Sorex_araneus Locus Mono:49:SNORA18
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:49:SNORA18
Sorex_araneus
Mono:49:SNORA18
scaffold_241655
SNORA18
1001..1114
2114
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGATGTCAGGAGGCAAGGAAGGAAGGAAGGAAGGAAGGAA
GAAGGGAGGAAAGAAGGGAGGAAAGGAAAGGAAACTTTGAACTTCCTAGAGGAAATTGTC
AAAGAATGAAAAAAAATTAACATAACCATATACTTTAATGACCAGAGGAATTTTCCTAAA
TACTCACGTAGCTGGAAATGTCTCATAGAGTCACGTGGCTTTGCTTTACTCACGGAACTA
TTTGTTAGATCTGTGGAAAGAACTGCAGGACAGTACTGTCAACAGCATGAAAGACTGAAT
GGTTGCATCTTTTCCACTGTAGGTACCAGCATATCCCACAGTTTGTTCTATTCTTGGCTA
TGATTGCTTATGGGAATGATTTCAACTTATTCTTATTTCAAAGGTGTCTGAAATTAAAAC
CCAGGCATATCAACTACTGTCACCCTAAAGTAAATCACTTAAAGAAATTAGATCCCAAAG
ACTCTAGGTGTGATTGTGGGGGTTGGGGGGGCCCGGGGGAATGCCTAAAGCATGACATCA
TTATTTCCATACTCAAGTGGCCATCAAAGAAGCTGAACTCAAAGAATTTAGAGGCTGACT
GACAAGACAACTGTGAATTATATATAGGGTCTTTGAAAAATGATTATCGTGAAAGATTGT
AGATGTGGCTCAGTGTTAAAGAGCACTCTTTGTGTGTAGTCAGTCCTGGGTTGAATCCCA
GGTACTTAAATTCTTTTCTCAAATATAACCTTGGCTCAAACTTTGGAGAAACTAAGGTGG
TTTTGATGTTCAGAGGAAGGAATCACAGCACGTAAAGCCACAAAACCAAAGGAAACAAAA
CTATAGATTCAAACCACAGAGCTGCAGTTACTAAAAAAAAGAGCAGAGTGCTCTGCATGG
GGGAGGAAGTCTGCTGGACTATCACTGTATCACTGTCATCCCATTGTTCATCTACTTGCT
CAAGCAGGCACCAGTAACATCTCCATTGTAAGACTTGTTACTCTGTTTTTGGCATATGCC
ACAGGTAGCTTGCCAGACTCTGCCGTGCGGGCAGGATACTCTCGGTAGCTTGCCGGGCTC
TCCGAGAGGGACAGAGAAATCGAACCTGGGTCGGAAATATGCAAGGCAAATGCCCTACTC
ACTGTGCTATCACCCCAGCCACTGGATTATAGTAGAAGAATATTGGGGCTGGAGAGATAG
CACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCAAATCCCAGCATCCC
ATATGGTCCCCTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved