Sorex_araneus Locus Poly:15:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:15:SNORA58
Sorex_araneus
Poly:15:SNORA58
GeneScaffold_2618
SNORA58, SNORA65
1001..1129, 2830..2933
3933
AAACTCTATTACTGGCCTTGCTTCAGAGACCCATAAATAAATCTCAAAAGAGATCAAAA
GCCAGAGACACAGCAGCAATTCCCGGAAGACACGACAGAGCCAGAGATCTCTCTGAGCCC
CATACCGAGCCAATTTCACTGGGGCACCCCAGATGGAGCAGGTGCACTCTACCGCGCCTA
CTCCAGATGGAATCCTGGTTACCAAGAGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTGGTCC
CAGAGGACACTTAATGGAATCTCAAATGAATTAGTTCCCTATAGAAATTTCTCTGGAACC
CAATCGTTTACATCTAGGATTCCAGAAGCACATGGACCATGATATTAAAAATGAGCGATG
GACAAGGGGCCGGAGCGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCAGCCGACCC
GGGTTCGATCCCCGGCATCCCATATGGTCCCCCAAGCACTGCCAGGAGTAATTCCTGAGT
GCAAAGCCAGGAGTAACCCCTGAGCATAGCTGGGTGTGACCCCCCAAAAAAAAAATGAGC
GATGGACAATAAATGATCTAGCATCTATCCCTGGCAGGCAGGCTTGAATGATGGTGGGAA
AATTTGAGGAAAACATAATGTCCAAAGGTAGAGAGAGAGCATTAGGGAAATTGCCTGCCA
TGGAGGCAGGGTGAGGACTGGGATGGGGGCAGGGGGGATGGACTGGGGACACTGGTAGTG
GAGAGTGTGCATTAGTGGAAGGATGGGGTGACACTGGTGGTGGAGAGTGTGCATTGGTGG
AGGGATGGGTGTTCAATCATTGTACGGCTGAATCTCAAACATGAAAGCTTTATAACTATC
TCATTTCATGGTGATCCAATAATAATAATAATTTAAAAATTAATGTAGAGTTCATGCCCA
ATTCAATCAGCTTAATCAATGGCTGAATAAATAGCAGTACTTCTACATTAAAAAAAAGAA
TAAAAGTACAAAGAGGAATACAATCAAGTTACTTGGTGTGGTGTAATTAGACAACATAAA
GGTTTGTATTACTCACCTTGGACCCTGAAAGGGCTTTATTAACTACTAAGATAGGAAAAA
TTTTAAAAGTATTTAATCTTGCTGGACTGCTGGCCCCAACTATGGCAGCTGTAAAAATCC
TAGAGCTTTCCCTAAGTGGAAGTGATGGAGGAGAAAAGATATCCTCTGTTGGGGACGGGC
CTGGGCACCCCCTGCCTTAGTTCCTGTAAACGGGAATGAGTATGGAGAAACGTGGCGTGA
GGGCGAGTCATCCCCTGACAGCCAACCTTGACAGGCAGCCGAAGGGCCACCATGCTCTGG
CGACCTGCCTCGAGAGAAAAGTTGAAGGGCCACCATGCTCTGGCAGCTGGACTTGAGAGG
AGGCTGAAGGGAGGATTGGCTCGTGTCTGCCATGGCCATGCTCAAGGCCATATCTGCTTT
CCCATGTTTCTCAAGGCTGAGAGAAGGAACCGAAAAACAAGTAAGATTGGCAAAAATAAA
GATGCTCTCACCACTTAATAATGTTTATGCCACTTAGGTAACCTGCTGATCATTGCTAAG
CTAAGACTATATAAACCTGCTTGGATTTCAATAAACTTGATGTATGCCCCATATTGCATG
CAGTCCTCCCTAGCCCACTCAACTTTCATTCCCTCTCTCCGGCCGAGGTTCAAGTTGGCC
GCGCAGGCCGCAGCAATCCTCAGCTGGAAGAACATAGACTTTCTAAGATTCAAATGACAG
CCTACTTTCACTTTATTTCAGAGGGATGAATTTTATTTTATTTTTTATTTTTAAAATTTT
ATTGAATCACTGTGAGATAGTTACAAGCCTTCATGTTTGGGTTACAATCACACAATGATG
AAGCACCCATCCCTCCACCAGTGCACATTTCCCACCACCAATATCCCTGATGTATCTCCC
CTTTCCCACCCTCCCCCTTCCTCCATGGCAGACAATATTCCCCATACTCTCTCTCTACTT
TTGGGCAATATGACTTGCAACACAGACACTGAGAGGTCATCATATTTGTTCCATTATCTA
CTTTTGGCACGCATCTCCCATCCCGACTGATTCCTCCAGCCATCATTTTCTTAGTGATCC
CTTCTCTATTCCATCTGCCTTCTCCCCTCTGCTCATGAAGCAGTCTTCCAGCTACAGAGG
GGTGTATTTTAAGCCTTTGTGTGAGGCTTAGATACTTTTAACATTACTCTGTAGAGAAGT
TATGATGTGATAACTGAATGGTATTATATGTTCAGACAGAGAAACAGAAAGCAGATAAAG
GTTGCCTTATAAATCTATTTTTATGATTGTAACCCAAACATGAAGGCTTGTAACTATCTC
ACAGCGGGGACAGACATAGAAAAATTGCACTCATTTGTGGAGTATAAAGTAACAGAATGG
GAGACTTACACCCAAAAATAGTAGAGCTAAGTACCTTGAGGATTGCACCATGGCTTGGAA
GCCGGCCTCACATGCTGGGGGAAAGGAAGCCCAGATAGAGAAGGGATCACCTTTACTTGG
GTGCTTGGAGGGTCCGCTCGGGATGGGAGATGCGAGCTGAAAGTAGACTATAGACCAAAC
ATGATGGCCACTCAGTACCTACTTTGCAAACCACAACACCCAAGAGGAGAGAGAGAGCAA
AAGGGAATGCCCTGCCACTAGTGCAATCCAGTGGTGAGTTGAGACTAAACCCCAGTTTAG
GAAACAGGGCTGTTCTTCATAGGATGGCTCTGTGCTGAAACCATGGGAATAGCCTGAATG
GGGTGTGTTTTGTGGTGGTAGGAAATTGAACACTAGGACTTAGTTACTGGTGTATAAATG
TTTGCTGCAGCATTATTCACAAAAGCCAAACGATGGAAACACACCAACTGTCCATCAACA
GAGGAATGGGTGAACAAAATGTGGAATTACAGAATATTTATTTAGCCACAGAAAGTCTTA
ACATATGCTACATCATGGACAAATCTTGAAAACATACTAACTGAAGTAAGTTATATAGTA
TATATATAAAAGTATTAAGAAGTATCAAATGTACATAGATAAATAAAGTCAAGTTTGAGG
GAAGTAAGAAATGGGGAGTTAGTTATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved