Sorex_araneus Locus Mono:446:SNORA55
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:446:SNORA55
Sorex_araneus
Mono:446:SNORA55
scaffold_220103
SNORA55
1001..1137
2137
GAAATACTGAGTAAGGTAAAGCAATAGGATACATTGTTAGACCTTGTGATTCTAGTGTG
CCTAAAAGTTTTGCTTCTACTTTAAAAAATGCTGGCATTCGCCCTGGGAGGGGAAAGGTT
TTTCTCTCTCGGCCTTTCCTTTCGCCAGTGGCATCATGACTGCCATCTTATAAGGCCCAC
TAAAGAGAGGTACGAGCTTGCAGTGATGGGGATGTGCAGAAGATCTTGGGATGGGGGGGG
GGTGCGTTAGTGGCGCTGCTCTTGGGCCCAGATGTGACCCCGAAGCAGCCGCACACGAAT
GGCACCTCCATTCCTGAGCGACCACGATCCCGGGAGGCCCACTAACTACTTTCAGCACCC
AGCGGCTCCTTGCAGAAATGCCTCTAGACTGTGAACTAAGCTACGGCCCCGTGCCATCCT
AGGAGGGGAAAGGTTTTTCTCTCTCGACCTTTCCTTTTGCTGGCGGCAGTGTGGCGACCG
CCATCTTTAAGGCCCACTAAACAGAGGTACAAGCTTGCAGTGATGTGACTTCAGGCAGAA
ATTTCTCTAGACTTAATTACTAAAATTCCAGAAATCCAAAACCTCATATGCTCTTCATTC
TCAGCAATGGAAAACAAATTATCAAATGATGCCTTTTCGGTAGGTCTGATGTTGGGGGAA
AATTTGAAATAATAATAGTGAGTTTTCTGTTGAAATATTGAATGTAATCAAAGTAAAGAG
AAAGTAAAGTGAAAATCATCAGCCACACAGGCAGGGGAGGGGGGGTGGGATGGGAGGTAT
ACTGGAGTTTTTGGTGGTGGAACATATGCACTGGTGAAGGATGGATGTTTGCTCAGTGTA
TGACTAAGACTTAAATCTGAAAGCTTTGTAACTTTTCACATAATGATTCAATAAAAATTT
TAAAAAATCAAAAAATTTTTAAAATGTTGGCATTTTAAGTTCCTAGGAAATTCATTTTAG
ATTGCTTATAATTGATAACACTATTGAAAAACAAGACAAAGACACCCAAATCCTGACCAT
TCCTTGATGCTTTGTGCTGGTGTGGGGACAGATGGTGCGACAGTACCAGCAGTGGATAAC
CAGACGGGACATTTCCATTTGTTTTGCTTGAGGCTGTCTCTACAACTCTGCCACATTAAA
AAAAAAATGATATAAACCTGTATAATACCTGTTTCATCCATTTATTATAGGTATTTCAAA
ATGTGATGTCAACTCTACTTCCAGATGTGACTGGGGTGTGGCTAGCGGTAAAGCCTTGCA
TGTGGCAGGCCCTGATTTGAACCCCAGCAGCAAAGACATTCGGGTGCACTTGGCAACATT
CAGACCTGATGTGTGCAAGTCAGGCATTTTCCCCATTGCACTGTTCCTGGGTGGTTGTCA
GAATGGAATCTTCTCTTTGGGGAGGACGTGTGTGAGAAGGGTTGGGGATCCACTTTGAGT
CCAGTCTTAATCACTCTCGGATGTGGAACCAGAGAAGGGGTGTAAAAACGGAACTGGAAA
GGAAAGTAGCAGAATCCTTTTAAAATGTGAATCAGAGCATTTCCTAAACTCTTCAAGTTC
TACTGTAGCATGTATTTCACTTGCTCTAAGGAGCTGCATTCTTCCTTCTCCTGGGTTCCA
TGGGGGAAAAGAATGCCCAGGCACATTCCTGGGAAGATGGATTGCTTTATCTGATTGTTA
AGTGTGTGACAGAAAAGAGGGCTTCAGTCTTCATCCCTTTAGGAGGGAGCAATCAGCAGG
AAGCAAGCACTCTCCTTTACTCTGCCATCATTAGGTAAGCGAGACATTAAGAAATGATGC
TTTCATTTTTCCTGCCAGATAGTGAGGTCAAGTGTTAGCAAGTTCACTTAGGAACCTAAC
GCAGAATCTAACATCTGCACGTCTACCAGTAAAGAAGTTTATTTGTTAACTTCTATCTTT
TCTTCCCTCTCTCCTTCCCTCTCTCCTTCCCTCCTTTCCTCTTTTGCTCCCTTCCTTCCT
TCTTCCCTTCCTTCTTTCCTCCCTTTCTCCCTCCCTTCCTCCCTCCCTCCCTTCCTTCCT
TCTTCTTCTCTTTCTTTCTCTTCCTCCTCCCTTCTTCCCTCCTTCCCTTCCTTTTCTCCT
TCCCTACTTAGCAGTTCTCAGGACTCAATCCTGATTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved