Sorex_araneus Locus Mono:704:SNORA62
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:704:SNORA62
Sorex_araneus
Mono:704:SNORA62
GeneScaffold_4911
SNORA62
1001..1146
2146
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCG
CGAGCTGTAATGTCTGCTGCGCCCCCACTCCGACTGTACGCTCGCCCCAGGATCACTCTG
AGGTGCTAGAAGTTTCTCCATGTGAAATGCTAGCTCTTAGGCAAAAGAGTAAGTGGGCCG
CATTCTCTCCACCTCGCTGTTCGTGCATATAAAACTCTAGTGCAATCTGGAAGTTTCTAA
AATTACCCCACCCCTCCAACAGTAGCTTCAAGGAGCTCAGAGAGAGAGAAAAAGACGACA
CCAAAAACAAACGGTGCGAGGTAGGTAGGCGGACCCCATCCAAATGACCTGCCGACCCAT
AACGCAGATCAATAATTCAGCAGTTAGAAGAGTAGGTAGCGTCCTGCAGGAAGGGCAAGT
TTTTCGAAAACACCATAAGGTTCTCTGGCCCAATGAGTGGAGTTTGATATTAATTCTTGC
TACAAATAAAATTTTGAACGTGTAAGTTTAGAAAGGATGTACACATTTGGGAAATATGGC
CTGATTTCTTATGTGTTGTCTTGCTACCTTACTTGGGTCTCTTAGGTACGAATTGACCTT
TCTTTTTAGACCAACTTGGTAAATCCTAAATTAAGATCCCAAAAAGGGGAGCTCACTCCA
TGATGCTGGCTGGATGCTAGCCCGGGAGGTTCTGCGCATGCGAAGCACCATTTCCCTGAA
CACCCATGGGAGATCATGCCTGATCCCTGCTGCTACAGAGATCCTGAGGAGATTGGAAAG
GAAGCGCCCGCTGCTGCTCAGAAGGCTGTGACTAAGGACGAATTTCGGAGGGAATGGACT
GCCCCAGCTCCAGGTTTGCTGCTGCTCAGCCTGAGGTGACAGACTGGTCAGAAGAGGAGC
AGGTGCCCTCTGTGACCATTCAGCAGTGCCCTCCCGAAGGCCTGCCACAGAAGAGTGCCC
TGCAGCTCCCATGCTCAGGCCACTGAATGGGTTGGAACCACTACCAAGTGGGTTTAAACT
GCTCTTCCACAGACTCACATGGGAAATGAAAATAAGATTGATGGGAAATAATTGAGTTTC
CAAAATAATAATTCAACAGCTTGGCAGAGGGAGGGACTAGTACATGGAATTATGGGGCAG
TCCCCAAACCTAACTCCTTTCTAACACCGGAGCCTTTCCGGAAGCTTTCCAAGATGGTAC
GGCCCCAGCAATTCTCAGGGAAATGTTTCCATGACTGGTGAGAAGAAGCAGTAAGACTAA
CTAAATGACCAGTCTAGGTGCTTACACGGGGGAGGACTAGGGAGAGGAAGAGGAGGAGGA
GGGAGAGCACTTGCTTTTCATGTGTGAGGTCCTGGATTGATGATCTCCAGCACAGAATGT
CCCTTCACCCATGAGTGCACCAAGGAGCGACACCGCAGGCCATAGCAGCCAAGATGGGCC
AAGAGCAAGTCCAAAGCATGGGATCTGAAATGGCTGGGGAAGAACGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved