Sorex_araneus Locus Mono:771:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:771:SNORA58
Sorex_araneus
Mono:771:SNORA58
GeneScaffold_6149
SNORA58
1001..1106
2106
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACCC
AGCAGCTCGCTGCAGAGATAGCTCCCGGATTTCTCCTCAGACGGGGGCAGACCACCTCCA
CCTGTCCCCAAAAACCTTCGGCAGTCGCCAACTTGCAGAACCCCAGTGAGAAATGCAGGT
ACTCGGGTCCAGTGATGGCAAACTCCAGGCCTTAAGGGATAAGGGATGGGCTGGCCCTTC
TCATCCCCCCCCCCCGCCCCATCTCCATGGGACCCTGGAGGTCACACCCACAAACTACCT
CCAGCTGCTACTTGAGCTCCTTAACGACCATGATCCAGAGACACACAAGGAATCTCCGAA
CCCAACAGCTTGCTGCAGAGATTTCTTCAGACCCTAATTAGCTAAAATTTTAGAATTCCA
GGAGCACATGGCCTCTCTCACAGCCATGTAACATCTTATGCTATTCATAACAAGCAATAC
AAAAGAGAGTATGGGAGAGATTGACATAGAGGCAGGGGCAGGGGGAGGGGATACTGGGGA
CCTTGGTGGTAAAAGATTTGCACTGGTGGAGGGTTGGGTGGTAGATCATTGTATGACTGA
AGCTCAAACAGGAAAGCTTTGTAACTATCTCACAGTGATTAAATAATAATAATAAATATT
CTGAATTTTTTAAAAAGTGATGTGGAGTTCATGCCCAATTTAATCAGCTTAATCAATGGC
TGAATAAATAGCAGTACTCCTACATTAAAAAAATAAATAATAAATAAACCCCAGTTCCTA
TATGTGCATTACCAGGAGAAACTCTCTCAGCCTGACTCCCACGTCTACCTCCTAGTGGGA
GGCAAGTTATTATTGTGCTCTCAGATGTCTCATGCCTGCCTCATTCACCGGCAGCCCTTT
ATTACCAGCATCAGGTAATGTACCAGCAAGGACCACACTGGACAGTTGCCTCACCATCAC
CACTGTACTGGCATGGACAGGCTGACACACTGAACTCTCTCCCCACCTCCACCCCATGAG
CAAGCCCAGCAAGAGAAGTGGAGAGAGACCAAACCTCTGTCACAGCAGCTGAACAGTCCT
TAGGGGAAAGGCGGTGAACTAGACAAGAGACAAAGGTTTCGGATGATTGCCTCTAAGGGA
AGTCCCTGCATGGACTTAATTTAGCTAAGGAGCCCCAAGGGCTGTTCCTTGGCATTGTGA
AATTTTCTCAGATTCAGGACCAGAGAGAAAGCTCAATAGGCTGGGGACATGTTTTCACAT
GCAGGAGCCTATGTTCAATCCTCAGTATCCCCAGAGAACTACTGGGTATAACCACCAAGC
AAAATCATGGACTGTAGAAGAGCAAAATTATTGGGAAAACCCAAGTATTACATGCTTGGG
CCACTAAATAGAGATTTTTCAGGTAAACCTATTCCACAGATAAGAAGACAGAATCACGTG
TGAGCAATGGAGAGGCCACTCCAACTCAGGGCTCCGGAGCTTGGCGCATGGCCCAGCCAA
ATTCCTACTTCTGGGTGCTGGGAGTCTTCCCTACTGAGCTTAGTTAGTCCAAAGAACCTA
ATATTCACAAGGAAGAGAACTAGTAATAAAGCTTTAAGAAAGAAAATAAGAGTAATGAAG
TATTAGATGAGAGAAAAGTTTTATTAATGATTAGAAAAAATGGGGGGAGGGAGGAAATGA
GTTATAACAGTGGGATGCGATGAAGACATTAAGTCTTACCAATGTAGACTGCGAGACCAC
TGGGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved