Sorex_araneus Locus Mono:461:SNORD38
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:461:SNORD38
Sorex_araneus
Mono:461:SNORD38
scaffold_257179
SNORD38
1001..1067
2067
GTTTGTTTTTGTTTTGAGGGTTACATCTAGAGATGCTCAGGGCCTACTCATGGCTATGT
CCTCTGGGTCACAGCTGCTCAGGCTTAGGGGACCAAATCCTGTGCCTAGGATGAAACCCC
CTTGTGCCCAGTGAAACAAAGGCCTATCTGTTGTACCATCTCTCCAGCACTAGTACACTA
TTCTTTATTTTTTTTTTAGTAAACTTGATTCATTAATTAATGTTAAAGTAATTTTATAAA
AACCCTTGTATTACGTACTTACTAAATGTAGTTATTTAAATTAGGGTCATATTTCCAAAA
GAGCATATGAAGATAATGAGAAATAAAGATATTTTAGAGATAACATTGAACAGAACAACC
TCTAATCAAGTTTACTTACTTTGGTTCTTATCTCTTCAGTATATCCCAGAGGAAATCATG
TGACTTGACATTGCATCAAACTGATGTCATCGCTAAGACTTAAAATATATGTATACAGTA
ACATTGCTCTATATCTGCTTTTAAACTGTTACTTCAGTAACTTCTTCATAATTCACCATT
TAGATATAACCTAATATTTATTCTACAGTTTATTATTAGTTTAACACACATTTAATGTCT
CCTTATATTTTGTAGAAATTAGAATAACTAAATTGCACATTGCAAGTGGAAATATATTTC
CCCTAAGTACAATATATAGATGACTGTGTAATTCATTTACTTAAATATCATGTTTATATT
TTTCTCTATATCTTTGTATATATTATATCTAGTATATGGTTTTATGTTTTGAAAACTTAA
TTGTTAATAGTGACCTTAAATATCTATTTTAAGAAGAAATTTAACTCAGAAAATCCTTAT
ATTTTATAAGCACTCATTAAAATATATTTTGTACTGTCTGAATATAAGCCAGAACATCTA
TCATGTAAGGCCAGGTTTTCAAATGAATTAATTTCTTTCAGTATTTTATTTCACTTATCA
AATTTCAAAAACAGTAATTTGGCCCTGGGTTGAGGGGACTGTATCAATGATGAAAACTTT
GTCCAGTTCTGCTGTTGACTTGGAAGTTATGATAAAGTATATCTGAGAAGCCAGTGGGAA
AAAAATAACAATTTAGAGCACATTTGACCATTGATGGAACTTTAACTCCTGAATCCCTAC
TGAAATACATATTCATTTCTGATTTGTAAGGATGCCTACAATCTTGATTAAGGATAGTGC
CCAAGGGTCAGTGTTAATACTCTGTTGGCTTTAACATCATTTGTTATATTACTGTAATTT
TGTCTTATAGAACTGCATTTTGTTTTCTTTTTTTCTTTTTTGGTATTTTGTTTTGGCACA
ACACCCAAAACCAAAACAGCTCTGTTCCTGTCCCATCCCAGGCTCTTTGCTCAGGGATCA
CTCCTGGCTATGTTAAGGGACCTTAGCTGTGCAGGATTGAATTTTGATCAGTCTCCTGAA
TGAAACAAACACACACTTACCTGCTGTATTTTCTGTCTATCTTATTAGAAACTAAAGCAA
ATGATGATTTCTAAAAATATTTTACATACTAAGGCTAAATATTTCATTATAATTCAATTA
TTTTATCTTGTCACTTCTGCTTTATCCTGTTTCTACATCGACCCTCTTTCATCCCTAAAG
TGTATTTTGCTTTTCTTACCTTTTGTGTGACTTTGAATTATGAGCTTTGATTTTTGCTAT
ATATTTTAATCTATGATGAATGGAGAGCCAACTTGAAAAAAAACACTATTCCATACACAG
CATTGATCTATTCCTCACATTATTTTGCCCTTCTTAACTACTCCTATTGCAACTCTGAAC
TCTGTCAACGGTTCTGATTTCCCATTTTAAAGGAAATTGAACCATAACAGGCAGCTTGGA
TATACTTTAAATATACCACAAAATGAATTGAAGTCTCAGTTCTTATACTTTCAGAGCTAT
ATTCACTGCTTTCTGGAAGTTATTTTGTGATACAGTGATTGCCAGATGGTATCTGTCCTG
ATAACTCCATTTACAAAAAGTTGGAAGAGAAAATATTATCAGTCTGTCAACATGAGGTCT
TATTACCCACAAGAAAATGGTCAAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved