Sorex_araneus Locus Mono:174:SNORA36
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:174:SNORA36
Sorex_araneus
Mono:174:SNORA36
scaffold_152844
SNORA36
1001..1143
2143
TTTTCAGTTCAATAATTTCACCTCTGACACTCCTTACTATATGATGCCTTTCTCTTTTT
TGGGTGACAATTTCTTTTAACAAGCAAAAATGATAATTAGGCACCATATGGGATGCTAGG
ATCAAACCTACATCATCCACGTGCAAGGCAAGCAAGCATCCTACCCATTGTACTAGCTCT
CCAGCCCCCAATTTTCAAGACAATGTTTTATAATTATAACAGTCACATCTTATGTATATT
TTGTAATTTATTAAAACACTTTGATAATCTGACCTACAAATAAATCTTTGTGTGAGCCTC
AAATTACTGTCAGAACAAATATTTTTCTAGTTGTTCATCCCTCAGATATAAACAGTATCT
AAAATAGCACAAATAAATACATTTATGTACATCACTGTCACTGTCACTGTCATCTCATTG
CTCATTGATTTGCTCGAGCAGGCACCAATAACGTCTTCATTGTGAGACTTATTGTTTTTT
TAAAAATTTATTTATTTTTTAATAGTCACAGTGAGGGTACAGTTACAGATTCACACATTT
TTGTGCTTGCTTTTCCCTTGTGCAATGTTTGAGAGCCCATCCCTCCACCAGTGTCCATTC
TCCACCACCAATGAACCCAGTATCCCTCCCACCCCCTCAATCCCATCCCCCCACCCCACC
CCGCCTCTGTAGCGGGGCATTCCAATTTGATATTTCTCTTTCTTTTTGGGTGTTGTGGTT
TGCAATAGGGGTTTTGAGTAGTCATCCTGTTCAGTCTTTAGTCAACTTTCAGCACGCATC
TCATTGTGAGACTTATTGTTACTGTTTTTGGCATATCAAATACACCACTGGTAGCTTGCC
AGGCTCAGCCGTGCAGGCGGGATACTCTCGGTAGCTTGCTGACTCTCTGAGAGGGACGGA
GGAATTGAACCTGGGCCGGCTGCATGCAAGGCAAATGCCCTACCCGCTCTGCTATCGCTC
TAGCCCGTTTATGTACATAACAGACAATAAAAATAAAAATTAACCAAGGTGTTGAGCATA
GTTCAGGACTGTTCTGGTAATTACCCTGTTCTAGTAATTAAACTTGGGGACAGTAAGACA
GGGGCTGGGAGAGATGACTGGATAGTAGTTATTTCTCTATGTATTTCCCACCTAGCCTAC
AAAAAACAAATATACACAAACACAAAACTAGAGCCTGAAGAGATAGCTTGGGAGGCTAAG
CACATGATCTACATGCAGGAAGCCTGGGTTTGATCCCCTGAACACGACTGGAAATGACTC
CCAAGGACTATGCCAGAAGTAGCCCATTAGCACTGACAGATGTGACCCCCAAACAACACA
CACACTCACACACACACAAACACACACACACAGACAAAAAATGCCTCTTCAGGCTCCCAT
CTTTGTTTCGTTTACACTTGCTTCACTTTAGGAAGAATTTTTCTTTCTTTTTGTTACTTG
GGCTATACCCGGAGTGCTCAGGGCTGCTCATGGCCTGTTGCTTGGTGGGGGTGTAGTGGG
GGTTTGGAAACTCCTAGAGAGCTTTGGGGACTGCACTGCTGGTGATTCAGTTTAGGTAGA
TATCTACTCACGTATTTTAGGGGTTCAATTTATGAATAGAGCTTCCACAGAGATGTTTAT
GTACATATTTTGAAAATAACAGGCATGACAAATTTCCTTAGAAAAAAATCTTTAATATCA
ACATACTTGGAATGTTTTGTAAACACAATATTCAATTTTCAAACACACATTATAAAATAA
CTTTTAGCGAGTTTCAACTGTTCTAATACCCAAAGAACTCCATATTGTGGCATAGAAATG
AACCTATTTCTGTTATACCAAAATGAAGATTTACCCATGTTCTAACATTGAGGAATGAGA
CAAAACATCATTACGCCTACCTAGACATCAAAAGTGACCTGACAGACTATCTTTTGCAGT
TGTTCTGTTTTGCCTCTGGGTGACACCCAGCAGAGCTCAGGAGGTATTGCAGGTTCTATG
CTCAGGGACTGCTAGCAGTGCATGGGGGTACATGAGATGTCAGGGGTTGTATCTGCGCTT
CCTTCATGCAAACCATATGCTCCATTCTGTTGAGTGATCTGGTTCTTAATTTATTTTATA
TATCTACTTGTCCTACTAAATAATGATAATTTGTTTAACAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved