Sorex_araneus Locus Mono:831:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:831:SNORD113
Sorex_araneus
Mono:831:SNORD113
GeneScaffold_452
SNORD113
1001..1062
2062
CTGCTGTTACCATTACATATGTGGAAAAACTTTTTACTTTTAAAACCTTTTTATCTGAT
TCTATAATCAAATGCTACGGAATTAAACTGATACTACAGAGGAGTTTCAAAAATAGGCAA
TCCAGGTTTATTCAGTAATTAGTAGTTCTAAAAACATAGCAACTATCAAAATTATCCACA
ATTTTGAAACAATCTGGCTTCAATGTAATTTTATAAAACTGACATACTGCAAATAACTTT
TGCTTAAAGACATAAGTATTTTCTTATGCTAATAAGTTTTCTTATGCTAATAAAAGCTTC
AGTGGTACATTACTCTTGTATTCCACTTTAAAGATAAGAAAATCGAGGCTTGGAAAGGTT
AATCAACTTGCCCAGAATATCTATAAATTCCCTGGAGGAGCCCCAACCTGATGAGAAACC
TGTAGTCCTCAACTTGGGTATGTTTCCCTCTAGGAGTACCAGGGAATACACCTGGGTATG
TTCCCCTCTATGAGTACCAGGGAATATACCTGGGACTGTTTCAAAGGACTTTCTATATCT
ATATGTCATCTTTCCTAAAATTCATCTTTGAGAATGCCTTCACATTCCACAAGTCCTTTC
AAACATTCTCTTTCACATTTACTCTTATCTCATGTAATCAAGGCATATGCAACAATATGG
TCAAATCTTAGCAATATAATATCAGTAAGAAAGGTCATTTCCAGAGATTACAAACAGCAT
GACACCCTATGATAAAATTAAAAACTAAAATTTTAAAATATAACTTTTATGAGTACATGT
AGATGGCAACAAAAAGTATATACAAAAGAAAACAGGGATGATGATGATAACTATCTCAGG
TGGAGGGAGGCAAGAAATGGTTGTGGGGGAGGGAAGGGAGGGCATGATAGGATTAAAGTA
GGTCATTTTCAAGGTCTAGCTTTACTTTGGTAGCTTCATGGCTGCTTATTAACATTACTT
AAAATAACTAACTTAAAAAAAAAAAAGAGAGCCATGCATGGTGGACCAATGATGAGTGAC
ACAAGGATTATGATTAAACCAAGTCTATGCACCTGAGGTCCAAAAACGAAACAAAGGCAT
ACCTCTCAGCCATCTTACTATGGTGCATTGCCTCAGCGTGTAAAAACCTCCTGGAGTAAC
AAACAAAGGGACAATTTGAAATATTGATATTGGGAAGCTTTAAGGCATTATAAACCCGCC
AAAGACTTTCCTCTGTGTGTGTGTGTTTTATGATGTGACTTAATCTGTTATAATATCCTG
AATTCAGATACTCTGCAGTACTATAGATTTGGGTTACTAGAACAATTTTACTTCTTCCAT
TCTGATGTTCAGAGAATGAATTTAATTTTGTGAGGGAGTTACATGAGAATAAAATTTAAA
AATCCACTAAAAACGGATCTTGATTCTCTCCCACAATTTTGAAGAGATAGTTAATGGACT
GAGTGGATGATCAAAACACTCATCCCTGGAACAGATAAACATTACTCAACAAAGAATTAA
AAAAGAGTATATGTTAATGACTAGTGATGCAGACTCTTAGATGTACCAGGAATAGTTGCT
AGGAGGACCAAATTTTTAAGTGCTTTTCTGAAGGTTCAAATTCCAGCTCACTCACTTAGT
CCCATCAGGCAAGCAACTTGACCTCTGTGCCTCAGTTTCTTTATCTTTAAATATGGAATT
AATCAACAAAATCTGCCCTCGTGTTAGAGCTAATATATACTAGCAGATGTAAATGCTGAA
TGGTCTCTCACAAAGTAGGAAGTATATTCATATTTGATCATGATTATTTTATAAACCGTT
GACTGTTTTATACTTGCCATTTAGAGAGAATAAAATGACAGGTCATCTACAAATCCAATT
CACTTTTTAGCAATTTATACTTTATTAAATATATCAGAAACATTTGACAGATAATCTATA
CAATTAGTGGAGTTATTCAGAATTTTTTTTAAAAATTCCTGGCCACACCCAGGGCTCTGT
GCTTAATTCCCTTAATCTTTTTCTATCCTACTCCCATTTGATTATTACTAAAAACTTCAT
CATAAGAAATTAATATAGTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved