Sorex_araneus Locus Mono:795:SNORA70
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:795:SNORA70
Sorex_araneus
Mono:795:SNORA70
GeneScaffold_5316
SNORA70
1001..1134
2134
TAAAAAATGAAAACATAGTAATTGCTTTTCCATATAATTTCCAAAAAAACATATAATTG
CTTTTCCATAATCATTTGGGATTATATATTATATGTATGCCATATTACCACTCTAAAATT
AAAAACAACAATCCCGAAACACATTTACTATCCAGATTTCCCACACCATTTAATCATCAG
TCTTGGCCTGAGTTCTGGCTATTTGCATAAATCAGATCCACCTGCAGATAATGAATATTC
ATTGCAGTGTGTGCTAGAGATTCATAAGATGATGTGTTTTGAGCCATGTCTTTGTGATCA
AAACAAGGTTTAAGGCTTCTTGAGTGACTACCTTGAAGTGGCAAGACCAATTTCGCTGAT
AAGGTATGATGTGTTCCTGAATAGCCAATCTCATTATCAGATTCCTTGTTTACACATTAA
CAGTCAATGGTCAGTGATCTTCTAAAATTAGTTCTCCAATCTGGATTTATTTTTTTCCTC
CGACTTAAACATTTTTTAAGTTATTTTATTGGGGTGGAGGGTTTTGGTTCACACCTGTCA
GTGCTTAGGGCTATTCCTGGCTATGTTCTGGGGTCTACACGTGACCTTAGGAAGTGCTAG
GGGATTATGTTTATTTTCTTTTATTAAAAGCTAGTTGGTGGGGCCTGAGAGATAGTATAG
TGGGTAAGAAGCATGTGGCCAACCTAGGTTCTATACTAGGCATCCCGTCTGGTCCTCTGA
TCCTGCCAGGAGTGATCCCTGAGTGCAGAGCTAGGAGTAAGCCTGGGACACATCTCCAGA
TGACCTAAAATCAAACAAAAAATTTGGGATAGTGGTTTTGGGGCCACACCCAGAAGTGCT
CAGATGCCATTTCTGACTCAGAGCTCAGGGCCCACCCTGGATGTGCTCAGGGCCCACACG
CAGTGCTGGGGATAGAATCAGGATTGTGTGCCAAGCAAGTCCCTTAACCCATGTACTATC
TCTCTCCTAAAAGTCTATGGTTTATGAAACAAAATGAAAAACTGTATAAGCAAACCATGC
TGCTTGCCTGTGAGGCCTGATGTGCAGTGTGCAGTGTCTGCAAATGACAGTCCCTCTGGT
AGTGTTTGCGGCCTGTTGCTTGTGTAGGCTGCCCAAAGGGACTTCGAGAAGGGCCTTTTG
TAGGGGAAGGCTCGGAGGGGTTGGGACTTTAGACGTTTCCTAGTCTTAGGCTCCAGATAT
TTGAGTGCCGCCGGAAAGCTTCATAGCATGGTGGCCAGAGTTCTCCCTGACTTAAGTCAC
CACATGTTCATCTGCATCAAACTGCAAAGCATGGAGCAAGTGACTGAGACGCTTGACAGG
ACCAAGTTCAAGTTTCCTGGCAACCAGAAGAGTCATGTTTCTGAGAAGTGGGACTTTAAA
AGTTTAATGAGGATATGTTTGAAGACATGGTGGCTGAAAAGCACCTCTTACGTGATGGCT
GTGGGATCAAATACATACTCAGTGAAGGGTGAGGGTGCAGGGGGCTGGAGAAACAGCACT
TGCTTTGTAGGTGGCAGACTAGGGTTCTATCCCTGGCATCCCACATGGTTCCCTGAGCCC
CGCCAGGCGTGATCTCTGAGTGCAGAGCCAGGAGTAAACACTGAACACCGCCTGGTATAG
CCTAAAAAAAAAAAAGTGTTGCCCCTGGACAACTCGGGACCCTCGAAGAGTTCTGCACTG
TTGAGAGCCTTGGAGCTGCCCCCCCACAGCCCCTCTGAGTCCCACCATGCTTCTCCCAAT
AAGTCCTGCTTCCTAGCCCTAAAATTAGTCTAGAGTTTATCAATTTCTCTCAGTTCTTAC
CTAATTTATTTCTGTTTCATATATTTTATTTAGGACTGAATCGATAGCACAGCGGGTAGG
GCGTTTGCCTTGCACGTGGCTGGCCTGGGTTCGATTCCTCCGTCCCTCTTGGAGAGCCTG
GCAAGCTACCGAGAGTATCCCGCCCGCACGGCAGAGCCTGGCAGCTACCCGTAGTGTATT
CGCTATGCCAAAAGCAGTAACAAGTCTCACAGTGGAGACGTTACTGGTGCCCGCTCGAAC
TAATCGATGAACAACGGGACAACAGTGCTACAGTGCTATCTTTTATTTGCTTCTGGATCT
CCCCCAGGAGTACTGGGGGATGGGGGAGACTGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved