Sorex_araneus Locus Mono:4:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:4:SNORA58
Sorex_araneus
Mono:4:SNORA58
scaffold_9113
SNORA58
1001..1130
1138
AAAAGGGGAAAATAATAATAAAATAATAAAATAAAATTAACATTCAGAAAAGAAAAAAA
ATTAAAAAGTAATGTGGAGTTCATGCCCAACTCAGTCAGCTTAATCAATGGCTGAATAAA
TAGCAGTACTCCTGCATTATAAATAAATAAAGGGGCTGGAGCGATAGCACAGTGGGTAGG
GCGTTCGCCTTGCACGCGGCCGACCCGGGTTCAATCCTCGGCATCCCATATGGTCCCCCA
AGCAGCGCCAGGAGTAATTCCTGAGTGCAAAGCCAGGAGTAACCCCTGAGCATCGTTGGG
TGTGACCCAAAAAGCAAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAGAT
AAATAAATAAATAAATAAAGAGGCCCACGTGCCCTGCAGGCAGAATCCCGCTCAGGCCAG
CCCCAGAGGCTACAAGCACGGGCTGGGTGTGAGCGCCCCCTTCTGGAGGACCCAAGCGGG
ACCAGACTTGTTCAAACATCCATTGAGACATTTGGTCAAACCAAAAGGGCCTTCAGACGA
CTCCAGCCGTTTTTTGTTTCATTTAGCGCATATATCGCTCATGCTCTATGGAAGAGTACA
AACCTTTATCTTCATTACAATTTAATTTAGGTTACCTTTATTGTAATTCATGATGACTTT
ACCCCAAATTCTTTTTTTTTTTTTCTTTTTGGGTCACACCCGGCAATGCACAGGGTTTAC
TCCTGGCTCTGCACTCAGGAATTCCCCTGGCGGTGCTCAAGGGACCATATGGGATGCTGG
GAATCAAACTCAGGTCTGCCGCGTGCAAGGCAAACACCCTACCCGCTGTGCTATTGCTCC
AGCCCCATACCCTAAATTCTTTTAAATAATTTTTTATTTACTTAGAAGCATTTAGAATGT
CAATAAAATAGCTGCATCTTTTTTTGTAATTATGGAGTGACTGAGTTACTGGAGGAATCG
TTTCATAAAAGCAGCAGCAGAAATGAGAGAAAAAACGTGTTTGGTCCCGTCCATGCCTGC
TCTGTGCCAAGGCCCACAGGACTGCCTGAGGGCCCTTCCTGACCCTCGTACCATGGCGAG
CAAGTGCCGGACAGACGCCCTCAGCCATCCAACCTGGGCAGGAGAGGCGTCAGTCACCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved