Sorex_araneus Locus Mono:507:SNORA28
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:507:SNORA28
Sorex_araneus
Mono:507:SNORA28
scaffold_230004
SNORA28
1001..1119
2119
ATGCAGCAAGTTGCACGGTCTCACATTTCCTCAAAATGTGATGCTACTCATAGTATCCC
ATTGTGTGCATAGGCCAAAGTTTCTTTATCCACTCATAGGAACATTTTGAAATAGGAATT
GAATTTCTCTAAAGTTCACATTTTCTGTTTCATTCTTGGGGTTCTTTTGGGCATAAAATT
ATTCACAGTATCCCCTTGTGCCCAATTTGGCACACAAGTTGTTTCCTGATCTTGGCTGTG
ATGAACATAGGTGTGTATATGTCCTTTTGGATTAAAGTTTTTGTGTTCTTGGGGTAGGTG
CTCAGGAGTGGAACTGCAGAGTCAGGTGGAAGCTATGTTCTTAATTTTTGGAGAAATCTC
CAAACTGTTTCCAAAGAGGCTGAAGAAACAGTTCCCCTTCAGAATGCTGTGTCTTCTAGT
CACTATAGTTATTTGGGGGCACCATCACTAGGGATATTGTGCATCCTGTGCAAACTGCTC
CTACTGATCATGGGAAACAAACACACAAGGACTGTCCAAGCGAACCCAGGGTGGCCATTG
CTCCCCCATGATGGCTCCCAGCAAGTGAACCTTTAAGTTAACAGAGACCTTAAGGACAGT
TAATAAGCATATCAAGATCAGTAGGTACGTGAAGAGCCAAGACTCGGGTATTTCACATAG
CAAAAAATATCAGGCACCCTTAAAGTATAGAGTAACTTCAAGATAATTTCCTATATAATT
TTTGCCCAAGTTGCCCTCTGCAGCTAAAAGACCCTAAACTGTTTAATTGTTTGCTTTTCC
GGGCACACTTCCTGTGGCATGTTTGCAGTCACTCTCTATTCCTCATCTCTCCTATTCTTT
CCTATTTTCCTATACTTTACTTGGTGCATGTTTGCAACTTCATTCTGTTCTAAGGCCTAC
ACTTGCTTTATTATCCTGGGGAATCTCCCAACCTTGGAATTTTTTGTTAGGGGGATGACT
TCTCACACATTAGCAGCAGAGAAAAGTTCATTTTTTGTTGCAGTCCACACTCAGTAGCAG
ATGATCCAAAGTGTCTGGTGCATTTGCAACAGCAAGGCAGTCTAACCTATTCCGGTGCTC
TCTTCTCCATGAGACAAGCTGTTATATAGACTTCAACAGCATTAAAAAATAGTTCCTTGC
TATCTGGCAAACCACATCCTTGCCAGCATTTATTGTTTCTGGTCTTTGTGATATAGACCA
TCTCCCTAGTGCGAGGTGATGTCCTGTTGTCATTTTGATTGCATTTCCCTGATAGTCAGT
GACAGTGGGCATGTTTTCATATGCCTGTCACCTGTCTTTATGTTATCTTTGCTGGATAGC
CTGTTCATCTCTCCCCCCATTTTTTTTTGATGGGGTTATTTTTGTTGTTGTTATTGAGCT
TTGAGATTGCTTTTTATCGTCAGTATTAGCCCTTTGATGTTTGATTTACAAATATGTTCC
CCCATTCGGTGGGGTATCTTTTTATTTAGGCTTCATTTCTTTTGCATTGCAGAATTATTG
TTTATTTAGTTATTTTTTTAGTTTGACATAACCCCATTTGCTTACCTTTGCTTTTGTTTT
CTTTGCCAACGCGGTCATATCATTTGAAGACTCCTCCGAGGTCAAGATCTTAGAGTCCTG
CCTGTGTTTTCCTCGTTGTATAGAAACAGGTTTGATACCAAGGTCTTTAATCCATTGACT
CACCCTTTGTTTATGTTGTGAGATAGAGGTCCAATTTAATTTCTGTGGCTATCCAGTTTT
TCCAGCACCATTTGTTGAAGTGGGTATCCTTGCTTCATTTCATACACCTAATCCTTTGGT
TGTAAATTCACTGTCCATATATTCTGGGGTTCATATCTGGGCTCTCAGTTCTATTCCATT
GATTTGAGGGTCTGTCTTTGTTCCAGTACCATGCAGTTTCGAGTACTGTGGCTCTAGAGT
AAAGACTAAAGTCTGGGAATGCAGTACTTTCCATATTCTTTTTTCTTAGGATTGCTTTGC
CATTATGGGAGTTTTGTGGTTCCATATAAATTTTAGAAGTATTTTATGTCCTTGAAAAAT
GCTGTGGGAAATTTTGGTGAGGATTGCATTGCATCTGTAAATTACTTTGGGTAGGGTGTT
CATTTTAACAATCTTGATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved