Sorex_araneus Locus Mono:358:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:358:SNORA58
Sorex_araneus
Mono:358:SNORA58
scaffold_197238
SNORA58
1001..1124
1243
GTGTTACAGTGGTTAAGAGGTGGAAGCTACTAAGTGCCAGCTACAAATGGAAAGGAGAG
TGGAATAAGCACACAATGGAAAGCTGAGCCCTTGCCATTCACAGCAAAACGGAAGATGCT
CCAGGGGATTATACAAAGTGAAGTAAGTAGAAAAGTAAACATCGGATGCTCTCATTTATG
TACAGTAGAAGGAAGCAAAGAAAATGGTTGGACAAAAGAAAAATAGGGCTGGAGAGATGG
CCCTGGGGTTCAGCTAGCCCAGGGGTTCAAGCAAGACCCTTGCTTGCACACAGTGGACCC
TGTGACCTTTGAGCTGGGAGTTCCTCCCGAACACCACCTGTGTGACCCAGCCCCCCAAAC
TACAACAAAACACCAGCCTTGTAGACATCAACCATGGAATCAAGATTTCCAACGCTCTTT
CGGCAGCTATGAGTGGTGGTGGGACTGGTGTTGAAATATCGACTGTAACCAAACTGAGAG
AGTATGGGGGAAATTGTCTGCCACATGGCCAGGGGAAGGGTGGGGACAGGAGGGGGAGGG
GAATACTGGGAATTTGGGTGGTGGAAAATGTGCACCGGTGGAGAGATGGGTGTTTGATAA
TTGTATGACTGAAGTTTAAACATGAAGCTTTGTAACTGTATCTCACAATGAATCAATAGA
AAGGGGGGAAATAATAATAATAATAATAATAAATAGCATTGTAGCACTGTCATCCCGTTT
TCATCGATTTGCTCGAGCGAGCACCAGTCCCATCTCCATTGTGAGACTTGTTGTTACTGT
TACTGTTTTTGGCATATTGAATACGCCATGGGTAGCTTGCCAGGCTCTGCCGTGCGGGAG
GGATACTCTCGGTAGCTTGCCCAGCTCTCCAAGAGGGAGGAAGGAACCGAACCTGGGTTG
GCCGCATGCAAGGCAAAAATGCCCTACCCGCTGTGCTATTGCTCCAGTCTATTCTGAATG
TCAATTTTTTTATTATTATTATTATTATTATTATTTTCATAATAATAAAATAATAAAATA
AAATTGACATTCAGAATAGAATATAAAAAATAAAGTAATGTGGAGTTCATGCCCAATTCA
ATCAGCTTAATCAATGGCTGAATAAATAGCAGTACTCCTACATTATTAAAAAAAAAATTT
CCAGAGCTTGCATGGAGGAGGTCTACTGGATATTGGTGAGTGCTTTTTTATTGCGATATA
GATAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved