCACCAGGCCATACTGGTGGTGCTGGTGAGAAG
AGATGACGTCTCAGCTCAGAACTGCATCCAGGGTGCTGTGCATGCTAAGTAAGGGTACAC
CAGCCCTCCAGCTCTCTCCCAGCTCTTGATGTAATCTTTAATTTTAGAGTAGATCATTTC
TGTTGTCCGGTACCGGGATGATATAGATAGCACATTTTTATCCTACAGGTCAAGTGCAGT
ACAACAGCTACTGGAAAAAAACTACAGAATTCACTGTTCGATCCATAACACAGTAAGCAG
AAACTCTTTCCGTAATTTCAGTGATTTTTGTTGTTTTAAAATGGCACTTTATTTTCTTTT
GCCTATCATTGGGAGATCCTAATCGCATGCATTCCATGGACTTTTTCAAGGGCATTGATT
ACAGCTAACCTAACAAACTGCCAGATCAGTGCTGCTGTACATTGAACAACCTGCTTCTTC
AGTCTGCCCCCTTACTGACAGTTGTCTTCAGCCATAGATTCAGCTGAGAAACAATTTTAC
TAAAAAAATTGATGGAGGTGAGGGGTAGAGCAATAGTACAGTGGGTAAGGCACTAGCCTT
GCAGGCAGCTGACCGGGCTACAATCTCTGGTATTCCATATGGTCCACCAAGAATAATCCC
CGAGTACAGAGCCAGGAGTAAGTTCTGAGTACGTCCAGGTGTGGCCCAAAAACAAAACAA
TTTTTAGGTCAGACCTATTGATGCTCTAAGGCTGCTCCTAGCTTTGTGCTTGCAGGTCAC
TCCCAGCAGTGTACAGGAAACATAGGCAGAGGCTGGGGTGGAGTTGGGAACTGGGGGCGA
GGGGGTAATCTGCATGCAGAACATGTGACCCATCCTGAGTAATCACTTTATTAAAACTTT
AGAAATGTGTAGTATATGCACCTTAAAATAATTTGAAACATTTGCCCACCTCTGATTTGA
TTTGAAATCATCCCTTCTTGTTGCTTACACAGCCATTATAAGTTTAGTTATCATCTCAGT
CACTTCCAAATCTGGATGTTAAAATAATTATTGCACCCATAATAATAAATAATGTGGTTC
TTAGCAACTTTTTAATTTTTCCTTGAGTGTTGGGCCATTCCAGTGGTGCTCAGGCCTTAC
TCCTGGCTCTGTGCTGTGGGATCACTTCCTTGTGGAGCTTGGGGGACGCATATGTGATAC
TGGGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCAGTAACAAGTCTCACAATGGTGCCTGCTCGAGCAAATCAATGAACAATGGGATA
ACAGTGCAACAGTGTGATGTATTATGAAATTATGTTAGGAAGACTGAAACGATTTCAGAT
TCTCTTTAACTTCTCAAGTATTGCTCTGAGGACCAGGAGGCCACTCCTGGTGTATTTGGC
CAGTTAGGCACAATGGTTCTGTGCTGTTCAAGGGCCAGCAGGCCATACCACCATGAGCTC
AGGAGCTTCCTGTACTGGGCTATCCTAGGTGGGGGCGGGGACCGGATAGAAGCAGCAGGC
TGTGCGTGGACTCTGGGGCCCCAAGGGCACCATTCACCCATTACCTCTCCAGCACCTGAA
TTTTGGAATCTGGGGGGATTGGAGGCGGGCAGGAGCAGGAGCAGGAGCAGGAGGAGGTGG
TATTTGTGTCACACAAGGTGAAGGTTGGAGGCTACTCCCAGTTCTGTGCTGCTGGAGTAG
GGGCTACTCCTGGTAGTGCACAAAGGCCATTCCTGGCATATGCTGTCGACAAACAACGCA
ATTTTCTTTAAACAGGGGTCTTCTTTAAAGGGATCAAACTGAGGCAGGGTTGGCAGCATG
CAAGCACTTGACCCGGGACTACATCTTTGGCCTCCATTGATCCAGTTCTCATTGGCACAA
ATAGGCTTTCACACTGTCAAAAACAGATTGATTGAAGGTGACTAAGGCTGACTGAACCAG
GAAAAAAAAAAAAGAGTCAAGGTGACTTCATTAAAGATGTTTTCATTTATTCTGAATTTT
ATATTGATAGATAATACCAGAAGATTTCAGCATAGCAGATAAAATACAGCAAATCCTAAC
CAGTACAGGTTTCAGTGACAAGCGGGCCCGTTCCATGGACATAGATGACTTCATTAGGTA
AGTACATTTTCCTTTTTCCAAGTGTTTACAGTTCTTAACAGTGACACCTTCAGATCAGAG
ACTTAAAGGCTTTTAAGCGGTTTAAGGTGCTACCAGGAGTTATTGCATAGCACTTCCATG
GCATGGAATAGTATTTGGTGTAGAAGATGGAGGCTAGTTAGCTGCATCGGAATGAACATT
TTAAGAACAATGAAGAACAGTCTGAGCCAGGAGACAGCCTTCGTGTCCGTGTCTGCTGTG
GTGTGCGTGTGCGCTCCTCCCGTCAGCCCCTTCCCCAATGTCTGTTCATACTTAAGTTTT
TGAGTTTTTCCTTTTGGTCTTTGGGCTGCACCTGGCAGTGCTCAGGGTCTACTCCTGGTT
CAGTATTCAGAGTACCATGTGGTGCTAGGGACTGACCCTAGGCCTCTGCATGCAAAGCAT
GCATTCCAACCCTGGAGCCATTGCCCTGGCTCTCATACTTAGTCTAAATAGTGTAGTATC
TCTTCAAAGTTGCCTAATAAGTACAAGAGACAATATGTATAATTGGGTCTCTTTTTAAAA
AAAAGAACAACAATAAGCTAGTGCTAAATATTAAGCATGAAAAAGTTTCACATTAAAATA
ATTTTTCTGACTGAAGTAGTAGATACTTGTTTTTTAGATTGACACGGGTTTTATATATAC
TGCAAGTATCTTTAATTTCTGGGCAATGCAGACAAGTTTGTTTTCATTAAGCGAGTCTTA
GGAAAGCAGAATAGACTTCAGTTACACCAGTAATTTTTAATCACATAACACTTCCATTTC
CTAACTAAGACAGCCAACTCATCTAAAATGTTTATGTTCTAGAGACTGAGTAAAACCTGA
GTTTTAAAATAGTTTAAAGTCAATGATCTGACTTAGAAACCGGCAACACAGTTCAGTATG
ACAAAGAGTTTATTTTACTGGCTGACCAGTAGTACTGTTGTTTCAGATGTCAGTCCTAGG
AACTGAAAGTTACTCATAAGTACCTAACTTCCTATGGCCAGGGATGTGGCTTACCAGTAA
ATTGAATGCCTTACATGCATGAGACATGGGTTTAATCCCCTGGCATTGCATAAATAAGTA
AAAAGTACCTAGTTTCTTTTCAGACATTTTAACTCATCTTAGCCTCCTCCTGCAAGGCTT
CCTGAACATAATCTCAGATTTAACATTTTCCTTAGCTTCATCCTTACCAAATTTCAAGGT
TTTAGGCATATGCAGTTTGCAAACTAGAATATGGTAAATAAGTACCTGAAGTAAAGAAGT
AATGTCAGTGTTTAACTTGAACTTAAGAACTCAGAGAGGTAAGCCATTTATCTCTCTTGA
ATTCCAAGTCGACTGCTGTACACTACAGTGTTGAAATGGAAGAAATGTCAGTAACCTTAG
ACCTGGGATAGTGGAATTCTGAATAATTTTAACCCAATTTATTCTAAGTATACGGCTCTG
ACAAAAAGAGGTATCAAAATGATGCTTATTTGTGTACTTAACAAAAAAAGTGTGGTTTTC
ACAAACATTTATCTTATTAGCTGGAAAATAAAGCTTCAATGAGTAATATTAGGAGCAGGT
CGACTTTGAGCTTGCTGGTATGTTTGTGTTTGGGAGTTCATGGTTTAGGAACTAGGCTGT
GTTAGGGGATACAAAACTCAGCTCCTGTCTTCATCCCATTCATTTCTCATTTCAGATTGC
TACACGGATTCAATGCAGAAGGTATCCATTTTTCTTAAGTATCTGGAAACAATCTTTCAA
GTTCAAGAAAAGAAACTGGACTTATGTTTGGAGACCAGGCCTGGGATGCTCAGGGACAAT
ATGGTGCAAGATCAAACCTAGGCCTGGATACAAAGCATTTGCTCTGCTCCTTTGAGCTAT
CTCCTGTGTCCTGGATTTTAACCATTTGAGATGAACTGTTTTTTGCTTCTTTAAGAAACT
GTTCTCCCCTATTCTTGATTACTACTGTTGATCTGACATCTTAAGGAAATAAGTCAGTTT
TAAATATCCGATTATTTTTCATTTTGCTTTGTTTTTATATCATAGGGCAGGGTCCAATCT
ATATGTCACAGCCTTCATTGTTGAAGAGCCGCAGACACGCACAAGTATATACACTTAAAG
ATGCTTATCTTCTGTTTTCTATGATATACATATATTACTGAGATGACCTCCTGAGGCTTT
CAGCTCTTTAGGCCTTTGTCCTTCAAGTAGTAAGGTTAAAATTAATGCTTAACTTAGTGA
AATAGTCCCCAAGCCATTTGTTATCCATGTGTATAGTAAACATTTCTTAATATACTGAAT
TTTGCTTCTTATTCTTTGTATCCTATACAGCTTCTATTACTACCTACTCCTTTAGCGATC
CTGTAGGATCATTGTCCATATGGTTCTGAGCTCCTGCCGCTGCCATGGTAGATGAGGCAT
ATTCCTTTATAGGCATGATTCCTAGTCTGTAACGATCATGCTTGTATGTTTTTTCTTAAT
CACTTTAACAAGATTTCAAAGGGTTTTAAAAATCAGAAGTTAAAATTTCTGCCCTTCAAT
TTTTCTTGGGGTGGGGGGGGCTGGGAGAGCACACCCAGCAGTGCTCAGGGATCACTCTTG
GAGGTACGCAGGGATCATATGGCGTGCTAGGAATCAAACCCAGGTCTGCCATGTGCAAGG
CAATCACCCTACCCCCGTCTGGTCTCCTCCTGCCCTTAGGATTTTAAACAGTAAACACAA
CCAGCCATTTCCCCATTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1079, 1526..1599, 2064..2150, 3326..3387, 3470..3550, 3552..3564, 3665..3714, 4713..4836, 4963..5055, 6191..6255, 6846..6909, 9088..9194, 10873..10915
1001..1079, 1526..1599, 2064..2150, 3326..3387, 3470..3550, 3552..3564, 3665..3714, 4713..4836, 4963..5055, 6191..6255, 6846..6909, 9088..9194, 10873..10912
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved