Sorex_araneus Locus IREB2
snOPY snoRNA Orthological Gene Database
Sorex_araneus IREB2
Sorex_araneus
IREB2
scaffold_137831
SNORA27
8278..8394
27912
TTAGTACCATATTGAGTTCTTCTCTAAGAAGCCGTCTGGATATCAGAATCTGGTGTGAT
GGCTTAATATGATTGAAAAATTTAAAATAGTATTATTGAAGTAGTAACCAAGAGTAATAG
GGTTATGTTGTTTTTTTGGTTTTTGTTTTGGGGCCACACTCAGTGATGCTCCCAGGGGGC
CATGTGTGATGCTGGAGATTGAACCCGGGTCGGCTGCATGCGGTAACTTACCCAAGTCAC
TGCAGTGCTTCTGCAGGGTTTGCTTCTCTGCCTCTGGAGGACTTTGTTTCTTCCAGTTAG
GAAAGCCAAAAGTATAGAGAGTCTGGAGTTAACATGAGTGTCATTTCTGTCCCATTCGCT
AAACTGAAAATGCTTCTAAAGAAAGAAGCCAGTGCTTCTCTGGTCGTTCTGTCTGCTATT
GAAATGTCCACAGTGCATCGGCATCACTGCTTCTGAGATTGATATCAGCTCTTTCTCTTG
GATCAGATGCTCTGCCTTACTCCATTCGGGTCCTACTGGAGGCTGCTGTGCGCAATTGTG
ACGGCTTTTTAATGAAGAAGGAAGATGTCATGAACATCCTGGACTGGAGAACCAAACAAA
GCAATGTTGAAGTGCCCTTTTTCCCTGCCCGTGTTCTTCTTCAAGACTTCACGTGAGTGA
GAGTTTATTCTGCATAAAGACATTTATTTAATTCCCCTTTTAAAATCAGACTTCCGGGGC
TGGAGCAATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATT
CCCAGCATCCCATATGGTCCCCTGAGCACCGCCAGGGGTAACTCCTGAGTGCAGAGCCAG
GAGTAACCCCTGTGCATTGCCGGGTGTGACCCAAAAACCAAAAAAAAAAAAAAAATCAGA
CTTCCTGGTGTACGTATGGTGGTGGCGGTGGTTCTAATTTTGAAGATTATAGCTTTTTTA
TTTTTATAGTTTTGGGGCCACACCCAGCGATGCTCAGGACTTACTCCTAGCTCTGCACTC
AGGAATTAGTCGTGGTGGTGCCTGGGGTACTAATGTGGGATGCTAGGGATCGAACCCAGG
TCAGCTGTGCCCAAGGCAAGCACCCTCCCCGCTATTCTGCTGCCCTGACTTCAGATTATA
GTTTTTAAAATTGCCCCTCTAAACCAAAGCAGTTCATTAAAAATGGAAACGTGTTTTCTT
CTACCATTTTTAAGAAAATCATTTCTGTTTTATGCCTACTTGTCATCACAAAAAGTAAAA
GGATTCTGAAACTTACCATGTACAAAGTTGGATACTTGATTGCCCTGCTCATCCTCCTTG
TTCCTTTGGAAGGCATCCCCATCACAGTTTTCTCTTGTTGGTCTAGGCAAGGATCTGCCT
GTCAACTTTAATGACTCTCCTTCCTCATACATAGTCCTCATCCCTCGTCAACTCTATCTT
TGAGGTTCATCTGGAGCCCAAGTATGATCTATACCAGTATTGTCTGGTATTTGGGTACTT
GCTATCTGGTCCAAATGCGAGTTATAAGATTATTTCTTTCTCATTTACCTGAGCTACAAT
TGTAAGAGTTTTTTTAAAAATTCTTATTTTTGGCGGCAGTGGAGACAGCTGGCCCTTCCC
ATCTTCCCACCTGCTTGGGGTCCTGGCTGTCACTCGAACGATCTGCCTCTGGGCGCCATC
TCAGCGCATCAATGGTCTAGATCCAGAGACTCCCAAATAAATCTCAAAATGGATTAAGAT
GGTACAGAGATGTCTGTGGACCCAGCCATTTACAATTTCAGAATTCAGAAGTGGCCTCTC
ATGATATTCATAATAAGCAATAGTAAATAAATTATCTGGCATCTGTCTCTGGCAGGCAAG
CTTGAATGGTGGTGGGAAAATTCTAAATAATGATGGTGGGAAGGTGTAATGGTGCTGGGA
TTGGTGTTGAAATACTGAATGTGATCAATTAATGTGAACAACCTTATGAAAACTAAAATT
TTTAAAAATTCTTGTTTTGGGGGGCTGGAGCAATAGCACAGCAGGTAGGGCATTTGCCTT
GCACGCGGCGGACCCGGGTTCGATTCCCAGCATCCCATATGTCCCCTGAGCACCTCTAGG
GGTGATTTCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATCACCAGGTGTGACCCAAAA
AGAAAAAAATTCTTGTTTTGGGGCCATACCTGGCTGTGCACTGAAGGAATCACTCCTGGT
GGTACTCAGGGGACCGTCTGGGGTACTGGAGATTAACCTGGGTCTGCTGCATGCAGAGCC
ACTGCCCTCCCTGCTGTGCTGTATCTCCGGTCCCAAGATTCGGAACCTCTGCTTTCAGCT
TTTAAGATCTGTGGTCTTGTCTTGACACAGAAGGTGGAGTAATTTGGTTATAAAAGGCTG
ATACAGAGCACATCATTCCCCATATGCCAGTTGGCTTCTACTATATTTGGGATAAAATCC
AAAGTTGTTGCACATCAAATTGGGCGTCCAGGAATTATTTATTGAAAAACTCAACTTTCC
GTTGAATTGGAAGGTGTAGGCTTTTAACTGGGCACATGAGGGCATCACTCTCACCTCCAT
CTCCCAGATGTGGTTTGTCCATCATGCTGCTCTCTTGTGTGTGCGTGTTTGTTGTGCATT
TAGCACCTGCCATGCTGCTGTCTTCCTCGTGCTCAGTGGGAGCACGAGCCATGTCCTCCC
TGACCAGATTCTGTTGGTGTACAGTGTATTGAAGGCTATGGGTGGTACTCAGTGACCGGG
AAGCTTTGGAGTAGTTGGAACTTGGGAACGGGAGGGGGGAGCCCTGACATGGAATGCAGA
AGAAGGGGCCTCAGACGGGGGAGTACCATGAAGCTCTCCATACCTTTGCAAATCATCTCT
TGTTATTCTGGCACATTGGCCCCGGACTTCTTGGGTTTCAGATAACAGTTAAGTTACTTC
CAATTAAATCTAACTTCAGATAATGTGTGTCGAGAGCATGTAAAAGGGATTCTATTTTAG
AGATAAAGAATGAATGCCTATGAAGCATTTGCGTATCTGTAACAGGAAACTGACTGTCTG
CTCACTCGTTCTTTTTCAGTGGAATCCCAGCAATGGTAGATTTTGCTGCTATGAGGGAGG
CGGTGAAAACTCTTGGAGGTGACCCTAAGAGAGTCCACCCTGCCTGTCCTACAGATCTGA
CGGTTGATCACTCCTTGCAGATTGACATCAGTAAATGGTACGTAACAGACTCATCCAGCC
AGCCTTGCAAATTCCCTGACTGCTGCTGGGTGCATGTGGTCTGGGAAATTGAGTAGAGAT
CATTTTACTAGAGCAGACATGCTCCACTTGGTGCTGAGACTGCTGGAAACATGCTATGCT
CTGATGAAATTCTTGTCCCTCCCTCTTTTTCTTTTCTTTTTTCTTGTTTCCATGGCCATC
CCTAGCAGTGCTTTTGGGTTGGGGAGTGGGGAGTGCATAGAATCCAGGGCCAGGGCTTGC
GCTGGACCTCCTGGCCCCATCAGTGGCCTCTAATTCAGTGTGACTTTAAGCTGCTCTGCT
GTTTGGTTTTGTTTTGGGGCCAGACCCAACAGTGCTCAGGGCTCACTCCTGGCTCTGTGC
TTAGGGCTCTTCCTGGTGAGCTTGCCAGGACTATACGGGTTCCGGGGATTGAGCCCAGTG
GGCCATGTGTAAGGCAAGAGCCCTACCCCTTATGCTGTGACTCTTGCCCCTAAGCTTATT
TTCACGTTTGTATATTGTTGCTATCATTTTTTGTGAGAATGTATAAGCCTAGTATGTAGT
GAACTTTGATTTCAGTCTTTTTTCGCTTAAATTAAGAAAAAAAAAATGAAACTACCTGCC
AGGGCGGAGTGAGAGGTCAAAGGGCTGAGCATTCACTTTGCATGCAGAGGGCCTGGGTTG
GTTCCTGATACCTAATGTTCCCTGAGCACTGTTGGAAGTGACTGCTGAGTGTCACCAGGT
GTGATCTGAGAACTAAATGATATCAAGATGATTAACCTCTTGAGAGACTCTGGCGATATG
ATCTCTGCAGGCCTCTTAATCACCAGTGCTTGCAAGCGCTAGGCTCACGAAGCTCTGTTG
CCCTCTCACTTTGATCAGCTGTTTGTTGTGGGGTCTGTACCCCACAGTGCTCAGGGCTCT
GACCACGTGAAGGCAGGCACCTTCCCTGATGTACTGTCTCTCCAGCCCAGAAACTTTTTT
TTTTTTTTTTTGTATTTGAGCCACACACAGCTCAGGACTTACTCCTGGCTCATGGATCAC
TCCTGGCGGGTTTGGGGGACCCTGTGAGATATTGGAGGTCGAACCTGGGTCTACCATGTG
CAAGGCAAACACCCTACCCATTGTCCTATTATTCCGGCCTCCCCATAAACTTTTCTGTAA
GAATTTTTTTTTTTGCTTTCTGGGTCACACCAAGGAGTACTCAGGAGTTACTCTTGGCTC
TGCACTCAGGAATCACTCCTGGTGGTGCTCTGGGCACCATATGGGATGCCAGGATTGAAC
CTGAGTCTGCTGCTTGCAAGGCCTTACCTGTAAGGATTTTTTTGACAAAGGGAAACTGGC
GACTGCATGTGTACACTATTCTCTCATGTTCCCAGAGTAGTATATTTTGCAACTCTGATT
TGGTACAACCTAGGACTTTGCCTTCTAGATTAAAATGATGGCTGAGTTCCTCTTAATGTC
AGACTTAAAAATTCAGTTTCACTACTTGCTAAACATTTTTTTAAATTGTTACTCAAGTAA
GTATATGAACGTGATTTTATTGGTCACTTAGAATTATATTGTGTCCATAAGTTAAAAATG
ACCTATTTTGGTAACCTGACAAAGCTGTTTTAAAATCTGAGCTGTATGTAATATATTTGA
ATAATCTCTAGGTATTTCAGATAGCATGACTAGTCTGTGTCTTATGGAAAGCCAAATTTC
TGTCCCTTTTACATTTTTTTCTTTTCATTGCTTTTGTGTTTGTGTTGGCAGTGCAATACA
GAATGCTCCCAATCCTGGAGGTGGGGAGCTGCAGAGGGCAGGGAAGTTCCCGCCCCTCCC
AGCACACCCCAAGAAGCTTCCCTGCAGAGGCCAGACCACCTGCCGGGGGCCCTGTGACTC
TGGAGCAGTAGGCCGAGACTCTGGAAGATTCTCTTCACAAATTGAGAACACGCCCATCCT
CTGTCCATTCCACTTGCAACCAGTGCCTGAGTATGAGATTTCAAAAACATTTTAGTATGG
CTCTTAACTCCCTTCCCTCTTAGTTCCTCAAATGGTATGACTTCATACTTAATGTGTTGG
ATTCAAATTGACATTTATTTTCTATTGTACCAAAAGAGGTGGAGGTAATTAAAATGGTAC
TCTTTAATGCCATTATTCATTTTAGTTCCTTAGAAGAAAATATTTCTTAGGATCATCCCA
TAAATATGTTGGTTTTGCTTGTTTTTGGGCCACGCTCAGTGGTGCTCAGGGGTTCCTCTT
GATTTGTGCTCAGGAATCCTTTCTGGTGGTGCTTGGGGCCCTGTGGGATGCTGGGGATCC
CACCTGGGTCAGCCACATACAAGGCCTGTGCCCTCCACGCTGTGCTGTTTCTTTAGCCCC
AGGATCTTGGTTCTTGAGATTGAAATTTTTTTTTTTTTTAATAAAAATTTTATTTTATTA
AATCACCATGTGGAAGATTACAATGCTTTCAGGCTTAGGTCTCAGTTATACAATGCTGAA
ACAACCATCCCTTCACCAGCACCCATATACCACCACCAAAAAAAAAAAAAACAGTACACC
TCCCATCCCGCCCCCCCACCCCCCGCCTTGTAACTGATAAGTTTCATTTTACTTTCTGTT
TACTTTGGTTAAATTCAGTATTTCAACACAAACCTCACTATTGTTGTTAGGAGTACCCCA
CTAGATTCAGACCTACTGTGAAGACAAATGAGGTTGCGCGGCCGCACTAGCGGCCTCACA
GTTTTGAATTTCCGTACTTTAACAACTAAGTCCAGGGGAGATTTCTTCCAGATATTGGAT
CATTGCAGGCTTGAAAATCCAATCTGTGGTCTTCATAATATGGCGGCCACCGCGCCCTTC
ATCCCCGGAGAGAAAGAGGCGAGAGAGAGAAATACCTTTCCCCTCCTGTACGGGCACGGG
ACCGAGGCTTAGTTCTCAGGCTGGAGACATTCTGCAAGGAGTTGCCCATGCCGAAAGAGG
TTTTGCTGGGTCTGGATTCACGCTCGTGCATCTGCGGAGAGGCCGCACAGGCGTGCGGCC
CCCGGGATCACATCTCAGCGGTGGGAGGGGCCAGTGCCTCCCACCTTCCCAAGAGCACCC
TCGTGTCCTTTTGCTGCAGTTTTTGTCGTAAATCCCATCTGTGGTCGTCTTAATATGGCG
GCCACCGCGCCCTTCATCCCCGGAGAGAAAGAGGCGAGAGAGAGAGAAATACCTTTCCCC
TCCTGGGCAGGCACGGGGCCAAGGCTTAGTTCTCAGGCTGGAGACATTCTGCGAGGAGTT
GCCCATGCCGAAAGAGGTTTTGCTGGGTCTGGATTCATGCTCGTGCAGCTGCGGAGAGGC
CGCACACACACGCATGTGTTCCCTGGGATCACATCTCGGTGGTGGTCTTGAGATTGAAAT
TTTTGTGCACAACTAAGTTCCCTAAAAAGTTCTACCGAAAAGAAAATCAGTTTTCTTCAT
TGATAGAGAATGAAGTGCTAAGTTCATGAATTTGTCTCATAAGACCATTTGTAAGGGAAA
CGCGAGTCACTCTTAGTGGTGCTTAGGAGATCTTATGGGGTGCAGGGATTGTAGCCACTC
ATAAATCTTACCCACTGCATTATGTAAATCTTACCCGCTGCATTATCTCTGCCTTGGGGG
GAATAGTGTTGTATGTATGACTTCTTCCCTCCGATTTTACTCTAAAAAGCCAGGAAGATG
GCTATATTTAGACCAGGGCTGTTTATCTTAGTAACTCTCGTGTGTTCTTTAAGGATCAGT
AAAGCATTAATTATATAGTCTGCAAAAATATGGAGGGAAGGGCATGCATCTGGCACTGTA
GATTACTGTCTAATTGGAGGTTAAGCTGTGCATTGGTGTGTATGGCCTAAGCTATGGGAA
GGTGCAATAATTGGAGAGTGATGTCACAAAGACATTCCCTGAGGCCCTGGGTAGAAATCT
CATTAGGAGGTGCAGTGCCTAGTCTCAAGTGGTCATCCAGCCATGAATTATTCAAGTAAT
CTTTGTATTAAAAAGTTAACAGTTAGACAGTGGCAATTATCTGGTCCCTTGAGGACACAT
GTAATTGTGTTATTGATGTTCTTGGCACCACTTAATCACCACTGGCAGGTGAAAGGAACA
ATTGAAAGCTGTTTAAAATACTTCAGAAACATCATTAGGTAAAAATGGTTTCCTAAAAAT
GAAATTGTTTTCTGCTTGGAGGTGAACAGTTTTTTCCTTTTTTTTTTCTTTCTGGTTTTG
AGGCCAAACTGGGTGATGCTCAGGAGTTACTCCTGATTCTGCACTCAGGAATCACTCCTG
GTGACCCTTAGAAGACCTTATGGGGTGCAGGGATTGCAGCCATGTGTAATGCAGATGTCT
TACCACTGCATTATCTCTCTGCCTGCCCCCCACCCCCACCCCCACCACCAGGTGGATAGT
TTTTATCTCTTATTTTAAATGAGGCACATACCTGCTTCTTAAGCCATCCTATTATAAACA
TGTCCCATAGAATCTTATTTTCCTTTTTCCCCCCCTTAATATATGTTACTATACTACAAA
CCTGTAAGTTATTCATGTGTCTGTAATCATGAGATTTAATTTATACATAAAAATCTCTGC
ATTCAAGTGGGGTAAAGGGCATGTCCTTTTAAAACTCAAGCAGACTGGATGTTTGTCTTG
TATCCTGTCAGAGGAAACAACTTGGGAAAAAAACAAACTGGGGAATAAGTTTGTTGTGGA
GTAAATTAATTTCCTCCTTGTAAGTCCAGCCAAACCTGCCTTGTTTGTAAAAAGGTCTTA
GCGCAGTCTCACAGTAAGAAATGTTAGGTTGGGTTCTGTTACATGTTTTTGAAGGAAAAC
TTCCTTCTCTAAAGAAAGATTATTCTGGGAAGTCTAGTAAATTGTCATTTCAAGGATTCA
AAAGATGTAGTTGTGTGCATAAGAATTAGAAATTAGATGAGGGGCTGGAGTGATAGCACA
GCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCAGGTTCGAATCCCAGCATCCCATAT
GGTCCCCTGAGCACCGCCAGGGGTAATTCCTGAGTGCATGAGCCAGGAATGACCCCTGTG
CATTGCCGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAAAAAAGAAAGAAATTAGA
TGAGGCTGGAGCGATAGCACAGCGGTTAGGGCGTTTGCCTTGCATGCGGCCGACCCAGGT
TCGATTCCCAGCGTCCCATATGGTCCCCTGAGCACAGAGCCAGGAGTGACCCAAAAAGCA
AAAAAAAAAAAAGAGGAATTAGAAATAAGGTAGTTCTTTTTTCTAGTATATACATTTAAT
ACCAGCTCTTCTTCCTTTTAGACCTGAAACAGTGTTAAAAAACCAAGAAGCAGAATTTGG
CAGAAATCGAGAAAGACTTCAGTTTTTTAAGGTATAAGTGATTTGGAGGAACTTAAAAAC
TTTGAATTTGTTCACTTTTTTATCTTCTGACTCCTGGATTTTAAACACTTTGTCAGTGGA
AACTTTGTTCTTCCTGAAGGTCATCTCAGCCCCTGTGTGTAACTGTGAAAGAAGGTTGAA
GAGATGCTAGGGACTGGGCAGGGAGTGCAAAAGGCCACTAGTTGGCCCCCTGGCACTGCA
CCCTACATCCAGCACTGCCAGCTCTAGGGCTGATGGTACCCTGAGCATGGGACTTCTGTC
CTATCATGACTGTTGATCCTAGCAGGATATTGGGGGGCATGGGGGGTGCTTAGGCCCCCC
AGTCCTGGGGATTCCCCCAAATAAATGCATACATAATGCATGCTCTGCTGAGCGTGAGCT
TGGAGGGCCTTGAGTAGGGCCTCCTTGCGCTCCCTGTTTCTTAGGCTCTTTGAAACATAA
CTGAATGTTCCCGTTTATTTGGATTAGCAAAATGAGTATGTTTAGCTTTAGCACGTGCAG
ATTGGTTTTTGTCTATCATAAGCTTTATCCATGTTGAACATTAGTAAAAAATATTTAGTG
TCAGTATTTGTGTTTCGAGGTATATCCAGATTTTTATGCTAATAAGTGTTCTTCAAATTT
AAACAAAATACAGTGGAGCTCACGCGTTTTTAAGAATGTGGCTGTGATCCCTCCTGGAAC
TGGAATGGCTCATCAAGTCAACTTAGAGTATTTGTCTCGAGTTGTTTGTGACGAGAACAA
CTTCCTCTACCCAGACAGTGCTGTTGGCACAGACTCCCATATAACCATGGTGAACGGTTT
GGGAATTCTGGGCTGGGGTAAGTCAAAGACTGCATGTGTCTCATTTCATTTTGGGATCAG
ACTTCAGGAGCATTGTAAAGGAACACATAAATAGGCGTGACTTCAGTCACTTTGAACATG
CATATTCATCTATTATAGCATTCTCAGAAATGGGAAACAGTGTGTTTGTGGACATTGTGG
TATGAAAAGAAAAGAAATGAAAATGACATATATGAAAAGAAATCTCAGTGCTCAGCACAG
TGTACACAGGAGTGCTGATGTCTGAAAGGGACGGGACTCCCCGAGGAAGGCCCTGCAGCG
CTCAACCTGGCCACCAGATGCCCGTATCCTTTTGCTGACACAGGCCTTTCCTGCTAGCTG
CCACACACCTTTCACTCCCCTTCGGACTGCTCAGACTTCGTGAATTTGCATGGCTCTTCC
TGGTTAACATCTTGACTCCTTCTGAACGGATATCATCCTTGATGAGATTTTTCTTATTTT
TTTATTAGACAGGAGTTGAGGTTGAGAGGAACTGGATTCTGTTCATTATTGTATCGTGAA
TATAATACAATCTCTAACACAGTAAAGTATGTTTACTGAATTTAATATAAAGCCAAAGAT
TATTTCTTTAAAAAGTTTTGTGGGGATGAAACCCAGGTTGGCCACACGTAAGGCAAACGT
CCTACTCAATCTGGCCCTGTGTGCAGTAAACTTTCAGACGGAGTCTGGAGAGTACCATCG
GATGTGGCCCCCAAACCAGAAAAAAACAAAAAAGAAACAAAACAAATTCTGTGTAATAAC
CAACCTTTAGGAGTAGTCTTGGGTTCCATGCTCCTGATGACCATGTTGCTACATGAAGGT
GTGCTATGGCAATGCTTTTGAGGCAGTTTGATGTGATGTAGGATGACTTCTCTTCCCTCT
TCCTTGGTTCTACACTGACATGCTGTCTTCCTCCAGGGGTGGAGGCATTGAGACGGAAGC
AGTGATGCTCGGCCTGCCCGTTTCTTTGACCTTACCGGAGGTGGTTGGCTGTGAGTTAAC
TGGCTCTTCAAACCTTTTTGTTACATCCATAGATGTTGTTCTTGGCATTACAAAGGTAAG
TGGAAGCTATATTGGTCATGTCACTTACTATCTGTGTATTCCCCTGCAGTCTGTTGTAGC
TGTTGTCAGCATTGCAATGTTTGGAGGTTGCACTCTTGTCTTCTGTGCTGGCCAAGATGT
GCACATGTGTCCTGCTGCCTGGGCCACAAGCAGAGCTAGAGGTGGTACTCACCACTGGGG
CTCTGGTGGAGCTGAGCTATCAGCTTTAGGCAAGGCTGGTCCTTAGTGTACATTGTTTTT
TTAAAATTTTATTTTATTTTTTAAAATTTCTTTTTGGGGCCATATTCAGCAGTGCTCGGG
GATCACTCCTGTCTCATTGGGACCATTTAGGGTCCTCCGTGTTCTGCCCCTGGTACCCTC
TCTCCAGCCCCTGGACACGGCCAACCTGGGCCCCACGCCTGCATCCCGTCTGGTCCTCCC
CAGTGCCCCACCAGGAGTGTATGAGCCCAGGAATGTATGTGGCAGAAATCTAAGGCCAGC
TTCTGTAGCGAATTGTTTGCCATCCGAAGTTTTCACTCTGTCTCCTGGTTGGTGTCTTTC
TCTTTGCCTAGTCCCACTCTGGAGGGAGCCCATTTTTTCTCTTGAACACACACTTCCCCC
TCTTTCTCCTGTCACGTCTCTGTTGTTTCTGTTTTGGGTCACATCTAGTGATGCTCGGGT
TACTCCTGGCTCTGTGCTCAGGAATTGCTCCTGGTGGTGCTTGGGGGACCCTGTGGGATG
CCAGGGATTGAACCCAGGTGCCAGGCCAGACCCTTCCACTGTACTGTGGCTCCAGCCCCG
GGAAGATAATTCTTATTCAACAAAGCTTGCTTAGGGGCCGGAGCGATAGCACAGCGGGTA
GGGCGTTTGCCTTGCATGCGGCCGACCCGGGTTCGATCCCCGGCATCCCATATGGTCCCC
CAAGCACCGCCAGGAGTAATTCCTGAGTGCAAAGCCAGGAGTAACCCCTGAGCATCGCTG
GGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAACAACAAAGCTTGCTTAGAAAAATGT
GACAGGTGGTGCTGGAGTGTTTGTGCTGTGCTTGCCTTGCATGCAGCTGATCCGGGTTTG
ATTTCAAGCACTGCCAGGAGTAACCCCTGAGCATCACTAGGTTTACCCCTAAAGCAAAAA
CAGCTATCTCCCTTCACTAAAAACAAACAAAAACACCAGAAAATAAACAATCAGTCTGCA
GATGATAATTTCAGAAATATGGATAGTGGTAAGTAATAGTGTTTTTCATGCTGTTTTGAG
CATTTTTATTAGTCAATAGAAACATTGTGTCTGAGTTTGAATTTATAAATAGTGGCTGCA
TATGTTTGATTTGTGTTTATATTCGCTTCTATAGAATATGATTATTCATGATTTCTAATG
ACAGAAATTTTCAATTTTCCGCAACTTTTTTTTGTTGGTGAATCACCCTGAGGTACAGTT
ACAGACTTACAGACTTTTGTGCTTGTGTTTCAGTCATACAGTGGCCGAGTACCTTAACTT
TCTTTGATGGCTAATTCCCAGTTTGATAAGTTAATGAAGGTGAAAAGTGTTTCACATGTG
ACTCCAATTTGGAGCTTCATTTTTAATTTGATGATTGATCTGAAGGCTTTTAGGATACTC
CTCAGGGAAAGAAAATGGTATTTCCCCCCTGGTAATATTGATCTTTTTCCCTAAATAGAA
GGAAAAAACCGGCATCTTAAATGATCAGTTAGGAGCATTATACCAAAAATCGAGAACTTT
AATTAAGAACTGCAGTATTATTCCTAGAAGAAAAGGACTGCCTGTAATGTTATTAGAGAA
ATCAGTTCTTTCCTTTGGACATTCTGAAAATCAATGCTGCCTTTTAGACTCCTATAGCTT
TTTTCCTCTTACCAATTTTGCTTTTGTTTGGTGATAGGTGCTCAGGGACTACTCTGGGTT
CTGTGCTAAAGAGTGAACTATGGGGGAACCATATTCAGTGCCAAGGATTGAACTTGGGGG
AGGGTTGATCAAGTGCAAGGAAATACTCTCTGCATCATCTTTTTTGGCCTTCCTCTGTTT
GTGACATGTTTTGCTTCTAGTTATTCTTTGAGGTTCTGCTTTATTTATGATCTTTATAGG
ATTAATCATGCATTGTTTTCAAAGTGTTATTGGAATGAGCGTCGCTTGGCTTGGTGTATC
TAATCAGTATTTCTTTCATTTTCAAATCAGTTTTTCATTTAAAAAAAAAAGCCCTTTTTA
TTTGTTTTCCTCTGGAAAGGTCAGTAGGCAGAAGAGATTTTGGGAGCCTCTGCTCCATTG
CTAGGCTTTTTGCTAGATGGGGGCTGTTGCAGTCTAGTCTCCCCTCTGCAGCTTCCCCTG
CCCCTGGCAGACAATTGTGCAAAGGTGAGTAGTGGTTTTGGTTACATGCTAGTAACTAAG
AAAAATGATTTTAGAAGAAGTTAAATGTAAAGTTCAAGTGTGAAACCCTATCAAAAGTGG
AATTCTTACAGCATATGTATATATATAAAATACATGTGATGAATTGTATTTTGTTTCTTA
TTTTTGTTTTAGGGCCACACGCAGAGGACTTAGGCCTCGGTCTATGCTCAGGGGTCCTCT
GTGTTGAAGCAGGGTCAGTTCTCCCCCACCCTCCCTGCATTCTCCCATCTTTCCTGCCCA
TGTACTTATATTCAAATACAGAATGTCAATCTTTAAGAAAAAATTTTTATTTATTTATTT
ATTTATTTTTTGCTTTTTGGGTCACACCTGGCGATGCACAGGGGTTACTCCTGGCTCTGC
ACTCAGGAATTACCCCTGGCCGTGCTCAGGGGACCATATGGGATGCTGGGATTTGAACCC
GGGTCGGCCGAGTACAAGGCAAATGCCCTACCCGCTGTGCTATCTCTCCAGCCCCAGAAA
AATTTTAAGCACTGTGTATTTCCTAAAATCTCACACACTGTCAGTTGTGGAGCCATCATT
ATTTCTGTACCACAGGGAAGTGCCCTGCCAGTGAAAGGAGCACTGCTAACTGTAGCTGCA
TTCTGAAGCTCTTCTGAGATACCTCTGACCTTTGAGAAATGACATCGGACTGCTCCCTAT
TAGCTGTGTGAAATGACCTACCAAAGTTGGGTGGTCATGGCTCTTAGAACAGTGAATGCC
CTCTTTATTGCCACTAACACTTGTTAACCAGATTTTTCTGCTTTTCAGAGAATATATGCT
AACCTCACCCTTGCTAATTTTGCATTTTATGTCTTTTATGTAGCACCTCAGGCAAGTAGG
AGTGGCTGGAAAGTTTGTTGAATTTTTTGGAAGTGGAGTTTCACAATTATCTATGGTGGA
TCGAACTACAATAGCAAACATGTGTCCAGAATATGGTGCTCTCCTCAGCTTTTTCCCTGT
TGACAATGTGACAGTAAAACATTTAGAGCATATAGGTAAGAAGACACATAAGATCATTAT
CTTAAGGTGTTGTATTTCTGACTTGTCTGTCCAAAATAATTTATAATCTGCCTTGTACCT
CTTCACCTAATGATTCATTTTGAAACAGTGACATTCCAGTAAAGGCATCAACTGCTTTAC
AGAGTGTGCTCTCAAACCATATTCCCTTATTCCCCATTGATTGCAGTTTCAAAAAAATGT
TTTGGGGGATGGGGACCAGCACACCTGGCAGTGCTCAGGGATAACTGAGCAGGTTCAGGG
GACCTTTTGGGGTGCCATGGAAGCAGCCTAGGCCCACCTGCCATATGCAGTGCAGGCAGC
CTGAGCGCTATGCTATGTGGCTTAGTCGCGTGGTCCTTGTTCACTTTTCTTAGATGCCCG
TCAGGGGAAGGGAGCCTTGTGCTCTTGATGTTGTGCCTTCTCCACCCAAGGGAGAGCCTG
GGAAATTGGACGCCTGGGCAGCTGCAGGTCCTGGAGCCACTACTTGCCCTCCAACTGGTG
TTCATGCTTTAGAAGACCTCTGCTGTGTGTGAAGCAGCTTGTTTTTGGGCCACACCTGTT
GATGTTCTGGTTACTCCTAGTACTCCTCATGAGACCATGTCGGGTTCTGGGGATTGAAGC
TGGGCCAGCTGTGTTCAGGCCAAGAGCTCCATCCATCGGATGGCCTCTCTCTGGCCCCAA
ACACAGGAGTTTAAATCTAATCCATGTTTTTAAAGTAATGATTCCAGAATTCATGATCTC
TGTTTATAGGTAAGTTGGGGGCTGTGTTATCCTCGAACTCTTAAATTTGGGTAAGATTAT
GAGTGTGAGTGAGCCAAATGGCCAGCGGATGCTTGCTTAGTCACGTGGGCCCTTGGAGGA
GTGTTTCGCACTGAAGGCAGAGTTTCTGTAAATCTTATATTCAGTTTGGAGAATATGTAA
GAAATAATCAATGATGCCTCTTAGCATACAAAGGGGTTGTTATTAAGTGCTAATTTAAAA
ATGCTTCTGTTCTCATTATGTGGTTATATGTAATGTGTGCTTCTTACTCATCATGTGAAT
TGCTCCCCCGTCAAAGATTTCTAAATTCCTTACAGAATATTTTTTTCTCATCTTTTTAGG
CTTTGACAAAGCCAAACTCAAGTTAATGGAAACATACCTTAAAGCTGTGAAGTTGTTTCG
AAGTGACCAGACTCCTTTAGGACAGCCCGAATATTCCCAGGTAGATCCATGGTAGTCTGA
ATTCTGGGGCTGGGGCATCCCCTCGCCAGTGGGCATGCACTTGGTGAATCTCTGTGGCAC
ACTCTCCTCTCCACACACCCCCAGTATCACCTGGTGTGACCTTGGTTTTCGCTGATACCG
AGAGCCCCTGCAGGGACGTGTCCTTATGCTCTGGTGTTGAACTGCTGTGCCCAATTGCAG
GGGTTTTACTGGGCTCCCGAACACTGCCCGAGGTCCCCCCGTACCCTAAGAACTGGTCAG
CTCTGGGACATAAACTTTTTGTGATCTTGAGTGGTAATTTGTTCCTCTGAGTTTTTTTGT
TGTTGTTTTGGTTTTGGGGATACATCTGGTGGTACGCAAGGCCAAGCCAAGAGGCTCTGA
ACTCAGGAGTCACTCCTGGCAGTGCTCAGGGGACCCTGTGGGATTCAGGGAGGACACCTG
GGTCAGCTGCTTTCAAGGCAAGTGTCCTTTTGTTCCCGACTGTGTTTCTCTGCTTCTGGA
AGATGACCTGCCACATCCCTTGTGTATGCATGTGCATAGATGAGGCACAGTCTGTGCTCG
GCGAGCACTATGCCTGGGTTCATGACCCTGCCGGGTGAAGCGGTTGCCTGTGACATCCAA
ATATTGCCTTGGAATCGGGGCCTCCTGGTGGCTTCTAGCAGGAAGTGGCCTGCTGGGTGC
AAGTTTGTTAGCCCTCATGACCCAGGGTATTGTCCGGCTTTGAATTTTGTATTGGGGGAC
AATTGTTTCACAAGTTCAGTGGGATCATTTGAAAAACTTTCTTTGGGGCTTTATTTCCTT
ATTATACAACAAATTGACATTAAAACAAATGTGTGATGAGAGTCATTTGCTTCCAAAGGG
AGCATTTGGTTCTAAGTCTGTATTTTCGGGCTATAATTCCATCTTCCTCCTTTCATTTCT
AGGTGATCCAGATTAATCTGAATTCAATCATCCCTTCTGTCAGTGGTCCCAAAAGACCTC
AGGATAGAGTTGCGGTGACAGATATGAAAAGTGATTTCCAGGCCTGCCTGAATGAGAAGG
TGCAATACCTCACTATTTCTTGTTCGTGTGCTTTGTTCTAAGCAAGGAAAGGTCGGTCAC
AGTGAAGCACCCTATGGCTGGTTTATTTTACGTGTCAGGACACATTGCCATTAGCTCTTT
TGTTCAGTGCATTTCTGCCAGGAGTGAGCCCCGAGCACCATCAGGGCGGGGGACATTCCA
TCCACACTCCAGTAAAATTCTTGGGGGCACACCTGGCAATGCCCAGGGATTACTCTTGAC
TCTGCACTCAGGATATTCTTGGTGGTGCTCAGGGGACCCTATGGGATGCTGGGGACCAAG
CCCAGGTTGACAGGGTGTAAGACCAGTGCCCTCCCTACTGTCCAGTCTCTCCAGTGCCTC
CCCCACCCCCAGTTTTTAAAAATTAATTATTTTATTTGGTTTGGTGTTTTTGTCACACTT
ATGTTCTCAAGGCTTACTCCTGCACTCTGTACTCAGAGACCTAGCCGCTCTCAAGGGACT
CTCGGTGGTATCAGGCATTGAACCCAAGTCGTCTGCATGCAAGGGTAGTGGCCAACCTGC
TGTCCTATCTCTCAGCCCCTGAGTTCATGTTTGGGCTGTTGTCATGGTCAGTCTGTACTG
TTTCCGTCTTTCTTCTGCTGAGGACCGGGCTCTCTCAAATGTATGTTTAATTCTGTGTAG
GTTGGATTTAAGGGCTTCCAAATCGCATCTGAAAAACAGAATGACATTGTTACCATTGGT
TACGAGGGAAGTGAGTATACACTGGCGCACGGCTCAGTGGTCATCGCCGCAGTGATCAGC
TGCACCAACAACTGTAACCCATCGGCCATGCTCGCTGCAGGTAGGCTGCCTGCAGCCCTG
GTCCTCGTGCATAGACATTGCTGTCTGCATGCTGACTTTCTAACATATTGCTAGGTTTCA
AAGAGCCTAATTTGAATTTCTTATTACATAAAGTGTTTTAAAATGGCATCTTGAGTGTGT
TATGGTTTTGAGTTGTATCTGGTTCACTGACTGAGATTTTCAGAATCAGGTACTTCTTTC
GTATAGAGTAGTTCTCCATGGCAGTATGCTAGCTTCCATGCGAATTTTGGAGACCAAAAA
AGATTATTGATAACTGGCAGTGAGGTCTGTGGCATAGTTCAAGGACAGTGGTATTGTAAA
TGTTAAATTGCTCTTAGTTCATTATGATCATTAAATTAAAAATGGTTTAGTGCCTTCCCC
TCCAAAAGGAAAAGAAAAATTAGTACATTTGACCATTCTGAACAGTTGTTACAGTGTTTC
TAATTGATAATAATAATGACTTGGAGACCATGCTAATCTGTTCTACATACTACTGATCAC
TTTCTCTTCTTTGGTTTGGTGTTTATAATCCTGTGATGGTGGTTGGTGCCGGAGCAGTAG
CACAGCAGAGAAGGTGCTTGCCTTACAAACAGCTGACCCAGATTCAATCCCTGGCACTCC
CTAGGGTCCCCTGAGACTGCCAGGAGTGATCCCTGAGCACTGAGCTGGGAGTACACTGAA
CACTGCAGGTGTGGTCCAAAAGCAAAAGCAAAAAAATAAAAAATTCAGACCCTAAAGCCT
GCTGTTTGGTAGATGTTAATTTGGGTGGGACGGTGGGACCACACCTTGGAATGTTTAGGG
GCACCCCCAGTTGTGTGCTTTGGGGCTTCTCTCGTCCCTCAGCCTTTGTTCCTTATTTAT
TGTGGTGGGTGGGGGTGTACCCAGCAGTGCTCAATGCTTTCTCCTGTCTCTGAGCTCAGA
TCACTCCTAGCGGACTTGGGGACCATATTCATGCCAGGGATCAAACCTGAGTCATCATCG
TGCAGGACACACACCCTTCCCCAGACTGTTGCCCAGCCCCTAAAACCTTGTTTCTCTCTC
TCTCTCTCTCTTTTTTTTTGTTCTTTTGGGTCACACCCAGCGATGCACAGGGGTTACTGC
TGGCTCTGCACTCAGGAATTACTCCTGGCAGTGCTCAGGGGACCATATGAAATGCTGGGA
ATCAAACCCTGGTCGGCTGCGTGCAAGGCAAATGCCCTACCCGCTGTGCTATTGCTCCAG
CCCCTATAACCCTGTCTCTCAAATGAACCCTCTGTGCTGTGTGTCGGAGGGAGGACACTG
ATGTAGTGACTGCTTTGTGCTGCTTGCAGGTCTTCTGGCTAAGAAGGCTGTGGAAGCTGG
ACTGAGTGTGAAGCCTTACATCAGGACCAGCCTGTCTCCAGGCAGCGGGATGGCGACTCA
CTACCTCAGTGCCAGTGGAGTGCTGCCTTATCTCAGTCAGCTTGGGTGAGCCCCTGTCCC
CTGTCCCCTAGTCAGCAGTCACTGCATCTGCTTCGCTCCCAGTTTCCCAGAGAGAAGACT
CTGGGTAATAGCCCTTGTTGTTCCCTTCCACTGCACAGTCTGTGGGGAATGGTCACTCAG
CCTTTACTGGGCATGTACATGACCAAGGCCCTGTGCTCACCAGGGAGAAGTAGGAAGTGT
CATTTGGGGTCTGGAAAAGGCCCTTCCAGATCTTAGCCACATGCGGGTAGTGACAGATGG
AAGGACGTCTCGACTGATGGACTGTTCTCTGAAATGCAGGTTTGAAGTCGTCGGCTATGG
GTGCTCTACGTGCGTGGGAAACACAGCGCCTTTGGCAGAAGCAGTTCTGAACGCAGTGAA
GCAGGTACAGGGCTGGTTCCACCAGCCAGGGGGCTGCACTCTCCCAGCTGGGATCTGCTG
AGAGGTTAGGAAGGCGCATTCCAGTGGGTTTCAAGTTCACTGTTCCTTGTATGTGACTAT
GAAAATGAATCAGAGTCATTTATAGACCCTTGAAATAACCACTTAATAAAAATACAAGGA
ATTAGAGGATTTAGTTTTTGGTTTCGGGTTTTTTCTCTTTACTCACCAGTGCTTTGGGCT
CACTCCTGGCTCTGTGCTTTGGGCTCACTTTTGGCTCTGTGCTCAGAGCTACTCCTGGCT
CTGTGCTCAGCACTAACTCCTGGCACTGTGCTCAGCACTGACTCCTGGTTCTGCTTTGGG
CTCATTCCTGACTGCTTTGGGCTCACTCCTGACTCTGCTCGGGGCTCATTCTTGGGCCCT
GTGCTTCGGACTCACTCCTGGCTCTGTGCTCGGGGCTCACTCCTGGTTCTGTACTCAGTG
TTGACTCCTGGCTCTGCTTGAGGCTGACTCCTGGCTCTGTCCTCCAAGGGTCACTCTTGG
TGGCCTCTGGGCAACCCAGTGGGGTGCTGGGGGTTGAATTAGGGTTTTACTTCAAGGCAA
AGGCCTTCCCTGCTATTGTGTCTTTCCAGCCCCTTGAATTTATAGATCTGTTGTTACTAA
TGTTTTCAGGTTTATTTATTGAAAATATTTGAGGTTTCTTGTTTACTGATTTTCCACTTT
TATAACATTTCTTGAATTGAAAGTATAATATGTTTTCTCCCCAGGGCGATTTAGTTACTT
GTGGAGTTTTATCAGGAAACAAGAACTTTGAAGGTCGCCTCTGCGACTGTGTCCGTGCCA
GTTACCTCGCCTCCCCTCCCCTCGTGGTTGCGTACGCCATCGCAGGCACGGTGAATATAG
ATTTCCAGAAGGAACCATTAGGTGACTTTCCCCGGGATCTTTGTATATTACTAAAGTCTT
CTTGCACACACACACGGCATTTCCCCAGAGCTGTAATTTTTAAATGTTTCTGGTTAGACC
ATTTATTTTTTAAATTTTTTAATTTTTTTAATTTTTTAAAATATTTCAGAAAATCTTACA
ATGTAGCTACTTGCTTATTCATATGAAAATTTTAAAATGTCTACAATTACTTTTTATTTA
TTTGCTTAATCCTGAAGTTTGTGTTGACTAATTTACTTACTTTCTGTAATAAGTTTTGGA
AGGACTGTGAATATTTTCTATTTCAGTCTTTGTTTTAATTTTTTTTTTTTTTTTGCTATT
TGGGTCACATCCAACAATGCTCAGGGGTTACTCCTGGCTTTGCACTCAGGAATCACTCCT
GGCAGTGCTTGGGGAACCATATGGGATGCCAGGGATCGAACCTGGGTTGGCCGCGTGCAA
GGCAAATGCCCTACCCGCTATGTTATTGCTCCAGCTCCCGTTTTGAATTTTTTAATTAAA
ATTTTTTTCCCTTATACACTACATAAACACTGGTTTACAAAATTGTTCATAAAGATTTGT
TACAGACATTGAGTATTCCAACACCAGTCCCATCACTGTTACACCTTTCCTCCACCATTC
TCTCCAATTTGGGAATCACCACTTAAGCCTGCCCACAAAACAGGCTCTCAGTAATTTATT
TTATATTGCTTGTTACTAATAATTTGCTAACAGAATGATCAAAACATGTTTTCCTTAGAA
GAAAGTGAAGATTTTTGTATCTCACCACGGGGACTGTGAACATTTTGAAGCAATTTTTAA
AAATTACTTTAGTTTTTGTTTTTGGATCACCTCGGAGGTGCTCAGGGCTGACTCCTGGCT
CTGTGTTCAAGGAATCACTCCTGACGGCTGTGGGGACCCTAAAGGTTGCTGGGGATGGAG
CCCCAGGTTGGCTGTAGGCAAGACCAGCGCCTTCCCCGCTGTGCTATCACTCTGGCCCCT
GGTTTTGAATATTTGTCAGTGCTTAAGGATGCTCTTTGCTCAGTGCTCCGGGCCAGATGG
CCACGTGGTGATGTGAGCTGAGCCCTACCCTGGCACTCAGCCTCCCACGTCCCAGGCACA
TATGCAAGCCTGCCACACCGTTGCTCCTGTCTCCACTTTTGGTGTGATAAGTTTCTTAGA
CATCGAGCACAGTCATCCTTCGAGCCACCCACTGGGCTCCCCATGCTCCCTGTGCTCCCA
GTCTGACCGTCATTGAACTTCCCTCCCAGGTACGGACTCTGCCGGCAAGAACATTTACCT
GCATGATATTTGGCCCAGACGAGAAGAGATTCATCAGATTGAGGAAGAACATGTTATATT
TTCTATGTTTAAAGCACTGAAAGAGAAAATAGAGGTAAAACTACACTTTACACTTTATTT
TATTAAACTACACTTTTTAAAGTCATTTTTCTCTGTCCTGTACTTTGCTCTCCAGGTTGT
AATGCTCTAGATGACCCGAGTGGTGTGTTTAATGGGTAGCAATAGGGATTCTGTGTCTGG
AGTTTGTAGTAACCAAGTATTGCTCTTGCTTTTATTTAATTTTGGGGACAAGCCTGTGGT
GCCTGGGCTTATCGTAAGCTCTGTGCTCCGGGGACCACTGGGGGACTCAGCTACTGGGAA
CTGCCTGCGTGCAGGCCAAGTACCTGCACCCAGTGTTTACCTCTTTCGTCCTATTTTTCA
GAAATGTGTAGCAAGTGTTTGCATTTGTCACTCTACACCCAGGCATGCTTGAGAGACACT
AGTACTACCACTCAGCTGTTCCAGATGTTTGGGTTTCTTTGTGGGGGGGCTGTGATGGCT
TATGATTGGCTCTGTTCAGGGCTCACTTCTGGTTAAGCTTGGATTATGGGATTATGGGAT
GTTGGGGATTGAACCCATCTTGGCCATGTATGGGGGAATCACCCACCTGAGTTACTGTAC
TATCTCTTCAGCCCCTAAGCTGTTTCCAGATTTGAAAGAAACGCAAGTCTCCCTCTGCCT
GTGCTCTGGCGACAGTGATGTCAGGCTGTCAGTCACGTTCCCACAGGCAGCCCTTGGCCC
CGCCAGCGACAGTATGAATGAAGGCAGGAAAAATAGTTGCTTGACAAATAATTATTTTTG
AAGATTGTATTTTTGGCACTGTGATTCACTGTATTGACACTAACAGGGTTTCAGGCAAAA
CTGTTCCAACACCACATCCTCTGCCGGAGTTCACACTGTGTGTGTGTCTTGTGTGTTCCT
CCTTTCCACACATCTGGCAGTGATCTGCTGCTACTGAAGACCCTTTTTCTCCCAGGTCCT
GTTGCATTGGAGTCTTTGTTCTTGCTTGCTTGTGTCACTCTCATCCCTCACGTGAGAGAG
ATGCTTCTGCCCTTGTCCTCCTCCCGCCCACTTCCCTTGGCTCAGCTGTCCAGATCCCTC
CACGCAGTCAGCTGCAGTTTGCTCCTTGTGGCTGAGTCGTGTTCTGTTATGGATGGATCA
CAACTTTGTCCTATGGTTTTGTGCCTGGTCATTTATTCTTGGACCTTTGCGCTGTTTCAT
AGTTTTCGGTACTATGAAGCATACTCTAGTGCAGTAGGTCATGAAGGTCTTTCCCACGTA
AACATGGATCGCTCCTGGGCTGTGTGGCAATCGTCCTTCTTGAACAACACCCGCGGTCCT
GGGCACGTGGAACTATGGGTCAGGACTGGGGCCCTTTCCTTCTTGCCGTGGTGAGGCTGT
GGTTTTAGCTTCCAGCGTTCGCCTGTCCTACACACCCAGGTTGATGCTGGGAGCTCAGGG
GCGATCTGTGCAGTGAAGCCAGCTTTATTCCCTGGCCAGAAGGGGCAGATTTCCACAGGC
ACAGCCTCCAGTCAGGGCAGGGCAGGGCAGGGAGGGTGAAAAGTCAGTCCAAGAGCCCTT
CATGAAGTTCTCATGATTGGAAACAGTGGACTGTCCACAGTAAGTCTCAGCTGTAGAGGG
CTGCACATGCGGTCATGCTATGAATAAGAGAAGGTTCAGTAGGATCAGCTGCGTGGGAAT
CTCGTGGGGTACTTGCAGGGTTACAGATGTGAGTCGTGAGCGCTCGCTTGGGGGAGGTTT
GAAGGTGTTGACAAGGGAGCCCTCACCTGGCCAGTTAGGCAGAAGAGGGCCCGGTGGCTA
GAACTGCAGAAGTCAGGAGCGAGAAGATAGGAAGTTAGCTAGTCCTGACTCCACAGGTGA
TTTTAGGCCTTTGTAAAAGTCATTCTCACTGGTGAAGGGTAAGGGTGGCTGGCAGGCCGT
GGGGAGGGCAGGCTGCTGTTGGAGGGCAGGCACTCCTGGAGCGGGATGGCATAGCGGTTA
GTGGGTGCCAGTGGGCCGCAGCGGGGATGTGCGGTGAGGGGTTGGACCTTGAACAAGCAG
ACAGGTCTGTGGACTCCTGGCACTCAGCCGTGAGTCTTTTCTGTTATAAATTAGCTGTTG
GGCAGCTTTGGAGATGCAGCATTTGGTGAGCCAGTCTGTCTTTACTCTCTCCCAAAAGAC
TGGCTTGTTGGAAGCACCCGTATAACTTGCTCTTCCATGTGGGTACAGAGCTCATATTAG
TTTGTTCTTCTTTTTCTCCTTGTGACCTATAAACTCTTTTATTCCCACGATCATTTCATC
AGTCTCTGATTCCATCCTATCGTTGCTTGTTTCTCTGCCCTCACCTATTAACAGATGGGA
AATAAGCGATGGAATTCCTTAGAAGCACCAGATTCAGTCTTATTCCCATGGGAAGCGAAG
TCTACTTACATCCGATGTCCTTCCTTTTTTGATAAGCTTGTAAGTATTGTTTGGTGCGTG
ATATTTTAAAAAACTCTAAAGTACAAAACCTTGTGAGTTTAATTTTGAAGAATTTTGTGT
TTTGGGACCACACCTAGTGGTGCTTAAGGATCACTCCTGGTGGGCTCTGGGATCGAACTC
GGGTCATCTGTGTGCAAGGTCTGCTCTCCTAGCTCCCTGTTCCCTCCAGCCAGAATCCTT
TTTTTATTTTTTGGCGGGGGATGTTGGCATACTCGGCGGTGCTCAGAGGTTACTCTGGCT
CTGCACTCAGTTTAGATTACTCCTGGTGGTGCTCAGGGGACTATGGAATACTGGGGATGG
AACCTGGATGGTCCATGTGCAAGACAAATGCCCTCCTCTCTATGCTATGGCTCTGGTGAG
AAATTAGGTAGCAGGTCCCCATGCTTGACCCATACCCAGACCAGCAGGGCTGGCGCTGGA
GTGACTGAGGGTAGGGTGGCCCAGTCTGCCCCGCTGGTCAGGAGCAGTTGAAACACCTTC
ACCTGTTCTTTGTAGACCAAAGAGCCCGCTGCCCTGCAGCCTATCGAGGATGCCCACGTC
TTACTCTACCTGGGAGACTCGGTCACCACAGATCACATATCCCCTGCCGGGAGCATCGCT
CGGAGCAGTGCCGCCGCCAAGTACCTGACGCACCGGGGGTATGTGGTGGTTCTGACCTCT
GCCCTGCTGGTGTGCAGTGTATGCCCTTCCTGCCCTCGTCCACCCCCCCCCCCCTCGCCT
CACTCCAGGCCCTGTCCCTGATGGTATGGGGGCTGATCTGATTCCACTCTAGAAATAGCC
TCTGGACATTTCTCAGTGATGTGCAAAAATCCAGAGAAAAGCAATCTTTCAAAATAGAAC
AGATTGTGGACTGTTCAAATTACATCTTTTTTTTTTCCCTTTTTTTTTTTAAAGCAGAGT
CCAGTACTTTGTATTTACTGCAAATCATAATGTCAGCAGAATTTTATGACCCAGGGACAT
TTGTTTCCACCTGAAATGAAAGTGCCTTTGCCGTTCTTGTTGCAGCCTTAGCCCTCGTGA
GTTCAACTCCTATGGAGCCCGGAGAGGGAACGATGCCGTGATGACAAGGGGCACCTTTGC
CAATATCAAGCTCGTCAATAAGTTTATCGGAAAACCAGCCCCCAAAACAGTTCACTTCCC
ATCAGGACAGAAGGTGGGGAACTATCCAGGGTTCTGGGCCGCAGCTTTCGCCTTTGGTCT
GTACTCAGCATCTGTGTCTGCTGTCCCCCACAGCTGGACGTGTTTGAGGCCGCAGAGCTG
TACCAGAAGGAAGGTATCCCGCTCATCATCCTTGCGGGCAAGAAGTACGGCTCAGGGAAC
TCTCGAGACTGGGCTGCCAAGGGGCCCTATTTGCTGGTACTGACCCATTCATGTCACTGT
TTGCAACTTCGGAATTTAAAGATTCTTGTTTCTCATGTCTCATCTGTCCTAGCTCACTGT
GCTCCTTCGTGCTGATTTGACTCTTGTGTTTATTTTAGTTGATCTTGTTTCATTTCCTCC
TCCCCCTCTCAGAGAGCCCGTCAAGCTACTGAGAGTATCCCTCCCGCATGGCAGAGCCTG
GCAAACTCCCCGTGGCGTATTCCATATGCCAAAAACAGTAACAAGTCTCACAATGGAGAC
GTTACTGGTGCCCGCTCGAGCAAATCAATGAACAGGACGACAGTGCTACAGTGCTTGTTT
CATGCTCATGTCATTACTACTCAGGACTCACTCCCAGGTCTGTGCTCAGGGCTCACTCCT
GGTTCTGTGCTCAGGGATCACTCCTGGCATGGCAGGGGCCAGGATAGCCTGTGAGGTGCC
AGGGATCGAACCTGGAAGTTCCAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAATAACATCGTGTGACATT
ATTTCTTCCCCAGGGTGTGAAAGCCGTTCTGGCCGAAAGCTATGAAAAAATCCATAAAGA
TCATTTGATTGGAGTTGGAATCGCGCCACTGCAGTTCCTTCCAGGAGAGAGTGCAGATTC
TTTGGGCCTGTCTGGTAGAGAGACATTTTCTTTCACGTTTCCTGAAGACTTGTGTCCTGG
AGTCACGGTGTCTGTGAAGGTATTGCTCATTGCGCACTCAATGGTTCAGCCCGAACAGAG
GGGCTCTGAATTGCCGATGATGCCCGGCGCCACAGAGTGTAGACAGTACTCATCTAGGCT
GCCAGGCGGGGAATGACGGCCTTCCCACCACAGGCCCCCACCTGAATCCGAGCAGCTGGG
CTCAGCCAACACCTTAGTGAAAGGCCACAGAGAAATCATGGCTGTCATGCTCTAGGTGAC
ACAGCCGGACCTGGCCTGTTAGGGGCAGTATGCACGTTTCTCCCTCGAGATACACATGGC
ACGCAGGGGAAGGCTTCCCAGCAGGGTGTGTGCAGGGCATTTAGCTCTGAGTCGCCCATG
ACGGTGTCCCCACTCACCCACTTGTTTGTGTTTTCTCTGCAGACCAGTACCGGCAAAGCG
TTCAGAGTCATCGCTGCATTTGAAAATGATGTGGAAATAACTTTGTTCCAACACGGAGGA
TTATTAAACTTTGTAGCGCGAAAATTCTTATAGTATCCACTCACAGAAATGGTCATCGCC
AAAGCTTCCATGCTGGATGGGCCCGGGAGTCCTTCCCGGGGAACCACGGTGGGCCCTGCA
GCCTGCTCAGTCGCCGCATCCATGGCGCAGTGGGGAGGAAGCTGAGTCTTGTTGACCTTA
AATAATACACACGGTGCTATTTTCATTGCTAAAAATCAATGTGTGAAGTGTGGAGAGGCC
TGTAAGCACTTGGGTGGGTGTGCAATCCGATCCTTGTCAGTAACGGGACGCTTCTTCTCT
GAATGACCTTCCTGAAGTTGTCACTTCTGAACCTATGACTGTTCACTGCTGTTTGTTGGT
TTAAGAGGAGCCTGTTGCCCTTGATGGTGCCCAGGCAGAATGAGATCATGAACATCGGAG
TTTTCTTGGATGTTTTAGGTGACGTTCTCAGTTGGTAAACCAAGGCAGGCTTACAATCTG
TCTCCCAAGAACTGCAGAGTGCACATAGTCACCACCAGATACTGCATGGTCAGTGTATAA
TCCAGCCAAAGGCTCTGCACAGCTGCGGGTGCAGCACTGTGGGTGTGCTGGCTGAGGCTG
CTCCTGGAAGTGAGTGTCTCACTGGCTCAGCCTGTCTTTAGTCTGTCAGTTGCTCTCCTC
CCCCTGTGCACTCTTTGGCCGGCTCTGAGTGATGTTTTAGACAGCTTGCCTTGCCTGACT
CTGAGGTTCTAGCCAGAAATGCTCGGGACCACTCATCAAAACCCTAGATTTCCATTTGCT
GATGAGAACATGATTTGAATCATGAAACAGTAAAATGAGTTCTTTGAGTATTTTAAATCA
TCCAGAGTCAACTGTACAATCACTCTTAGCCCTGACCCTTGTTTAAAATGTGGTCTTGTC
CTAATGATTTCATTTGATTTCCTACAAGGCTGAATCATGAATTTATCTGAGATCTGTGTT
CGTAATAAAATACTGATTCTGTTGAAACCAGAGCAAGCTTGCTCTGGGGATCAGATACCG
ATGTGATTGCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1164, 3592..3729, 5484..5702, 9054..9123, 9766..9949, 10868..11007, 14236..14407, 15512..15612, 16535..16651, 17313..17472, 18782..18917, 19212..19296, 20057..20213, 21482..21606, 23907..24011, 24528..24670, 25038..25185, 25266..25388, 26746..26931, 27315..27425
1001..1164, 3592..3729, 5484..5702, 9054..9123, 9766..9949, 10868..11007, 14236..14407, 15512..15612, 16535..16651, 17313..17472, 18782..18917, 19212..19296, 20057..20213, 21482..21606, 23907..24011, 24528..24670, 25038..25185, 25266..25388, 26746..26931, 27315..27422
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved