Sorex_araneus Locus Mono:392:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:392:SNORA58
Sorex_araneus
Mono:392:SNORA58
scaffold_134560
SNORA58
1001..1124
2100
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAAGCTCCAGAAGAGAAGACTGCAGAATGTCATGACCGCATGCCAGACTG
TCTTCCGAAGCACTCGGAGTGGAGCGGATGAGTTTCCCTGCCTGCGCCTAAACAGAATCC
GGCAGCTGAAAACTCCAGAACGCAAGCACCGCCATGTCCAACGCCACTCTCCACTACTCG
GACGAGCCTCACGCAAGAGGGCACAAGCCTCACCCAAAACAGGATGAACCTCACCAGAGA
GCAGACTGGCAGGAAAACCCAGATATGCAGGAACCCATGACTGAGATCTCCAAGCCCGCT
TGGATTGGGATAGAGTCTCCTCCCCCAAGGTCCCCAGTTTTCCAGTAGCTTGGCAGTCAC
ACCCACAAACTGCCCCTGGTGCCATATAATCTTATCAATGGCCAAGGCCCAGAGACTATA
AACTAAAGCTCCTGGAAGAGAATGACACAGAATTTCCTGGACATTATATTCTATCCATAA
CAAGCAATACAAAACAAATCATTTAGCATTGCCTTTTCGGCAGGTTTGAGTGGTGGTGAG
ACTGGTGCTGATATATTGAATGCAACCAAAGTAGAGAGAGAGTATGGGGGAAATTGTCTG
CCACACAAGCAGGGGAAGGGTTGGAATGGGGGATGGGGAATACTGGGGATTTTGGTGATG
GAAAGTGTGCACTGGTGAAGGGGTGGGTGTTTGATGATTATATGACTGAAGCTCAAACAT
GAAAGCTTTGTAGCTGTATCTCACGGTGAATAAAAAAAGGGGGGGGGAATAATAATAAAA
TAAAGTTAAGACTTAGAATAGATAAAAAGAAAAAGTAATGGGGAGTTCATGCCCAATTCA
ATCAGCTTAATCAATGGCTGAATAAATAGCAGTACTCCTACAGTATATATATAAAAAAAA
AAGCCGACTTGCACTGCACCCTGGAAGGTAATTTAAGAGACTGAGCCGGGGACTTCTGCC
AATGTAGACATGTCCACTGAAGCACCTAAGAACCAAACTAATTCCCAACAAACCCTGGGA
CTAAACTGTCACTTCAGTTAGGACTTCTGGGAGTGCCTGCCCTTTTCAGAAAAGAGTTAT
TTCCCAAGAATTTTAAGAGTATTCTATAGTGACTGCTTTTCTTGCACATCATGTGTCTGA
AGGACACAGTAAAATATGAATAAGGCACCAAGCTGGTCCAAGCAAGCACAGAAGAGCCGT
GAGAGCACAGGGCACATGAGTCAGTGAGAAGCCAGAGCCTAACGCTGCACAAAGGAATGT
CAGTGGCAAAAGCCAGAACTAATGCTGCAGGGTCTGATTAGGACACAGACTAACCAGCCA
CCAGAAAGCGACTATTTTCCTGGACACAGTTCCAGGGCTTAGGTTTGGCCTAGGTATGCC
TCAGAAAATTAAGTACCTGGGAATCAGCTTGACAAAGGAGCTGAAAAACTTACACAAAGA
AAATTATAAATCATTACTAAAATAAATAAAACTAAAAAATTTCCAGGAAACTGAAACACA
TCTCCAAAGCATTCTATCGATTCAATGCAGTCCCTATCAAAATACCCATGACAGTTTCAG
AAAACATGAAGTCATGAAATTTGCATATAAGTGGATCAACATGGAAAGTATCATGCTGAG
TGAAATGAGTCAGAAAGAAAAGACAGACATAGAAATATTGCACTCATATGTGGAATATAA
AGTAGCTGAGAGCTTACAATGTTGCGATTTCTGGCAGATATTTCTCTGGACTTAGTTACT
AAAATATTAAAATACAGAAATCCAAAACTGTGCGGCTGCTAGTGCAGCCTCCTGACCTCA
TATCTCTTCATTCTCAGCAAGTGGAAAACAAATTATCTAATGCTTTCTTTCAGCAGGTGA
C
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved