Sorex_araneus Locus Mono:154:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:154:SNORA58
Sorex_araneus
Mono:154:SNORA58
scaffold_238129
SNORA58
1001..1123
1757
ATTGGCCTTATTTCAGAGACCCATAAATCTCGCAAGAGATCAAAAGATGCAGTTAGGGC
CTGTAGCACAGAGGTAGGCTGGAACCCATGACTGAGAGCCCCAGGCCCACTTGGATCAGG
TCTGGGCCTCCTCCCTCCAGGTTCCCAGTTTTCCAGAAGCTTAGCAGTCACACCCACAAA
CTGCCCCTGGCGCCATGTAATCTCATCAATAGTCAAGACCCAGAGATTATAAACTAAAGC
TCCTGGAAGAGAGTGCCAGTGAATGCGCCAGGCTATCTTCACCAGGCTATCTTTATCCTG
TGCCAGGCTATCTTCACCAGGGAAGCTTGGAGTGGGGAATGTTGAGTTTCCCTCCCCGCC
TCAAGCAGAACTCCAGCAGCCGAAAACCTCCAGAACCCAACCACCGCCATGCCCAAGGCC
ACTCTCCACCTGCTCTGACGAGCCTCACCCAAAATGGGATGAACCTCACCAGAGAGCGGA
CCGGCAGGAAAACCCAGGTAGGCAGGAACCCGTGACTGAGATCTCCAAGCCTGCTTGGAT
CAGGACTGGGCCTCCTTCCCCCAGGTCCCCAGTTTCCAGAAGCTTGGCAGTCACACCCAC
AAACCGCCCCCTGGCACCATGTAATCTCATAGATGGCTAAGACCCAGAAACTATAAACTA
AAGCTCCTGCAAGAGAATGACACAGAATTTCCTGGACATTATATTCTATCCATAACTAGC
AATAAAAAATAAATCGTCTAGCATTGCCTTTTCAGCAGGTTTTGAGTGGTGGTGAGACTG
GTGTTGAAATATAGAATATAACCAAAGTAGAGAGAGAGTATGGGGGAAACTGTCTGCCAC
ACAGGCAGGGGAAGGGTTCCAATGGGAGCTGGGGGGAGAATACTGGGGGTTTTGGTGGTG
GAAAATGTGCACTGGTGAAGGGATGGGTGCTTAATGATTATATGACTGAAGCTCAAACAT
GAAAGCTTTGTAGCTGTATCTCACGGTGAATCAAAAAAAAGGGAGAAAAATAATAATAAA
ATAAAGTTAACATTCAGAATAGAATAAAAAAAAGTAATGTGGAGTTCATGCCCAATTCAA
TCAGCTTAATCAATGGCTGAATAAATAGCAGAACTCCTACATTATTTAAAAAAAAAAGAA
GAAACTGTAAAGACAAATGACCGTGTGGGAGAAACTGATGCATCTGATCAAGAACCGCAA
CTGCAAATCAAAAGAGACAAGCACAATTCTTTTTTTTTCAATTACTTAAAATTATGTTTT
AAATTTTTATTTTAGGCACCAGGATTTACAACGCTGCTAATGACAGGGTTTTATGCATAA
GGATAATAACACGTCTTTAACACTCAACAATAAGAACACAGACAACCCAATTAAAATATG
GGTCAAAGACCTTAAAAGGCGCCTCACTAAACAAGACACACTGATGGAGAATAAGCAGGA
AAAAGCCCTCCCAGCCCCCTGTCCCAGGGAAAGGCAGATCAGAACAATGACAACACCACT
GCATGCCCGTCCAAGTGCCCAGATCTAGGGCTCGGGTGCTAGCAAGAGGCAGAGCACCTG
CCGAACACACAAGAAGTCCTGGTTCCTCAAGGACATCATCGCCCTGGTCCCTGAGCACCG
GGTCACCAGGCTCAAGCATCAGCCCCTCAGGCTGAGCATCACCAGGAGTGGCTCCAGGTG
CCCAAGCACTGCAGGGGTCGGGGTGGGGGGACTGCTATTAAGAAAAAAAAAAAAGCAAAA
ACCTGAAGCACTGACGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved