Sorex_araneus Locus Poly:1:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:1:SNORD113
Sorex_araneus
Poly:1:SNORD113
scaffold_253301
SNORD113, SNORD113
1001..1070, 1217..1286
2286
AGGAAAATGGATAGGTAGTTAATTTGTTTCATGCCTAATTATTTACATGAATAAATAAA
TGACCATTAGACATCAAAATCAGAAAAATTTGTGCATCACTGATGAGACTATGCCATAAT
ACAAAGATTTACATTTATCCAATTTTACGCAACTGAGGTCCATTAAAAGCATTCACTGAG
CTGTTAAATTTATGAATAGGGGATTTTGTAGACAGATATTTATGGTACCTAATGGTTCTT
ATCTCATTGGTGTTCATCGTATTATTTAAAATAAGAATGAAATAAGTTAATAAGTAAGGA
AGACCATTCTTGGGCAATGATGAGCTTATGAAATGACCCAAGCTTATTATTAATGCTGTA
AGTCTAACTCCCATTAAAATATGACTAACCAGAAGCTTTTTCTTTCTTTAGAGTCTGCAT
TTCACACGGCGAAGCGGACACACCACGCCGGCTTTATCATTCTCTAGGTGTTAAGGATCA
TGGCTCTCACAAACTCTGGGTAAGGAGAGAAGAGATTGATGAAGGTAATAGTTCCAGTTT
ATGTGCTGGGGTTGGAAGGTTGGCTTATAGGGGTTGCTTGTAATTTTCAAGGTAATAGAT
GGATATATTAATAAATGAAAACAAATAACACCCACATAGGCCACCTACGAATGGGTATTT
TATCTACTATCACGCACTGTGGGCTGCCATCTTGGAGTCTGGCTCCCGTATTATGGTCTC
TTAACATGGACACGTTAGTTAGAGGAAGGTAATTAGGGACAAAGTAGAAATCTGGCGTTG
ATGTTAAGCACAGAGGTGATTGTACGTGTAATGCTGAGTTTCCTTACGAAAAGGTGCAGT
CCTGAAGATTCCAGCTTAGCGACACTCAAGGATACCGTTTCTAACTTTTTGCATTTCCAT
ATACACATGTCTAGTCAGTTATCTGTAACGTGAAGTAAGTGCTAGAGGGAGACAGAAATG
CGAATCAATGGTGTGATTAAGTAAACTGAAGGATGCCAGTCTGAACCAATGATGAGTGTT
TGGGGTCCCTGAACCAATGGTTCTGATTAAACCCTTAACTCTGAGGTCAGATAAGTAGCC
AATGGCTACACAGGTTGATTCTAGCTTTCTGCATTTACATATGTACAGGTGTATCCAGTT
ATCTGTAATGTAAGTAAGTGCAGCAAGCTAGAAAGAGGGAGAGAAATGTGAATCTGAAGT
GTGACTAAATGGCAATCTGAACCAATGATGAGTGTTTGGGGTCCCTGAATCAATGACTCT
GATTAAAACCTTAACTCTGAGGTCAGATAAGCAGCCAATGGCTACGTGGCAAACATTCAT
AATATTCAGGATTTTGTTCTTACGCCGTTAAGGTTTAATACAGTCAGAAGATTACCAAGT
ACATAAAGACCAAGGCAAGGAGAGAGCCAGGTGTGGTCTAATGATTAGAGAATGTGTTGA
TTATTATTCAGCTATTTCTGAAGCACTTTGTTCCAACATAAATTGGTTTCTGTTTGTTTG
TTTTTGGGTCGCGCCCAGTGGCACTGAGGGATCACCCCTGGTGGGGTTCGGGAAACTCTC
TGTGGCGCTACAGAGTGAACCCGGCCGACTGCGCGCAAGGCAAGTGCCCTACCGTCCTAC
TGTTGCTCAGGCCCGACATAAGTTGATTTTAAGCGATGCCCGTGTGGGAAAGGAGTGTAT
AAGCAGCAAGAAACTGTCGGTGTTCTGCATTGTTTGGGGGGTTCTGGAGAGAGACGGGGA
ATATTAGAGTGGGGAGGGAAAAGACAGTCACCAGATGGTCTTTTTCATACGTGGACTATT
AAGAAACATGCAAACCATATAGTCGTTCCCAAGGTAGTTGTGAAAGTGAAAAGTATCTTG
AGACTTCGGTGATGTCCTCTGGGGGGCAACATTCCCCGTGGTTGGAAGCACTGGGGTACA
CCACGGCCCAGTAAGGACCATGTATTTTGAAAAAAATATGAATCTCTCTCCTCTCTCAGT
GATGCTTAACTGGGGGGAGGGCGGGAAGAACTCGTCTCTTCCCACTGTGGATCCAGTTCA
TCTACGTAGTTGCATTTAGTGGCATAGCAGTTTGGGTTCTTGGTAGGTTGATATTATTGT
TTTTCTCTATAAAAAACACTTGTCCTGAGCCAAGAGAGATAGTCCAGAGGAGATGACACT
TTCCCGGCATCCCCGTGGCCCTATGTCCAATCCCCTGCACCATATGTAGTCCCCCAAACA
CAGCCAAGGGCCACCCCTGGGCTCAAAGCGAGGAATAACCCTTAAGCATCACCAGGTGTG
GGTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved