Sorex_araneus Locus Mono:24:SNORA53
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:24:SNORA53
Sorex_araneus
Mono:24:SNORA53
scaffold_253785
SNORA53
1001..1235
2235
TACTAGAACTGTGCTCTATGATTTAGCTCTGCTGATCCACTATTATTTCTCAAACAAGA
GAAGATTCAATGAATCCCCTCCCCCGAAAAAAAACAAACAAACACTGCAATAAAGGAAAG
AAGGAAGAGGAGGATGGTGTTATCATCTCTTTTGAGTTATCATCTCCTGGAAGCCAAGCA
ACTCTGTACTCTGTGCTCATTGCTGGTCTGGATGAGAGGCTATCAGCCTCAACATACCTT
TCATACACTGATGGATGACCTGTGAGATGAATTACTAGCACACTTCTATTTGATAGCATT
TGTAGGAAAAGAAACATAATGTCAGAAGAAAATATATTTTTAGGCAGGAGTGATTCTGAA
AATTAACATATTTACGAATCTCCATATTGCCTTCACTGGACCTGAAAAAAATCATTAAGT
CATTTTAATAGAACCGATGATTCCATTAAAAAAGATTGAGCTTTCATATAAGCCAGCAAT
TCCATGTCTTAGCATCTACCCCAAGGACCCCAAAACCCTACTCAGAAAAGATGATTTTAC
CCTATATTCATTCAGCACAGCACTATTCACAATAGCCCAAATCTAGAAACAACCCAAGGC
CCCTGGATAGATAGGTTGAGTGAGGAACAGTCTGGTGGAGAGTATCATGTTGGAATATTG
TATGTATGAATCCTAATCATTAAACTATTGTAAATCATGATGCATAAAATAAGCTACAAT
CTTTTTTATTTTTTAATTTTTATTTATATTTTTGCTTTTTGGGTCGCACCTGGCAATACA
CAGGGATTACTCCTGGCTGTGCACTCAGGAACCACCCCTGGCGGTGCTCAGGGGACCATA
TGGGATGCTGGGATTCAAACCTGGGTTGGCCACGTGCAAGGCAAACGCCCTACCTGCTGT
GCTATCACTCCAGCCCCTACAATCTTTTTTAAAGGAAAAGAGAGTAGTTCCCTACTCTCA
ATCCTGATATGGCCAAAAAAAAGAAGTCATAAGAAATTTTCTGGATGGTGGGTTGAATTC
TTGTTTTGTTTTGAATAGGAGGAAAAGCTGTTTTTGTGTTTCTCCTTATACTATGCTCAA
TCAGCTAGTCATTCCATGGCTTTAAGATTACAATGTACTTGAGTCATTGACATGTGAGAT
CAATATACCTGCATGTTAGTCTTAAGTTCTGATAGAAATGACATGCAATTATGCTGCCAA
ACTTGACTATCAGGACGTGACTGGTGTGCAGACACTAATAATGAAAATTTCTGCTTGGCA
ATGGCAGAAGTTAAGTCTCCTATATTCTATAGAGGGATTATGTAACATAGGATTTAGAAC
CTCAAGGAATAAATGCTTACCTCTATTGAAAAAAAAAAAGATTACAATGTAAGCCCATTA
TAATAATATGTGTATGGACGGGGTGGGGCGGGGAGACAAAACAGTGCCACTAGCTATGAA
GTCTTGACTTATTCATCCACTTTTAATCATTTGTTTGTTTGGATGTCTGTGTAGACACGA
TCAAGGAACAGTTCCTAGGATTTTATGGGATTTTACTGAAAGAGAGTTAAGAACTAAGAT
TGTAAGGAGAATCATACATTATTTCCAAGAGGAGAGAAGTCAAAATAGTTTCTGGGTAGC
CCAAACACAGAGCAGTTATACTGTAAGCCAAAAGTTAATTCTTAATGTGCGTTGATAACA
GAAATAGCATAGATAAAATTCTTGGTCATTTAGAAATGTAATAATAAACATATAAAATAT
AATATAAATGCATACTAAAATATCAACATTGCTGCATCTGTACACATCTTTTAAAGCAGC
TGCCATATTTATTATGCAATTGTGTTTACATGCTTTTCTTCCCATTAGATTACATGCTCC
CTTAAATCAAGGATCATTTCTTTTCATCTTTGCTAAGAATCTCTAAGCTTTCTTGCTTTC
AAGGTCAGAATCAAACTTAGATAGAGTCTAACTATAAATGCCTAGAAAATACATTTTTGA
CTCTAAGATCTTATTTATTCTAAGCAGCCCTACTTTTAAAAAAAATCAACAAATGTTAAC
ATTTCCAAACTATCCCGAAGGTAAGAGAAAATAAAAATTAAGTGGCATCAAGTGATATTT
ACCTTCTCAAGCCATGACAATCCAAAACAAATGAATGTGGCAGCTCCTTTTACTGATCTA
TAAGCTAAATTCAGTACCAACTGGAAAATTCTAACATCCTTCCCCATGTCATAAAACACA
CCAGCTCACCAGTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved