Sorex_araneus Locus Mono:441:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:441:SNORD113
Sorex_araneus
Mono:441:SNORD113
scaffold_166894
SNORD113
1001..1069
2069
CACCCGCCTCTGTGGCAGGGCATTCCCTTTTGTTCTCTCTCTCTCCAGTTGGGTGTTGT
GGGTCTGCAATAGGGGTGTTGAGTGGCCATTGTGTTCAATGTTTTTAAAAATCTCCCACT
GGACTTTGTACTCCCCAGAGTGGACCCCTGAAGCTCACTGAAGCAGTGCCCCCTGGTGGC
CAGTGAAAGAACTGCATCATCGTCGCCCCGAGACCAGCCTGTGAATTTCAGTGGTTCTGT
TCAAAGGTAATCCATCGGCTTCTTTGGCCGTCTGAAATATACCTAGACGAAGTGATGTAT
ATCCTTAATACCAAACACTTATTTTACTCTCGTACTGGGAGCAGCTGTGTGCAAGGCAAG
CGTCCTCCCCGCTGTACGATCTCTTTGCCCCCCCCCCCCCCGCCCCTTTAAAAGGGGAGA
GTAAAACACGTTTCTCCCCGCTGAGAGAGTACTGTCTCCAGGAGTTCCATTTATAAGCCG
CTCCTTCCCAGTCCAGAAGTATCCATACCCCATCCTGGGGCCGTTCCTAGCCTGCTGCAA
TGCGGTGGTCTCCTAATGCCCCCACCCCACCCCACCCCTGCACTTTCCCATATAGAATGG
GTGCTTGGGAGTGGAGGTGGGGAACAAGCAGTGATATTTTCCCAGGTCTACCCTTGCCGG
GTTCGATTCCTCCGTCCCTCTCGGAGAACCCGGCAAGCTACCGAGAGTATCCCGCCTACG
CGGCAAAGCCTGGCAAGCTCCCCGTGGTGTATTCAATATGCCAAAAACAGTAACAGCAAG
TCTCACAACGGAGATGTTACTGGTGCCCACTCGAGCAAATCGCTGAACAATGGGACGGTA
GAGCTGCAGGGCTACCGGGAGCAGCGTGGTTTGCCGGAAATCCACTCTGCAAGTGAAGGA
TGCCAGGGAGGCCTGTGGTTTGTTTAATGTGGTTTCAAGGTCACGGTTAGAGAATCGAGA
ATTGGGAACATTAGCAAGTGGCAGTGTAGGGCGACAGGCGGTGAGCTGGATGATGACCAC
TGGTGGCGTATGAGTCATCTACGATGAATACGTGGGACTCTGAGGCTCGCCCGGGCACGG
CGGACACCATCCGCCTGCTTGAACCATCCAGAATATTCACGATTTCTTTTTTTTTATGTT
TTATCCTCGGCTCTGCGATGTCTTCCTTAGCACGGCGCCCTCGAGCGGAGGGCTCGGCCG
GTGGTCACCGCTGGAGAACAGATACAGATGCTGACGTGAGTCCTTGGGGGAAACCGTCTT
CCTGCCTCCTCACTGTCCTGGCACTGGGAAATACGTCATCCCAAAATGCCGAATTATTTT
CGTGTTAAGTGTGGTGTTTGTGAAGCATTGACCAGTCTGGTGTGTATTTAGGACACTAAG
GATTAAGAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved