Sorex_araneus Locus Mono:165:SNORA9
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:165:SNORA9
Sorex_araneus
Mono:165:SNORA9
scaffold_253974
SNORA9
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCATATATATATATTTGAGTCTCTTTCCCCTGAAC
CTGAAAGAAGCCTCCAGTGTAACACCATTGGAAAGGACGAGTAAAGAGAGGCTTCTAAAA
TCTCAGGGCTAGGATGAATGGAGACGTTACTGAGACCAGCTCGAGAAATTCAACGATCAG
CGGGATGATGATGATAATGATGATGATGATGATGATATATTCACGGCAGAGCCTTGCCAA
GCTGCCTGTGGTGTATTTGATATGCCAGAAACAGTAACTATAGGTCTCATTCCCTAACCC
TGAAAGAGCCTCCCATCGTTGGGAAAGATGAATAAGGAGAGTCTGCTAAAATCTCAGGGC
TGGGACGAATGGAGACGTTCCTGGCACCCACTCGAGTAAATCGATGAACAATGGGCTGAC
AGAGATTCAGTGACAGTGGTTTTAAAATTTACTTGATTCTTCTGCAAGCCTCCAGCGTGC
TGGGGTCTGGAGTGACCCTGTGCATTCCTACAGTGCTTGCAAGAACATTATGGAATGGTT
TGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGTTATAGAAATTTCAGACATGAAAAAAAA
AATTTACTTTATTCTTAAAATTGCATTATTTGAGGGGAGGTGCAGCCAGCAGTGCTCAGA
GGCGGGAAGCCAGCGCGCCGGTGCGGTGCTGCTCTCCGGCCCTGGATTCCTTCTGGCCTC
GGGGCCTTCCCCCAACTCGCTTCTGTTATTCCTCTTAGACACGGTGAGTGAGCTCAGCCC
TCACACAGGCAGGGCCAGCTGCGCCTCAGTTTCCTTAGATGTGCCTTGGACCTCACACCT
GATTCCGCAGCAGAGAATTCAGGGAACCACTGCAGCCGCAGTGAGTCAGGCCTAGAGTAA
GTGCAGGCTCCGCCCTCTGTCCGGCAGAGACCCAGTGAGTATCTGGAGTGGATGCTCATG
GGAGCGGCAACAGACAAAGGCAGCTGCTTCAGAGTTGTCGTGTCTATCGCTTTGCCTGCT
TTTAACACTCGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAC
AATTGTGTAGGTCCCAGCCGTTGCCCAGTGCTCCTAGCCCTGTGTCCCCTGGCCTTGGTT
ATTAGTCTTCTACTATGTATTTTTCACATACCACAGTTGAAGGATCTATTTCACAGTGAT
TTAAAAGAAAATTTAAAATAAAAATACAAAGTCACATTCAGGAGTTTGTAAACTGCAGAC
CATCAATGCGAAGTAGTGAAGTAGCTGCTCTGAGAAGTGGGGGAGGGGCGGGGGGGTGTT
GCTTTCCCCTTCCTGCTCTCCACACTTGCTCCCTCAGGACTTCACGTGTGGCTCTGGTGA
CAGCGGGAGGGAGCCCTTGGCTGGCTGGGATCAGGAGGTGGCTTCCAGGAGCTGGCTTCA
AGCCTCGGAGTGACAGTGCCCCGGCAGACGCCTTCTCGCCCGGGCGCGGGAGTCAGATTG
CACTTGGCAGGTGTCCACTTCAATCCCAGCGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved