Sorex_araneus Locus Mono:427:SNORA31
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:427:SNORA31
Sorex_araneus
Mono:427:SNORA31
scaffold_217298
SNORA31
1001..1129
1421
TTATGATGGTTTGACAATTAAGAATTGAACTGCTTTTAGGAAATTAAAAGTATTCTATG
CGAGGAACTGCTGGGAGGTAGTAGAGACATTTATTGTCCCACCTTGCAAAGGCCTCACAC
AAATTTAGGAACAAGATAAACTTGAGACTTATCAAGATGAGGCAGTACCAGGTGATTTAT
CCAGGGGATTATCTGTCTTGAAGTTTCAGATGAGGAAACACTCGAAAATGAGGCTTTGCT
CAGAACGAACTTCTTGGAAAATATGCCTCCTTACCTTTGGTTTTAGGCTGATTCTGCATC
CACTGATAGACCTTGAACAAGTTGCTGTTGTTCATTTGGTTTGCACTAGGATGCAAAAGA
AAATAATCCCAGCGCTTTCTGTCTGCCTCTGTGGCAGCCAGATTGAATAGGGGAGAACAT
TGCAGTCAGATACTCTTATTAAGTGCGTTCGTACAAAAAAAAGTATTGATTCCTTTTTCC
TTGTTTTTACAGTAACAGATTTGGCAGTTACTTCGGATCTATCACCTGTCATCATAACCA
GCTGCTGCTTTCCATCTACACAACACCAGGACAGACAACAGGGACTGATGTCATCTTGAG
CTCTTCATTTATTTTGACCTTGATTTATTTGGAGTGGAGGCATTGTTTTTAAGAAAAACA
TGTAGGTTGTCTTAAAATAAAAGTCACTTAAATTCATTTGAGAGACTGGCTCTTAGTTTA
ATGCCTATTTAAATTCCATTCTGTAATAGTGCTCCTGGAGAAAGCTAGAGCCTGGGTGTA
GACCACTACTAAAAAGCATAAGACTGTCTTCTGATTAACTTCTGCAGACTACATCTGGGA
CTGGAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCTGTTTTTGTAAGACTCCAAGG
TGGTGTTGATACTTAAATGTGGGATAAAATCAAAAGAATGGGATATAAAAAATTGCTGTG
AGAGTTAAATGTGGGTCCTGTTCATCCACACTCATTCACTATGGACTGACTCAATCCTGA
CCCTTCAAGAGCTCACTGTGACCACTCAGGGCAGCAACTGCTAAAAAGAGCCTATGGGGC
TTTCTAGGGAAGATGCTGGCGTCTATTTTAGCTGATGGTAGAGGAAAAGATTTCTGTATG
GGAATGAGTGTGACAATGCGTCAGTTTGACAGACCAGCAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved