Sorex_araneus Locus Mono:421:SNORD101
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:421:SNORD101
Sorex_araneus
Mono:421:SNORD101
scaffold_215071
SNORD101
1001..1074
2074
GCGGTATGAGTTATTTTTTTTCTGGGAAAGTTCATTGTTCAGCAGATTATCAAAATAAA
TAGCATAGAGAGAAAAAAAGAAGTGAAAGGGAAGAAGACATTTGAACTCCGAGGTGGTAA
GTTAACGCTGGGGCTAGGTTGGAAACTGTTTCTTATATTGACCCTAAGCCATAACACACT
GCTCAGATATCTAGTGCTATCCATCTGCACCAGACCATGCTCATCTCTGCAACGAGGACT
TCGGTTTTCTGATTTGTCACAGAAGGGGTTGGAGCTAGTGATTTCTATAACACCCAGAAG
AAAATACTTCCATAGTTTGCCATTGGATTTCTAGGTGCTATTTATTGCCTTAGGAAGACC
CAACACTTCCTTGTGCCAGAAGTAGAAAACTCCAGCCCAGTTCTCAGCTAGAGGCCATAT
TCAGCCCTCAGCACCCGACGTATCACACTAAAATAAAAATGATGTTAATTTGAATTAGGG
TGTATATGTGTGGTGTGAGAATGTCATATCTTTAAAGCAAGCTTCCAGAGTGAAAATCTA
ATTTACATACTGATAAAAGTTGAAAATTGATGCTTTCTAGTGAACAACATGCCCAAGACT
GGTCTTGCTTGATATTAACAAAATAGTGATCATTACACTGGCATACAGTTAGAAGGTAGC
ATAAACTGACTCCTAGAAATCCATTGAAACAAAGTCTTTCTCCATTTTTGGTTAGATAGG
CAGCTTATAGGTTTCTTAGCAGTCCTAAAGGCAAAAGCTAAAGTCATTAAATATTAAGAT
TTGACACTCTCCTATCAGTCAATTTATGCAGTATTTGATGAGTGCCCTGGGGTGTAAGAA
GGGAAATTCTCAAAGTTTGCAAAGTGATAGTTCAGGATATTCTTGGATGGTAGAGCCCAG
TACGAGGAAGGTCAAGTTTCAACTCCATCATTCCTTCTTGTATTATGAGATCTAGGCTGA
TCAGACTTCTACAAGTCATAGAACCATTTTTAAAAAACTGTATTTGAATTATGATTTTAT
TTTTGGAAACTCCTTCACTCCTTTTATAAATGAAACAAAAATGAAAATAATATATTGGGG
GAAAATTTTACATCTAGAGTATAGATAAGAATCTCTATTTAGGGGCTGGAGTGAAAAAGT
ACAGTGAGAAAGGCGTTTGCCTTGCATGTTCAATCCCCAGCATCCCGTATGGTCCCCTGA
GCATCACCAAGAGTAATTCCTGAGCGTAGAGCCAGGAGTAACCCTGACATCTCCAGGTGT
GACCCAAAAAGCTGGGAAAAAAGAATCTCTATTTATATGTATGCAAACCAAAAGAGAATG
GTTCCAAACTCATCTGTCTGTACTCACATCCAACTGTAATGAGCCTATGGAGGTCAAGTT
TAGTGGAGACTTTTTGGCTGAGCCCCAGATCAAACTAATTAAGGTTGATAACAATAAGAA
TCTAAAGAGGTGGGGAGGCCTCTGGAAAACTAACAGAGAGTGGATACCCTGGAGAGCAGT
TGATTGCACTTGGGCTATAGGCAAGGACTATGGCAAAGAATTCCAGGCTGAGGGTGTCAT
TGAAGAATCCCTCAAATACAAGAAATATGTAAGTTAACTTTCTGATACTTGTTGGAAAAA
ATCCAAGGAATAAAATTTTAATTACACAATGATACCAGCAATTTTAATTGACTCCTATCT
CCTGTGTACTTATCAGGCTATTTCAGTGCCAAGCATCTGCTGACCTTCAAAGATCTTTCC
CATCTTCTATTAAAGTGTGTGAATGCATTACCAGGTATGTGTGCCTCTGGTGTGTGTGTG
TGTGTGTGTTATCATGATTAATTTATAAACAAATGTTATAACAACCCAATTCACATTAAT
AATGTAGAAATCACCCAGGTGTCATTGAGGGATTAATGGATAAACAAAATGTGACATATA
TCAATGGAATATTACTCAACCATAAACTGGAATAGCATTCTGATACACACTACAACATGG
ATGAATCTTGAAAACATTATGCTACGTAGAAGGAGTAAGACACCAAAAATACCCACAACC
ATTCATAATTCCATCTATGTGATTACCCAGGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved