Sorex_araneus Locus Mono:370:SNORA49
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:370:SNORA49
Sorex_araneus
Mono:370:SNORA49
scaffold_32780
SNORA49
1001..1133
1413
GAGTTGCACGTGGCCGACCCGAGTTCAATTCCCAGCATCCCATATGGTCCCCTGAGCAC
TGCCAGGAGTAATTCCTGAGTGCAAAGCCAGGAGTAACCCCTGAGCATCGCTGGGTGTGA
CCCAAAAAACAAACAAAAAAAAAAAAGTATGGTATCATCAGACACCTAGCACCAAAGTAC
CAATACCTCTTCACAAGGATTTACTGTAACCTTTCCATACTTCCAGTCTACCCTTGGAAA
GCTCAGTTCTGTGGTCAGGTTCTGAGGGCTTGCTTTCATTGGCCCTTTTATGCTCTCTTG
TTTCTTTGTATATGTGAGTGAGATCATCATCTTGTCCTTATGACTAATTTCAATTAGTCT
GAAATAATTTATTTAGTTCCACTGATGTGGCAGAAAAGTCAATTTTTAATCTTCTCTAAT
AGCTGAGCTGCTTTCCATTGTGTATATCTCCCATAACTTTTTTATCTACTCATCTGTCAT
TGGGCACTGGGTCATTTCCAAATTCTTCCTAATGCAGCTAACGTTGCCATGAACATAGGA
ATGAATGTCTGTATCTCTTCATATTAGTTTTTAGCAATATTTCATTTCAAATATTTATTA
TATTTTTAAATTCCCAAGTTGATTTCATTAAATTTTCTAATGTGATAAGATGTCCTATTC
AAATATATGTGAATCAAAATTCAATTATTGAAACACTCACAGTTTTGAAAGTCTATTAAC
CAGCTTGTTAAGATTTTACTAACAATAATAAGTGATTTTCATTTTGATGATCCTACACAC
AGTACAGCTTCTAACATACTGAACAATCTATACACCAATATGAAAAGCATATGTTTTTAT
ATCTTCCCCGTGGTTTTTCATTATTGAGATTTTTATTTTAAATCAATGACCTTAGAATAA
TAGAGAAGTTACTTTAAAATGTAAAAATTTATAAATATCCATTTATTTGGTTATGCCTGC
TATACTCATACTTGATTTAGCTTCTCAAAAAACTTACATTTTTCCCTCTGTCTTCCTCCA
GGGGTTTTTGCCTGTAGAGTGCCCTGGCAATGACTGAGGGTACAGGAAAAGGAAAAGTAG
ACTTCCTTCTTCAGGATGACCATTTCCATTGGGACCTACAAGGTGACTGACAGTAAAGAA
ATAAACAAACAAACAACAACAACAAAAAAAAAACCCTTTACATTTGAACTTCAAAATATT
TAAAAAGTAATATGATAAACAAAACCATAGATCCATAAAAAAGTATGGATTAGCTTTTAA
AAAACTGATCATAAAGTTTATAGTAAAAGGCTGAAGTTCCATAATGACTAGAAATAATGT
CACAGAATAAAATATAATAATTATATTATCTGTATCAAGGCTTACTAGTATTTACAGTAA
TAAAGATTGGTTGACATAGAGAAAAATAGATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved