Sorex_araneus Locus Mono:6:SNORA43
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:6:SNORA43
Sorex_araneus
Mono:6:SNORA43
scaffold_246350
SNORA43
1001..1142
2142
TGGTGTATTAATATGCCAAAACCAGTAACAAGCTGGGTCTCATTCTCTTGACCCCGAAA
GAGCCTCCAATGCAGAATCGTTGTGAAGGACGAGTAAAGAGAGGCTTCTAAAATCTCAGG
GCTAGGGCAAATGGAGACGTTACTGAGACTGCGCGAGAAAAACAACGATAAAGGGGATGA
TGATGATGATGATGATGATGATGATATTTATTAGTAATCTGTGAACTATTTAGAGGTGCA
AAATTTGAGCACAGTATTTTAAAAAAAGTCTTATCTTCCAGTTAGAAGATAACTTTAAGT
GGTTGGGGGAATGTGATGGTAGTATTTTTGTTTGTTTGCTCATTTTTTTATTGAATCACC
GTGAGATGCAGTTACAAAGTTTTCATGTTTGAGTTTCAATCATACAATGATCAAACACCC
ATCCCTCCACTGGTGCACATTTTCTACCACCAATATGGTGTTTTTAAGGAGTCCCATGGT
TGTAGAGTCAGCAGTAAGAGCCTTAGAGGAGAGATGGTGGGGTTGGGGTGAGGGTACTTT
CGGGAGAGATCTTTGCCAAATGGCTTTATAAGGAAAGCTGCACTGACAGCACAGAGCCTG
TCTGTCCAGGCACAAGCTCTTACCTCTTTAACCATGAAAGAGGTCTCTGTCGGGGCTGGA
GCAATAGCACAGCGGGTAGGGCATTTGCCTTGCACGCGGCCAACCTGTGTTCGATTTCCA
GCATCCCATACGGTTCCCTGAGCACCGCCAGGAGTAATTCTTGAGTGCAGAGCCAGGAGT
AACTCCTGTGCATCAACAGGTGTGGCCTAAAAAGGAAAAAATATAAAGAGGTCTGTCTTT
CATGGACAGTCCTGTGGGGGACTTTGCCACTTCACAGGCAGGGCTTTGGACTGCTTTCTG
GCAGCCACACAATGAAGTTGAGCCTGGAAATTTCAGAGAGATCAACCCATCATCCTAAGA
TGGAGCTGAGAGAATACCTGGGTTAAAATATGAATAGTTCCAGTGCCCTGCGGATGCTGA
GCTGAGCGCCTCAGACATGGCTGCCCGGATGCATCTGTGACAACAGGGCACACAGTAAGT
GGCTATTTCTACGCTCAGTGTCCAGACCCATGGGCACTAAGAATGGTTTGTAGCCTCACA
TTGACTCAGAAAAAGGTATAGACAGTTCCTCTGTTTTATAGAGGATTGAGAATCCTTGAA
CACCTGATGAGGAGGTGAGGAATGATTTGGAAAATAAGAAACGACTCTACATTTAAGTCA
TGTCCAAAACCACTGGAACAGTTTATAGCAACCTTCATGAGAAGTCTCAACCTGATGGCC
CATATTTGGGAGGGATGTTGTCCTTTGATTTGATCGACAGCCTTTCTTGAGCTTCCTTTT
CAGCATCCACGTGGAATGTACCATTGCCTGTGTAATATAGGCCAGGCCTTGTCATTTGTT
ATTGTAATAATGCCTATTGCCTTGAACATTATTAGACAGATGTTTTTGTTTCCCGGGAAC
CTGAGAATCTGACTTAGCTGACAAGTGAGAACCAGCCTGTGCCAGGTGGTTCTCTGCAAT
CTGTGGAATACCGGAGCAATTACAGTAAAAGCCAGCAAGCACCCCTTGGTGTGATATTCC
GAAATCCATCACTCTTATCACCACACTACCTTATCTTTCTTATTTCATTTGTAACAAGTT
CTGATCCCGTTGGCTGGGAGGGATTCACTGACTCACACACCCAAGCCTTTTAGAGCCCAG
ATTCTGAGTGCTTCTGAACACAGAATTGGCTGGGAAATACCTTCCAACTGGGTGTACATT
TTCCACTCTGCCTGACTGAACACTGCAAGGGGGTTCCTGGGACACAGAACTCTCAGAGTT
AAAAACAGGAACAATTTCCCAGCAAATTATGGTCACCATCATTCCCAACACCCCATTCTC
CCCCTTGCACACAGCTGTGTGATGTTAATGCTCACCTAATTGGCTGCTGATTGCAGTTGA
ATTTGAAACCTTTGTTAAAAAAAGAACTGGGTGCATTGGGGGGAGTTGTTTAGACTTCAG
CTCCAGTGCTTATCAACCCTGAGAATGGACATTGCTTCTCTCAGCTTCCCATTGTGACAA
GTAAGAATAATAACAAGCCATGGGGCTAGTAAAGGTTACATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved