Sorex_araneus Locus Mono:211:SNORA72
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:211:SNORA72
Sorex_araneus
Mono:211:SNORA72
scaffold_164803
SNORA72
1001..1134
2134
ACTGGGGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAGAAGAT
CTGTGATTCAAATATCAATGCCTTGATCTGTGAACTACCGATCTTATATTATGGGTGTAA
TTTTAGTATCTAGAAAATATAGTGTCTATTAAAAAATATTTTTAAAATGGATTTTACTCC
TTTATATTTGTGGGATCTACTAAAGTCGAGCTGCAGGCATGCCTGCATGATGATTCTAGT
CTCTCCTCTATATAATTGATTGCTTCCAATATCTTTTATATAGACCATCTCACAGTTTTG
AGGTTATCTCAGATTGTTTCCTTAATAATAAAAGAAGTTGACTGCAAATATTTTTGCTGT
TCTGATTCAGTAATAATGTGCAGGCTAAACTTTTGCTACAATAAGATCATTCAGGTGTTC
TCAGACCTAGTTTTTTATCTACTCAGTTCTGTTCTTAGAAATTATGGTGATAGGGGCCGG
AACGATAGCACAGCGGGTAAGGCGTTTGCCTTGCACGCAGCCGACTCGGGTTCGATCCCC
GGCATCCCATATGGTCCCCCAAGCACCGCCAGGAGTAATTCCTGAGTGCAAAGCCAGGAG
TAACCCCTGAGCATCGCTGGGTGTGACCCCCCAAAAAAAGCAAAAAAAATAAAAATTAAA
AAATAGAAATTATGGTGATAAATAAAACAACAATAATAAGAGAAGTTGAACAATGTTTCT
AAAATATTTGGACAATTTCGACCACTTCTTTGAAATCTATTCAAATCTTTTGCCCACATT
TTGATCAAAGAGAGCTTTTAATTTAAAGTTGTATCTAAGTTCTTTACTTTCAAATGTCAA
GCTTCTGTCAAACTGATGTATAAATACTGTCTGCTACTTAGTAAGTGGTCTTTTGTCTTG
GTGATAGTTTCTTTTACTATATGAGAGCTTTATTTTGTATAGTACCATTTATTTATTCTC
ACTTTCGTTTTACCTATCAATTGAACTGAAACTCCAAATACATCTCTGATATTTAGATTC
TATATCAATTATGTATTCTTCCATGTTTGTAAGTTTTAGACCTACTATTCAAGTCCTTAA
TCCATTTCCAGTTAATTTGTGTGTGTGATCAGACAAATTTTATGTGATTGGATAGTGATT
TAATTTCATTTTTCTCCATACTTGTCCAGTTTACCCAACATTATTCGTTGAAAAGATTTA
CTTTTTTCTGTTGCATGGACAGCACTTACTGTCATGCTTTTTCCTAAATAATCATCATTA
TCATCATCATCCTGTTGATCATCGATTTTTTCAAGTGGTCTCAGTAACGTCTCCATTTGT
CCTAGTCCTGAGATTTTAGAAGCCTCTCTTTACTCCTCCTTCCCAATGGTGCCACATTGG
AGGCTTTTTCAGGGTCAGGGGAATGAGACCCATCATTATTACTGGTTTTAGCATATGAAT
ACACCACAGGGAGTTTGCCAGGCTCTCTCATGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved