Sorex_araneus Locus Mono:268:SNORA71
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:268:SNORA71
Sorex_araneus
Mono:268:SNORA71
scaffold_183919
SNORA71
1001..1131
1592
AGCCTGTGTTCTTCTAGAACATGTATATTTGCTTTTTCTTCCACTCTGGAGAATCCTAT
GTTCTCTCCTGAGTTTGTACTTCTCTTTCTCTCCCCTCACATCTTTCTAAATAAGTTCCA
ATAAGAACTGACTTGATTCACTGTCACTGTCATCCTATTGCTCATCGATTTGTTTGAGCG
GGCACCAGTAAGGTTTCTCATTGTGAGACTTATTGTTACTGTTTTTGGCATATCGAATAC
ACCATGGGTAGCTTGCCAGGCTCTGCCGTGAGGGCTGTCCGAGAGGGGTGGAGGAATTGA
ACACGGGTCGGCCGCGTGAAAGGCGAACACCCTACCGCTGAGCTATCGCTCCAGCCCGAC
TTGATTCACTAAATAAATAAATAAATAAATAAATACATAAAAATTTGAGAAAGCATGTCA
AAATAAAGTAAGAAGAATATTTTAGTTAAATTTGAAAGGGTCCCCTGTATTCGAAAGTGA
TCGCTGGCTGCCTGTGCCCCGGTCATTGATAGTGCAGGAAGAGAAGTTGATGAAAGCCTT
TCCCCGTGTTTGGGGGGTCTCCTGTCCCTTCCAGACCCTGGTGCTTTCGTACAGTCTGTC
CCACGCTGCTCCCTGCAGGGTGCTCCTCGCTCCCATGCTGCTCCCTGCCAGGTGCTCACA
GCCCGCAGGGTGCAGCCACTGCCCTCCAGGTTGTCTCTTGAAAAAAAAAAATTTGAAAGG
GTATTTAACATTTTTTAAAGTAAAATTAGGATTGAAGAGCGTCCTTTTATATATTTTTTT
ATTTTGGTGTTTGGGTCACACCCTGTGGTGCTCAAGGATCATTCCTGGTGGTGCTTCAAG
GGACCATATTCAGCACTGGGGATCAAACCAGGGTTTGTCGCCTCAAGTACTTGTGCTATT
TCCTTGGCCCTAACTTTTTTTTAATGAAGTTTCTAATCTTCTCTTGACCTGAAAAAGATT
GGTGTTGTGGAATGGGCACAGAGCTCTTAAGCAGAGGACAGGGCCACTTCTGGTGGTCGG
AGTAGCCTCCCCCAAGGGTTCAGTGTGAGGGCCTGAGAGTGCTGAGCTACCCCCACTCAG
TCAGCCCCTCTAGTGTTGGGGGATCAAGGTTGCATGGCCACTTGACCTCAAGCTTTGGTG
GGGGTGTCGCCCGCACAGCACACAGAAGCCTACACCCCTCCTTGAAATCCTCTGCCTGCT
GGGCCAGGGGTTCACTGTGAGGGTCGAGCAGTGCTAGGGATTACCCATATCACCTTGGGG
TGCTCAGGGGCCTCCAGGGCTGCACGTGACAGTGTCCCCTTCATAGCAAGGCAAGTACCT
TAATCTCTATGTTTTCTTTGTCTCAATCTTTGACTTTTAACTTAATATGTTTTAATGAAG
AATCTTGATTACTTTGAGGTTTTATTTCAAAATGTCTAGATTTTTCTGGGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved