Sorex_araneus Locus Mono:487:SNORA70
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:487:SNORA70
Sorex_araneus
Mono:487:SNORA70
scaffold_228416
SNORA70
1001..1127
1930
GCAAATATTTATTCATATTTACCAGAAAGGTGGTTAAGAACATACAATGGACAAAGGGT
AGATAGATCTCTAAATAAAATGATGCTGGAAAAACTGGAGAGCCATAAACAGAAGAATTA
AACTACAACTGTATACTAGACACAAGAATTAAGTCCACATTGACTAAATACATGACCTGA
AACCATGAAATAGTGACAAAAATACAGATGGTAAGCTCCCTGATAGTCTAAGAGATGATC
TCAGACTCCAAAACCTAACTAAACTATTTGCCACAGAGGGGCTGGAGCAATAGCACAGCA
GGTAGGGCATTTGCCTTGCACGCGGCCGACCTGGGTTAGATTCCCAGCATCCCATATGGT
CCCCCGAGCACCTCCAGGGCTGATTCCAGGAGTGCAGAGCCAGGAGTAACTCCTGTGTAT
CGCCAGGTGTAACCAAAAAAAGCAAAAAAAAAAAAAAACACAGAAAGGAAATTATCCAAA
AAAAAAAGTCAACAAACTGAGTCAGAGAAAAAAAATTTGCAATCATATAGGTATCACTGT
ATCACTGCCATCCCAATGTTCATCAATTTACTCGAGCAGGCACCAGTAACATCTCCATTT
GTCCTGAGATTTTAGCAGCCTCTCCTTACTCATTTTTCCCAATGATTGAAGGCTCTTTTC
AGGATCAGGGGAATGAGACCTGTTATTGTTACTGTATTTGGCATATTGAATACGCCACAG
GGAGCTTGCCAGGCTCTTCCATAACCAAATAAATCACTGTCATCCCGTTGTTCATCGATT
TGCTCGAGCAGGCACCAGTAACGTCTCCATTGTGAGACTTTTTTTACTGTTTTTGGCATG
CCAAATACGCCACGGGTAGCTTGCCAGGCTCTGCCGTGAGAGCGAGATACTTTCAGTAGC
TTGCAGTAACTTTCAGGGCTCTCAGAGAGGGCCAGAGGAATCTAAACTGGGTCAGCTTCG
TGCAAGGCAAATGCCCTACCCACTATGCTATCACTCCAGCCCAACCAAATAAATAGACAG
ATAAAATGTTAATAGTGGTTCAGTGTACAATGTCTGCCAACAGCAGCCTCCTGGTAGTGT
TAGCAGCCTGTTACTGGTAGAATTGCCCTAAGGGACCCAGTGACAGTTCTGTGTGATAGA
TTTGTCCTATTACTATGCCCATATTAAGGCTTCAAACAAAGTGGGTAACATGTGGTTGAG
GCTCTACAGTGGTCCTAGTTCAAGTCCCTGGCAACCAGAGATCCATTATCACCAGGAAAA
AGGGCTTTATTGAGTTTAATGTGGATAACATGGTGGCTGACAAGAGGCTCATCTGAGATA
GCTGTGGGGTTAAATACATCTCTAACTCTGGGCCTCTGGACAAATAATGGGTACCTCAAC
ACTCCTGAGAGTGCAGGTGCTGTCCCTCCTGAATTCTTCCTCCCCGCAATGCCCCAATAT
ATCCTTCCAATCGTATATATCACAGTATCAATGTATCACTGTCATCCCATTGCTCACAGA
TTTGCTCAATCGGGCACCAGTAATATCTCCATTGTGAGACTTGTTACTGTTTTTGGCATA
TCAAATACGCCATGGGTAGCTTGCCAGGCTCTGCCGTGCAGGTATTGTAAAAATGAATAT
TTTTATTTTGAAAGAACTTCCTCCCTTTATGCAACTACTCAATGTTAAAAGTGATCTATT
CTATTTGCTTTAGTCAAATTTGATAAACCAGACTCTCTCTCTTTCCAGTCAAATGAAATA
TTTAAGTTAATAACTTGAAGCTATCGGACTAAAAGATAAAATAATGATTAAATAGGCATC
ATCTTAGAGTTTAAGGAGGATTATTATTAGATTCATTAATTTATTTCAAAATTATTAGAT
TTATTAATTTTGAATATCAAAAAGGGTTTATGTGAGATGCTTAAAGTTGATTTTGAGGGA
AATATGATTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved