Sorex_araneus Locus Mono:325:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:325:SNORA58
Sorex_araneus
Mono:325:SNORA58
scaffold_194052
SNORA58
1001..1127
2042
AGCAAATGGGAATGCCCTGCACAGAGGCAGGGTGGGGTGAAGGGACAGGGTGGGATGGT
GGGAAGGGATGCTGGGATCACTGGTGGTGGAAAATGGGCACTGGTGGAGGGATGGGTACT
TGATCATTGTATGACTGACACGTAAGCATGAAAACCTGTAAGTCTGTAACTTTGTCTCAC
AGTGATTCATTAATAAAATAAAATAATAATAATAATAATAAAAAAAGCACAGTCTACTTT
CCCCAGTCTCTGGTGACCCAGGATCACACCCATAAACCACCTCCTGCTGGCGCCAGATAA
TCTCGTCATTGACCACCATCCAGATCCCACGACTGCTTCTCCCGAAAGGAAGCATACCAC
GAGTTCCCCATAACCATGCCACGGACTCCGCGCCAGGTTGTTTCACCTAGGGCACCCCAA
AGGGCGGGCCCTCCCTGCCCCAAGGGACCCAGCCCTGGCAGCCAAAAACCCCCACAACCC
AACCACTGCCAGGTTCAAGGCTGTTCCCCAGGCACCCAGGCTGAGCCTCACATGTGAGTA
AACATTTTCCTGGACCACGTGGCTGCAAAGCAACACATCATGAAACACTCCCTACCCCCA
GGTGTATTAGTAGCACTGTAGCACTTTCGTCCCATTGTTCATGGAGTTCTCCATAATTAC
CATACCACATTTGGTGGAGTTCAGATGGTAGGCAACAAATCATAGAGGGAAATATATATA
TGCATATAGACATATTTTCAGATATATATACCAAAGCTCACATCACCCAAACTTTAATAA
CATGCCAGTGATATCCTATAGGATGTCTTAATGGTTCCTGCCAAAACAGAACAATCTTCA
CACTGTTTCCTATATGAACACTTTTTTTGTAAGCACATCCAGCAGTTCTTTATAACAGAC
AATAACAAAATATACTATTTTGGTTGTGTTCTGGGACAGGGCTTGGGGCTTGGGATATAA
ACATCCTGAATTTGGTGGTGGGAAGGTGTTTGAATACTGAAGGTAATCAAACATTGTGAC
ATTGTTATAACTTATAACATTAAAAAATTTTAAAAATGTAATGTGGAGTTCATGCCCAGT
TCAATCAGCTTAATCAATGGCTGAATAAATAGCAGTGCTCCTACATTAAAAAAAAACAAA
AGAAGGCACAGAAAAGTTAACTGTGTCCCACTATAATTTAGCTATATTCCAAAGCAAGCC
CAAGTACATTTACAGTAAATAAATACATAACATTACTCTAGGAGATAACATCGCCAATGT
CAAGTATCCAATCAAAAGTTGCTAGGTTTTGAAAGAAGAAAAAAAATATAAATCAATAAT
GAAGAAAAATTCTGATACAAATTTAAGACATACATTGAATTAGCAAGCAAGGGCAAATTG
CCAAAATGTAGACTCATGAATATGTAAGAATACATCAAATTTTAGAGGCTGAAAAGATAG
TATAGTGAGTGAGTGGCTAGCCTTGCATGCCACCACCAGGGATCAATCCCGAAGACCACA
ATATGGTGCCTTGAGCACCGGCAGGAGTGATCCCTGGAGCACAGAGCCAGAAGAATGCCC
AGAGCACGACCAGATGTGGTCCAATTCTCCCACCCCCATCATAAAAAGAAGACATCAAAT
TTCTGGAGATAAAAATCTACAAAGTGGGCTGGAGCGATAGCACTGTGGGTAGGGCGTTTG
CCTTGCACGCGGCCAACCCGGGTTCGAATCCCAGCATCCCATATGGTCCCCTGAGCACCG
CCAGAAGTAAGTCCTGAGTGCAGAGCCAGGAGTAACCCCTGTGCATATCCAAGTGTGACC
CCAAAAGCAAAAAACAAACAAACAAACAAACAAAACAAAAGAAAACCAAACAAAACACCA
AAGCAAAAAATCTACAAAGTGTGAAGTGAAAATCATATTAGCTGGAGTTATTGTCAGAGA
AATCGAAAAAAAAAATAGTGAATTTAAAAGCACAGAAATAGAAACTGCAGATGGAAAACA
AAAGGAGAAAAAAATAACAGTGCGACAAATGAGCTACTGAACAGCTCAAGCATCCTAGTA
CAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved