Sorex_araneus Locus Mono:587:SNORA7
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:587:SNORA7
Sorex_araneus
Mono:587:SNORA7
scaffold_236766
SNORA7
1001..1139
2139
CATCCCTCTTCTATGCAGCCTTTTTAAATAATTGTTTCACTATTTAAGTTANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACTGTCACTGT
ATCACTGCCATCCATTTCTCATCGATTTGCTCGAGCAGGCACCAGTAATGTCAAAGTATG
TTATGAATTAATCCAAAGCATATAATTTTCTGTACAAAGAGGATATGAGAAATGTATTTC
ATTTGAAATAATTAACAGTTTTATCAATACATCTTTAAAATTTATTTTAGTCACTAAGAA
AAACATTAGAAAAAAATAGCATTATTAAAATATCATGCTGATTGTCAATAAAATGCACTT
AAATGTGTTAAAAGTAAGAGAAACTGAAAATAAGATATGCACTGAGAAATATATTTTTCT
TTATTTTAAATAAGACTGTAATAATATTTTTTGTTGTCTAAGAAGAAAATACCAAGAAAT
ATTTAAATTTTTTTTCTAATATTACCTAAATATAAAAAAATTATTTTTAAAGTTTAGAGT
ATTAGCCTATAACATTTGATCAGGATCATTATGATTACATGTGAAAATTAAACTTCTGGT
CATTTGTTTTCCATCTTTTAAATTCATGCAATAGACATTTCTGAAAATAATAATGGTGTA
TGATGTAAAATAAAGGAAATATTCAGGATCTATTAATTCTTTGTCTCTGAGAAATAATGA
TGTATTACTTGGTATGCTTTCCCTTTGAGAACACATAAACAGACCTTTCAGAAATGTGTC
TGGAGAGGGTTTTGTATGCTGACAGCTTCAGGTTCTGGCGGGAATTCAATCCTGTCAGAG
GCATCCACTCCAATCCCAGATGGCTGTGTAGCTGGCGATTGGAAGACACATGTCCCAACC
ACGCAAACATGTTTTTAAATTTTTAAAGGTAAAAGCCAATAACTTGAATGATGTGTCATA
AGCACGCTCATTTTTAATTAAAAATATTACTACAGTGATGTCTCCTCTATTTGACCCATT
GACAGTGGGCTGGAGCGATAGCACAGTGGGTAAGGCATTTGCCTTGCTCGAGGCCAACCC
TGGTTTGATTCCTTCGCCCCTCTCGGAAAGTGCATCAAGCTACCGAGAGCATCTCGCCTG
CACAGCATAACCTGGCCAGCTACCTGTGCGTATTCGATTTGCCAAAACCAGTAACAACAA
ATCTCTCAATGGAGATGTTACTGGTGCCCGCTTGAGCAAATCCATGAGCAATGGGATGAT
AGTGATACAGTGATACTATAGTAGGACTGGAGCGATAGCATAGCCGGCAGGGTGTTTGCC
TTGCTGTGGCCGACCCAGGTTCGATTCGATTCCTCTTCCCCTCTCGTAGAGCCTGGTAAG
CTAAGGAGAGTATCTCACCCGCATGTGAGAGCATGCGAGCTAACATGGTGTATTCAATAT
GCAAAAAAACATAAACAAGTCTCACAATGGGGACCTGACTGGTGATTGCGCAAACAAATC
AATGAACAACGGACCACGGTGCTACAGTAGGTCAGCCCAGTGGTTAAATGAAATTTATAT
TTAAAGACACTTTCCTATAATAATGAGAAAGTGATTTTCATATGGGCCGCAAATAAAGAA
TACGGTGGCATACTTTGACTCCCTGAAGAAGGGTTTAGATATATTGTAGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved